ln cancer therapy - university of toronto t-space€¦ · cancer gene therapy abhijit ghose a...
Post on 07-Jul-2020
1 Views
Preview:
TRANSCRIPT
THE CANARYPOX VIRUS ALVAC AS A VECTOR lN CANCER GENE THERAPY
Abhijit Ghose
A thesis submitted in conformiv with the requirements for the degree of Master of Science
Graduate Department of lnstitute of Medical Science University of Toronto
O Copyright by Abhijit Ghose (1999)
National Library 1+1 dcanacia Bibliotheque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services senrices bibliographiques
395 Weilirigton Sireet 395. rue Wdligtori Ot!awaO(J K l A W -ON K l A W canada Canada
The author has granted a non- L'auteur a accordé une licence non exclusive Licence aiiowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distriiute or seii reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/film, de
reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantid extracts f b m it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.
The Canarypos Virus ALVAC as a Vector in Cancer Genc Therapy
By Abhijit Ghose
A Thesis submitîed in codormity with the requirements for the degree of Master of Science,
Graduate Department of Insitute of Medicai Science, University of Toronto, 1 999.
Abstract
The immunogenicity of recombinant canarypox (ALVAC) viral vectors within whole ce11 turnor
vaccines was evaluated using the early T-ce11 thymic Lymphoma STFl O. STFl O cells were
modi fied with the recombinant ALVAC vectors and injected into syngeneic mice. ControI mice
receiving unmodified cells developed twnors, while mice injected with STFIOIALVAC,
STF 1 WALVAC B7-1 or STF I O/ALVAC 87- 1 or STF 1 OIALVAC B7- l/ALVAC IL- 12 compktefy
rejected their tumors. Rechalleage at day 55 showed that none of these groups were
si gni ficantly protected However, modi fied regimens incorporating two vaccines induced a
protective effect in al1 vaccinateci groups. Notably, the parental ALVAC virus was equivalent
to al1 other recombinant ALVAC viwes in conferring antitumor immunity. Tumorigenicity
experirnents in nude mice revealed that the effector mechanism mediating rejection of tumor
cells bean'ng ALVAC vectors is multifactorid. Finally, in vilro experirnents revealed that
cytotoxic T-cells specific for parental STFlO cells cwld be generated as a result of in vivo
immunization with STF 1 O/ALVAC vaccines..
Acknowledgments
First and foremost, 1 would like to thank Dr. Neil Berinsteio for introducing me to the
exciting field of cancer immunology, and providing the knowledge and inspiration
necessary for any discipline that proposes to look into the nature of life- His unbridled
enthusiasm for learning and exploring infused us dl , and 1 can only hope that in fÙture, 1
can approach science with the same passion.
My sincerest thanks to my program advisors, Dr. Andre Schuh and Dr. David Spaner,
who shaped my project into what it becarne, provided me with academic guidance, and
chailenged me to learn about subjects that were completely alien to me. Thank you to
Jillian Haight, Rosemary Ahrens and Beverly McLaughlin, without them nothing would
have been accomplished. Many thanks to Monica Ghose for sharing her exemplary word
processing talents, this thesis would be quite unpresentable otherwise.
To Jennifer Tomlin and Jane Gillis, thanks for making me feel welcome; to Laurent
Verkoczy, 1 have yet to become a master such as yourself; to Nancy Pennell, th& for
always being there and having the solution to every problem; to Barbara Guinn, thank
you for doubling as a supervisor every now and then and showing me the ropes.
Thanks to Ivan Fong, who taught me what it meant and what it took to be a reai graduate
student; thanks to Maria Lorenzo and Ken Luk, their fnendshîp kept me sane, Thank you
to Elena Iakhnina, who throughout my studentship, was a good friend. excellent teacher
and a worthy tennis opponent. Finaily, my heartfelt thanks to AL Zarrin without whose
mentorship, my faith in science wodd be uncertain. He kept reminding me of the things
that are t d y important in life, and showed through exarnple how to become a scientist,
artist and philosopher at the sanie tirne.
Table of Contents
Absn-acr Acknowledgmen ts Table of Contents LLÎf of Tables a d Figures Lisr ofAbbreviations
Introduction Models in Antitumor Immunity - Recombinant Costirnulatory Molecuie Expression
B7- 1 B 7-2 ICAM 1 4-IBBL
Models in Antitumor Immunity - Recombinant Cytokine Expression
IL-2 I L 4 I L 6 IL-'? IFN-y TNF-a GM-CSF IL- 12
Combination Therapies Utilizing IL- 12 and 87- 1
Gene Transfer Methodologies Physicai Methods of Gene Transfer
Plasmid DNA I n m ~ t i o n Virai Methods of gene Transfer
Retrovirus Adenovins Poxvinises Canarypox V h (ALVAC)
Generation of Recombinant ALVAC viruses Titration of ALVAC v i w e s The ALVAC V h s in Cancer Therapy
Active Imrnunotherapy with tumors Genetically modified via ALVAC Vectors
.. 11 ..- 111
v vii xiv
Current Experimental Approach
Material and Methoth Cell Lines Infection of Ce11 Lines via ALVAC vectots Flow Cytometric Assessrnent of Ce11 Surface Marker Expression Irnmunoassay for IL- 12 production Reverse Transcription (cDNA synthesis) PCR for Gene Expression Growth Kinetics of ALVAC-Mected STF 1 O cells Stability of ALVAC Encoded products over time in ST Tumorigenicity in Wild Type BALB/c mice: Vaccination and Challenge Statisticd Analysis Cutotoxic T-lymphocyte Assays
Preparation of Stimulator Celis Preparation of Effector Cells Preparatoin of Target Cells CTL Setup
Differential Effects of in vitro stimulation on STF1 0 Lysis
Results Heterogeneity in T r o p i d i r a 1 Gene Expression Surface Marker Phenotype of STF 10 Growth Kinetics of ALVAC-Mected STF 10 cells MHC-class 1 expression on ALVAC lnfected STF 1 O cells Stability of ALVAC encoded Products over T h e Decreased Tumorigenicity of STF 1 O cells Modified by ALVAC Vectors
Tumorigenicity in Nude Mice Boosting with whoIe ce11 vaccines bearïng ALVAC vectors confers antitumoral immunity In Vitro Antitumoral Reactivity
Discussion Immunogenicity of the ALVAC Vector Antitumoral Protection following Vaccine Boost Protection against Tumor Epitopes as a Result of Vird Immunogenicity T-ce11 Independent Antitunior Mechanisms In Vitro CTL Activity
Ftrture Directions
References
Tables and Figures
Table 1: Level of IL-12 secreted by STFlO vaccines prior to h u n i z a t i o n of mice
Figure 1: Genomic Organization of recombinant ALVAC viruses
The ALVAC virus vector consists of a Linear double stranded DNA molecule measining
about 325 Kbp. The multiple cloning sites CS and C6 have been inserted as s h o w
above. The ALVAC B7-1 construct consists of a human B7-1 cDNA driven by the
vaccinia H6 promoter inserted into the C6 MCS, The ALVAC IL-12 constmct consists
of two p35 subunit cDNA sequences each driven by one E3L vaccinia promoter, and a
p40 subunit cDNA driven by the entomopox 42K promoter. The p35 and p40 subunit
constructs are inserted into the CS and C6 loci, respectively.
Figure 2: Heterogeneity in ALVAC Viral Transduction
To determine the tropism exhibited by the Canarypox virus ALVAC, ce11 lines of
different lineages and stages were assayed for the ability to successfdly take up the virus
and express the virally encoded protein B7-1, Clear histograms represent cells that were
specifically stained by anti-human B7-1 antibody, while shaded histograms represent
staining via an isotype matched non-specific antibody. Results indicate that recombinant
B7- 1 is expressed only in select tissues represented by NFS-70, B 16, ST, as well as two
vii
ST subclones STFlO and STG4. A20, K465, CI498 and P8 15 are completely negative
for ALVAC-encoded products.
Figure 3: Surface Marker Phenotype of STFlO
STF 1 O cells were stained with antibodies specific for the surface-expressed proteins
indicated, and then assayed by ceil cytometry as outlined in Materials and Methods-
Clear histograms represent specific staining for the marker indicated, while shaded
histograms represent irrelevant stahing of STF 10 via a non-specific isotype matched
antibody. STF10 cells are CD44+, CD25-, HSA+, CD4 low, CD8 Iow, and CD3-.
Figure 4: RT-PCR analysis of ST-FlO, and STFlO infected with ALVAC, for TdT,
RAG-1, RAG-2, and HPRT.
ST-F 1 O yields the expected size PCR product for RAG-1. RAG-2, as well as TdT. The
positive control for PCR ampification of TdT consisted of a genomic sample fiom mouse
tail-DNA. Positive controls for amplification of RAG-1, RAG-2 and HPRT consisted of
various cDNA preps of the mouse Pro-B Ce11 Iine NFS-70.
Figure 5: Growth Characte~tics of STF10 Cells af'ter infection Ma ALVAC vectors
STF I O cells were infected with ALVAC B7-1 as outlined in Materials and Methods, and
then replated in culture media at a concentration of 20,000 cellslml. Growth was
viii
monitored over a penod of 4 days, and was compared to the growth rate of a STFlO
culture that was plated at the same concentration, but was uninfected with ALVAC B7- 1.
Resuits indicate that infection of cells via recombinant ALVAC vectors does not alter the
growth characterstics of the STFl O ceils as the rate of expansion of the two cultures is
almost identical.
Figure 6: Effect of ALVAC viral lnfection on MHC class I expression via STFlO
cells
STF 1 O cells were infected with ALVAC B7- 1 as outlined in Materials and Methods, and
assayed for the expression of MHC 1 at tirnepoints corresponding to 6 hours into viral
infection, and 24 hours following viral infection. Results indicate that there is no
downregulation of classical MHC class I ( H - ~ K ~ and i 3 - 2 ~ ~ ) as the geomtric mean
fluorescence of infected cells is 17 at 6 hours, and 19 at 24 hows, compared to unidected
celk which display a geometric mean fluorescence of 14 at 6 hours and 1 5 at 24 hours.
Figure 7: Stability of ALVAC Encoded Products Over Time
Because the ALVAC viral vector is non-replicative in mammalian tissues, the expression
of ALVAC-encoded products will be transient as the population of cells divide and
ALVAC proteins approach their haif-life in situ. The SCID Thymoma ce11 line ST was
used as an indicator of ALVAC product stability: SCID Thymoma bulk culture was
transduced with ALVAC-B7-1 and half the culture was irradiated to stop it fiom dividing
further, while the other half was kept in log phase. Both cultures were assayed for
ALVAC-encoded 87-1 expression at discrete tirnepoints. Results indicate that in a non
dividing culture, GLVAC-encoded products can be detected by immunostaining upto
four days (> 96 hours) post infection, whereas for a rapidy dividing culture, expression is
optimal for about two days (48 hours), after which expression levels start declining, and
is Iost completely at four days.
Figure 8: Survival of Mice Post STFlO Tumor Variant Vaccination
STF 1 O tumor cells were infected with a) No virus b) ALVAC c) ALVAC-B7- 1 d)
ALVAC-IL- 12 or e) ALVAC-B7- 1 and ALVAC-IL- 12, and injected subcutaneously
into mice (using 5 mice per vaccine). Mice receiving cells alone succumbed to twnor,
whereas mice that received cells containing either parental or recombinant ALVAC
vectors al1 rejected tbeir himors at a fiequency of 1 00%.
Figure 9: Lack of Systemic Protection against Wild Type Challenge After a Single
Vaccination
Subsequent to vaccination of mice with STF 10 transduced with a) No Virus b) ALVAC
c) ALVAC-B7-1 d) ALVAC-IL42 or e) ALVAC-B7-1 and ALVAC-IL-12, ail
surviving mice were challenged at day 55 with a subcutaneous injection of wild type
(unrnodified) STF 1 O cells on the opposite (left) lateral flank. Previously unvaccinated
(naive) mice were also injected with wild type SFlO cells as a positive controi for
tumorigenicty. Survival of ùnmunized mice is not statistically improved for any group
denoted above (p > O.OS), even though there appears to be a delay in twnor formation in
mice previously immunized with STF 1 O/ALVAC-IL- 12.
Figure 10: Tumorigeniciîy of STFlO Variants in Nude Mice
STF 1 O cells were infected with parental or recombinant ALVAC vinses as desctïbed in
Materials and Methods, and injected subcutaneousIy into nude mice. All anirnals
receiving cells alone succumbed to tumor in both experiments (A & B). Animais
receiving STF 10 celis containing either parental or recombinant ALVAC vectors
displayed tumor rejection at statisitically significant (p < 0.05) fiequencies, relative to
mice receiving cells alone, in both independent experiments.
Figure 11: Survival of Mice Post Wild Type STFlO Challenge Followuig Vaccine
Boost
Mice were prîmed and boosted with cellular vaccines of a) STFlO / ALVAC b) STF 1 O /
ALVAC-B7 1 c) S E 10 / ALVAC-IL- 12 d) STF 1 O/ALVAC-B7- 1 and STF I O / ALVAC-
IL-12. In addition, one group of mice was only prirned with STF 10 / ALVAC-IL-12, but
left unboosted. Vaccinations and boosts were administered subcutaneously, on the right
flank, with the boost taking place 35 days after the initial vaccination. 21 days post the
boost, mice were challenged subcutaneously on the left flank with wild type SV10 cells
and assayed for survival. Naive controls that had not been previously vaccinated al1
developed tumors, while al1 other vaccinated groups displayed improved survival relative
to naive mice @ < 0.05 for al1 groups relative to naive mice).
Figure 12: Specific Activity of Splenocytes from STFlO/ALVAC-IL42 immunized
mice
Mice were immunized with STF 1 OIALVAC-IL- 1 2 and spleens were harvested on days
1 3, 1 7, 27 and 3 5. Splenocytes were stimulated with STF 1 O/ALVAC and specific killing
against STF 1 O/ALVAC-IL- 12 (A & B) or wild type STF 1 O (C & D) cells was evaluated.
Cytolytic activity was observed on day 27 against STFlO/ALVAC-IL42 cells (B) and
not STFlO cells (D). No cytolytic activity against either type of cells was observed on
day 1 3 (not shown), day 1 7 (A & C) and day 35 (not shown).
Figure 13: Effects of Differential Stimulation on Splenocyte Reactivity against
STFlO
Mice were imrnunized with STFlO/ALVAC and then boosted with the same vaccine. 21
days following the boost, splenocytes fiom an immunized mouse and a naïve control
were harvested and stimulated with STFlO (A & B) or STFIO/ALVAC (C). Results
indicate that cytolytic precursors specific for STFlO are indeed present in the splenocyte
culture (A), in addition to those specitic for STF 1 O/ALV AC (B); however, their detection
xii
is dependent on stimulation with wild type STF 10. Stimulation via STF 1 O/ALVAC does
not yield efficient cytotoxicity against wild type STF10, relative to naive controls (C).
xiii
Ab breviations
APC P-gai bp CEA CEF GY CHO CLMF CM CNS CON-A CTL DNA DTH D n : FCS GP GM-CSF HPRT IFN IL IRES Kb LCMV LTR MBP MCS Me MHC pCi MOI MS NK NKSF NTP PBS PBMC Pfù PHA PLP RAG R-EAE RG RNA
Antigen Presenting Ceil beta-galactosidase base pair Carcinoembryonic Antigen Chicken Embryo Fibroblast centigray Chinese Hamster Ovary C ytotoxic T-lyrnphoc yte Maturation Factor Culture Media Centrai Newous System Concanaval in-A Cytotoxic T-lymphocyte Deoxyribonucleic Acid Delayed Type Hypersensitivity DithioxytreitoI Fetai Calf Senun Glycoprotein Granulocyte Macrophage Colony Stimulating Factor Hypoxanthine Phosphoribosyl Transferase Interferon Interleukin Intemal Ribosome Entry Site Kilo base Lymp hocytic Choriomeningitis Vins Long Terminal Repeat Myelin Basic Protein Multiple Cloning Site Mercaptoe thano 1 Major Histocompatibility Complex microcurie Multiplicity of infection Multiple Sclerosis Naturd Killer Natural Killer Stimulatory Factor Nucleoside Triphosphate Phosphate BufSered Saline Peripheral Blood Mononuclear Ce11 Plaque Forming Unit P hytohemagglutinin Proteolipid Recombination Activating Gene Relapsing-Rernitting Experimental Autoimmune Encephalomyelitis Rabies Glycoprotein Ribonucleic Acid
xiv
r W SCID TdT TMEV TNF VSV
recombinant Vaccinia Virus Severe Combined Immunodeficiency TenninaI deoxy nucleo tidy k Transferase Theiler's Murine Encephalomyelitis Virus Turnor Necrosis Factor Vesicular Stomatitis V h
Introduction
Advances in our understanding of antigen presentation and effector activation have
provided the basis for new and exciting strategies for the therapy of cancer. It is widely
believed that spontaneous tumors arise due to an acquired ability of cancer cens to evade
immune surveillance, a process whereby immune effectors specifically recognize and
eliminate tumor ceiis fiom the body (1).
Normally turnor cells express various protein epitopes (tumor rejection antigens) on their
ce11 surface via theu MHC class I and class II molecules, which can be specifically
recognized by T-cells (2). In the course of a progressive cancer, the interaction between
the cancer ce11 and the T-cell. which shodd cause specific activation of the T-cell, does
not occur. This could be induced by several factors including immunological ignorance
of the tumor cell, down-regdation of MHC molecules expressing the tumor antigen (3),
down-regulation of costimulatory or adhesion molecules, loss of tumor antigen due to
genetic ùistability (4), and expression of immunosuppressive cytokines (5).
Thus, rnany biological therapies against cancer are aimed toward reactivation of these
tumor antigen specific T-cells. One such approach in active irnrnunotherapy involves the
modification of an MHC expressing ce11 iine by transfection of a gene encoding a
costimulatory molecule (6). This costimulatory molecule provides the second activating
signal to the T-cell, the fist signal comprising of activation via the T-ce11 receptor as it
recognizes a cognate MHC-peptide complex on the antigen presenting ce11 (7). Once a
cytotoxic T-ce11 is activated it can specifically recognize and kiil other cells with or
without receiving the costimulatory signal,
An alternative strategy is to introduce into the tumor ce11 a gene encoding a cytokine (8).
Cytokines can have a wide array of targets and effects, and generally they serve either to
activate immune effectors like T-cells, NK ceUs and macrophages directly, or recmit
professionai antigen presenting cells (APC). These APC take up tumor antigens, migrate
to the lymph node and then activate T-cells more potently due to a greater number of
costirnuIatory molecules present on their surface (9).
Models in Antitumor Immunity - Recombinant Costirnulatory Molecule Expression
In order for T-cells to be activated against an antigenic epitope they must receive two
signals from the antigen presenting ce11 (10): signal 1, arising fiom cognate interactions
between the MHC-peptide cornplex on the APC and a complementary T-ce11 receptor on
the T-cell, and signal 2, arising from a costirnutatory molecule on the APC and a
complementary receptor on the T-cell. Various ce11 SUfface receptors have been shown to
ddiver costimulatory signals to the T-celis including B7-1 and B7-2, 41BB-Ligand,
CD40-Ligand, ICAM 1,2, and 3, and LFA 3 (1 1).
Expression of costimulatory molecules has also been used in active immunotherapy
models, whereby tumor cells have been genetically modified to express genes which
provide this second activating signal, and manipulate the immune system to mount a
response against the tumor cells,
B 7-1
In a landmark paper, Chen et al. (6) showed that transfection of a murine melanoma
KI 735-M2 with an antigen E7 and the costimulatory molecule B7-1 induced complete
tumor rejection in 100% of mice, after an initial phase of tumor growth. This rejection
was dependent on the presence of the antigen E7, and was abrogated in nude mice,
showing that the in vivo response was T-ce11 mediated. More specifically, depletion
experiments showed that CD8+ cytotoxic T-cells were responsible for tumor rejection
and CD3+ T-helper cells could be removed without changing the antitumor response.
Furthemore, wild type tumors could be rejected with concomitant injection of B7-I
expressing tumors on the opposite flank, and 4 day established lung metastases could be
cured in 40% of mice with injection of 87-1 expressing tumor cells.
Townsend and Allison (12) performed a sirnilar experiment where they showed that
KI 735 cells were rejected at a fiequency of 90% if expressing recombinant B7- and that
this was an effective vaccine in mice, as 90% of the survivors were protected upon
rechallenge. Once again CD8+ T-cells were responsible.
Subsequently, however, Chen et al. (13) found that the inherent immunogenicity of the
tumor ce11 may be a factor in B7-1 mediated antitumor irnmunity. They assayed four
immunogenic lines RMA, EL-4, P8 15 and E6B2, and four non immunogenic lines MCA
101, MCA 102, Ag104 (sarcomas) and B16 melanoma and found that in the
immunogenic tumors, recombinant 37-1 expression induced 100% rejection, while in al1
the non-irnrnunogenic tumors, B7-1 expression had no effect. Furtherrnore, in v i m
anaiysis showed that the ody two immunogenic tumors tested, EL-4 and P8 15, induced a
CTL response fiom irnmunized mice, while the non-immunogenic tumors MCA 102 and
B 16 did not.
B 7-2
A second B7 molecule, designated 87-2 was cloned in 1993 by Freeman et al. (1 4 ) ,
based on its ability to induce T-cells to produce IL-2 and proliferate, and the abrogation
of this activity by CTLA4-Ig but not anti-B7-l antibody. Subsequently, B7-2 was also
tried in several active immunotherapy models. La Motte et al. (1 5 ) showed that P8 15
mastocytoma cells expressing B7-2 were just as effective as B7-1 expressing cells in
inducing an antitumoral response, and 87-1 and 87-2 tumor variants were equally
effective in retarding the growth of established tumors. Yang et al. (16) also
demonstrated that P8 15 cells expressing B7-2 were immunogenic, and protected mice
against wild type challenge through specific recruitment of CD8+ T-cells only.
[CAM 1
Initial active irnmunotherapy studies with ICAM 1 showed that ICAM 1 gene
transfection into the mwine fibrosarcoma MCA 105 significantly slowed tumor growth
(1 7, 18). Subsequent work by Uzendoski et al. (19) revealed that with MC38 tumor
cells, expression of ICAM 1 stimulated concanavalin A-activated T-cells to secrete TNF-
a. As well, a specific alloreactive cytotoxic T-ce11 reaction was observed against MC38
cells that were expressing recombinant ICAM 1. in vivo MC38 cells that were
expressing ICAM 1 were rejected at a fiequency of 100% and hirthermore, dl surviving
mice were protected from M e r tumor challenge, even when the dose of the challenge
was twice that of the immunogen.
4-1 BBL
4-1 BB ligand (4-IBBL) is a type II surface glycoprotein which belongs to the tumor
necrosis factor (TNF) family, and is expressed on antigen presenting cells such as
activated B-cells, macrophages and splenic dendritic cells (20, 2 1 ). It is a costirnulatory
molecule which can activate T-cells independently of CD28-engagement by either 87-1
or B7-2, but can also synergize with the latter two molecules, especially at low levels of
CD3 activation (22). in vivo studies have shown that like B7-1, expression oE4-1BBL on
tumor cells can effectively activate T-cells against the respective tumor, and in the long
mn, confer antitumor immunity. Guinn et al. (23) demonstrated that while A20 cells
expressing B7-1 were 100% tumorigenic, and those expressing B7-2 were more
immunogenic, A20 cells expressing CBBL in conjunction with B7-2 were completely
rejected in syngeneic mice. Furthemore, challenge of surviving mice with wild type
A20 revealed protective effects in 90-100% of rnice, depending on the clone that was
used as the immunogen Similarly, Melero et al. (24) showed that P8 15 cells expressing
4-1BBL were rejected in >90% of mice, and al1 surviving mice were protected against
systemic challenge. Antibody depletion experiments showed that only CD8+ T-cells
were required for tumor rejection when tumor cells themselves were expressing 4- 1 BBL,
and both CD4+ and CD8+ T-cells were needed if wild type tumors were already
established (24,25).
Models in Antitumor Immunity - Recombinant Cytokine Ex~ression
Cytokines are key modulators of host immune and idammatory responses. The transfer
and expression of cytokine expressing genes into tumor cells has yielded a novel strategy
to augment antitumor reactivity in various murine models. These gene modified tumors
have been shown to induce a rejection of the -or variants themselves, and in many
cases, induce systemic irnrnunity against the parental tumor cells.
Toward the goal of reducing tumongenicity via stimulation of local immune and
inflarnrnatory reactions, a number of cytokine genes have been used to genetically
rnodi* tumor cells (26,27). These include IL-1 (28), IL-2 (29,30), IL-4 (3 1,32), IFN-y
(33-39, IL-6 (36, 37), IL-7 (38, 39), IL-12 (40,41), TNF-a (42, 43), and GM-CSF (8).
The pleiotropic effect of cytokines on the various arms of the innate and adaptive
immune system poses a problem in establishing a definite mechanism by which tumor
cells are rejected. Because different cytokines ultimately affect different downstrearn ce11
types, different models of antihunor immunity have evolved.
IL-2
A variety of tumor models utilizing expression of IL-2 have been tested, including a
colon carcinoma CT26 and a melmoma Bl6 (291, a fibrosarcoma CMS-5 (30), a
mastocytoma (44), a mammary adenocarcinorna TSA (49, a fibrosarcoma MCA 102
(46) as well as bladder and lung carcinomas (47,48).
Predorninantly, the ttunor rejection or onset delay that is observed upon injection of
tumor cells expressing IL-2 is mediatec! by cytotoxic T-cells, though in some cases,
neutrophils and NK cells have been implicated (45, 46). A protective immunity toward
parental challenge was also found in a nunber of these cases- In a mode1 of an
established tumor, Comor et al- (47) grew a 7 day bladder carcinoma MBT-2 tumor in
mice, and observed a decreased tumor size with concomitant injection of radiation killed
IL-2 secreting cells.
I L 4
Unlike studies with IL-2, -or rejection models utilizing IL-4 secreting cells have
shown a number of different effector mechanisms to be responsible, depending on the
particular turnor line studied. Using a renal carcinoma RENCA, it was shown that local
rejection was actually T-ce11 independent and mediated by eosinophils; however,
systernic irnmunity toward wild type challenge was conferred and this was mediated only
through CDS+ T-cells (3 1). Studies with the J558L plasmacytoma showed eosinophils
and macrophages to be the major effector in confemng rejection of tumor cells, as
defined by blocking with specific antibodies against granulocytes (32).
IL-6
IL-6 is usually classified as a cytokine that is involved in uiflammatory responses and it
is produced by macrophages, monocytes, as well as activated T-cells (49). It has also
been shown to be able to increase cytotoxic activity of T-cells in vitro (50). IL-6 has
been implicated in both nonspecific as well as specific antitumoral responses. Sun et al.
(37) working with the B16 melanoma, showed that the antitumor responses were due to
mainly nonspecific proinflanmatory effectors like Macrophages and neutrophils.
Porgador et al. (36), working with the Lewis Lung Carcinoma D122, however, showed
that IL-6 conferred a reduction in both tumorigenicity as well as metastatic cornpetence
that was a result of T-ceIl mediated function. In addition, IL-6 irradiated cells were a
potent vaccine toward protecting mice against a subsequent wild type tumor challenge'
and moreover, a reduction in established tumor growth could also be obsewed with
concomitant injection of inactivated IL-6 transfectants.
IL- 7
IL-7 is a cytokine known to have a critical role in the development and maturation of
lymphocytes (7). However, this cytokine was also used in the context of antitumoral
immunity by Hock et al. (38) who showed that the plasmacytoma J558L was completely
rejected upon injection of IL-7 expressing tumors into mice. frnmunohistochemical
analysis showed infiltration of macrophages and CD4+ as well as CD8+ T-cells within
the tumor, while subset depletion experirnents showed an absolute dependence on CD4+
T-cells as well as macrophages, but not CD8+ T-cells. In contrast, McBride et al. (39)
showed an increase in the number of infiltrating CDS+ T-cells relative to CD4+ T-cells
within FSA fibrosarcoma turnors expressing IL-7, and splenocytes fiom animals that had
been vaccinated with FSA expressing IL-7 were able to specificaily lyse parental FSA
tumor cells in vitro, giving evidence for CDS+ T-celi mediated effects.
Various murine -or modeis have used EN-y expressing tumor cells to induce rejection
of tumor variants and induce and subsequent protection toward wild type challenge.
Predominantly, CD8+ T-cells have been implicated as the effector subset in the
antitumorai response, in models including a neuroblastoma C 1300 (5 1 ), a fibrosarcoma
CMS-5 (33), an adenocarcinoma SPI ( 3 9 , a colon carcinoma CT26 ( 3 9 , a lung
carcinoma 3LL (34) and a bladder carcinoma MBT-2 (47). In a number of these studies,
MHC class 1 upregulation was observed on the tumor cells themselves. upon expression
of the recombinant cytokine.
Working with a weakly immunogenic fibrosarcoma CMS-5, Gansbacher et al. (33)
showed that upon injection of mice with IFN-y expressing tumor variants, splenocytes
exhibited specific cytotoxicity against parental cells over a set of discrete tirne points.
Furthemore, an in vivo protective effect was seen upon injection of survivors with
parental unmodified CMS-5 cells. Porgador et al. (34) observed that EN-y expression
via retroviral infection of two poorly immunogenic clones of the lung carcinoma 3LL
turned the clones into high expressors of H - ~ K ~ and caused a specific decrease in
turnorigenicity and metastatic growth. In addition, irradiation of IF%y expressing clones
and their subsequent injection into mice induced significant protection against parental
cells, while injection of IFN-y expressing clones almost cured mice canying already
established micrometastases. Esumi el al. (35) showed also that while IFN-y induced
MHC 1 upregulation is necessary for tumor rejection, MHC upregulation by itself is not
sufficient and other downstream effects of IFN-y are integral in making tumor cells more
immunogenic.
ThrF- a
The primary source of TNF-a is usualiy considered to be the macrophage / monocyte, but
various other ce11 types aiso secrete it, including neutrophils, T and B lymphocytes, NK
cells as well as endotheliai cells (49). TNF-a exerts a wide variety of effects on diverse
ce11 types. and plays an important role in defense against infection and tumor growth (7).
Asher et al. (42), working with the MCA 205 sarcoma, showed that turnors expressing
TNF-a regressed in animals after an initial phase of tumor growth and that this regression
was mediated by CD4+ and CD8+ T-cells. Blankenstein et al. (43) demonstrated that
J558L plasmacytoma tumor establishment was significantly delayed with TNF-a
expression; however, in this case, this effect was blocked by an antibody to type 3
complement receptor (CR3) which blocks migration of inflammatory cells like
Macrophages.
GM-CSF
A number of early studies involving vaccination models with cytokine gene modified
cells showed that expression of certain cytokines were capable of augmenting T-ce11
rnediated immunity, defked by systernic protection of vaccinated animais after challenge
with wild type cells. Because it is known that some tumors are inherently immunogenic,
it has been postulated that instead of just having a specific effect of T-ce11 activity,
cytokines might aiso act nonspecificdy by killing the tumor cells and rendering them
immunogenic.
Dranoff et al. (8) addressed this issue speciflcally for the BI6 melanoma twnor mode1
where they made stable expressors of IL-2, 4, 5, 6, GM-CSF, IFN-y and TNF-a, and
vaccinated mice with live tumors expressing one of these cytokines. Delays in tumor
formation were observed with expression of IL-4,6, IFN-y and TNF-a. while only cells
expressing IL-2 were completely rejected. Expression of IL-6 eventually resulted in
death of animals, as did expression of IL-5 and GM-CSF.
Interestingly, while challenge of mice protected via vaccination with IL-2 expressing
tumor variants resulted in 100% mortality, challenge of mice vaccinated with variants
expressing iL-2 and GM-CSF induced systemic protection. This led to a postulation that
while IL-2 expression mediated a local antitumor response, expression of GM-CSF
mediated a more systemic effect. Using irradiated B 16 cells, Dranoff et ai. showed that
vaccination via GM-CSF expression did in fact lead to systemic ïmmunity against wild
type celis, while irradiated cells by themselves did not. Thus, irradiated cells conferred a
level of protection equivalent to other cytokines, while only GM-CSF induced complete
protection. Depletion via antibody administration showed CD4+ and CD8+ celis to be
primarily responsible for tumor rejection.
IL-12
IL- 1 2, originally called cytotoxic T-lymphocyte Maturation Factor (CLMF) is a
heterodimerïc cytokine cornposed of two subunits of 45 KDa and 35 KDa. It was
originally isoIated by Stem et al. (52) on the basis of its ability to synergize with IL-2 to
facilitate cytotoxic lymphocyte reactions, and act as a growth factor for PHA activated
human T-lymphoblasts. At about the same time, Kobayashi et al- (53) had also identified
the IL-1 2 activity which they designated Natural Killer Ce11 Stimulatory Factor W S F )
on the basis of its ability to induce production of IFN-y by resting PBMC and act as a
proliferative stimulus in combination with PHA and phorbol esters.
Afier the murine cDNA for IL-12 was cloned (54), Gately et al. (55) showed that in vivo
administration of recombinant IL-12 caused a dose dependent enhancement of NK ce11
lytic activity when assayed in vitro. In addition, IL-12 treated mice had elevated Levels of
s e m IFN-y. Lastly, rnice immunized with allogeneic splenocytes displayed enhanced
CTL activity against these cells when IL-12 was administered concomitantly with the
irnmunogen. This showed that IL-12 can enhance NK and CTL activity, and induce IFN-
y expression in vivo. Gennann et al. (56) also demonstrated that IL-12 could induce
proliferation of Thl cells activated via IL-2 or anti CD-3, but not Th2 cells.
One of the initial cancer therapy studies with IL-12 was performed by Zitvogel et al. (40)
who showed that injection of IL42 expressing fibroblasts at the site of an established
sarcoma MCA 207 could suppress tumor growth in a dose dependent manner, or
eliminate it, and induce long term irnrnunity towards challenge. Furthemore, IL-12
delivery by irradioted fibroblasts at a distant site led to efficient rejections of established
tumors. Immunohistochemical staining revealed that for mice treated with IL-12
expressing fibroblasts an enhanced number of CD4+ T-cells, CDS+ T-cells and
Macrophages were present at the tumor site.
Tahara et al. (41) subsequently used the MCA 207 sarcoma and showed that genetic
modification of the tumor ceil via retroviral expression of IL-12 also induced tumor
rejection when injected intradennally in mice. Furthemore, a protective immunity was
observed in most anirnals challenged on the opposite flank with wild type cells. Three
day old established tumors could also be cured by IL-12 expressing tumor cells
inoculated at a distal site. Depletion experiments showed both CD4+ and CDS+ T-cells
to be important for long term imrnunity.
Combination Therapies UtiliWig; IL- 1 2 and B7- 1
The synergistic effects of the costimulatory molecule B7- 1 and the cytokine IL- 12 were
initially observed by Kubin et al. in a senes of in vitro experbents involving both
mitogen activated, as well as peripheral blood T-cells. In this report (57) Kubin et al-
show firstly, that 5 days following activation via PHA, culture of T-ce11 blasts with IL42
and anti-CD28 induced proliferation that was far superior to that induced by IL- 12 alone.
Secondly, cytokine profiles were significantly altered as PHA blasts which were
stimulated with IL42 and CHO cells expressing B7-1 showed increased IFN-y
production relative to cells that were stimulated with only one of these agents, or with
anti-C D3 in conj unction with 87- 1. Thudly, human peripheral blood T-ly mphocytes
which were incubated with anti CD28 and IL-12 showed hi& IFN-y production, while
those incubated with either one showed baseline levels. Finally, addition of CTLA-4 Ig
to both PBMC as weil as PHA blasts reduced the level of IFN-y produced after
incubation with IL- 12 and CHO cells expressing B7-1.
Initial antitumor models utilinng IL-1 2 and B7- 1 were established by Coughlin et al. (58)
who showed that while SCK mammary carcinoma cells expressing B7- 1 were rejected in
only 28% of mice, and intraperitoneal administration of IL- 12 only induced a delay in
wild type tumor onset, the combination of rIL-12 administration with B7-1 gene
modification in tumors induced rejection in 92% of mice. Further, while wild type cells
could be effectively eradicated by administration of SCK-B7- 1 cells on the opposite flank
along with rIL-12 administration, rIL-12 by itself had no effect. Antibody depletion
experiments showed CD4+ and CD8+ T-cells to be responsibIe for wild type tumor
rejection.
Established turnor modeis were more successfully treated by Rao et al. (59) who showed
firstly, that even though 3 or 6 day old lung metastases of CT26.CL25 (adenocarcinorna)
could be effectively treated by administration of recombinant vaccinia virus (rVV)
encoding the mode1 tumor antigen P-gal, addition of rIL-12 greatly increased the
therapeutic effect. A M e r significant delay in w o r onset was observed if B7-1 was
also expressed by the r W expressing P-gal, and rL-12 was adMnistered in mcie with
established tumor burdens. This showed that B7-1 synergized with I L 4 2 in effectively
activating T-ceUs against pre-existing turnors expressing the p-gal model antigen.
Augmentation of B7- 1 mediated immunogenicity via intratumorai IL- 12 gene expression
was demonstrated by Pizzoferrato et al. (60) who showed that while A20 cells expressing
B7-1 were delayed in tumor formation (relative to wild type cells), A20 celis expressing
both IL- 12 and B7-1 were completely rejected in wiid type mice. Furthemore, 70% of
the surviving animals displayed systemic immunity in that they rejected a challenge of
wild type A20 cells on the opposite flank. Interesthgly, in this case, vaccination with
A20 cells expressing IL- 12 only also led to 100% tumor rejection, and an equivalent level
of protection against wild type challenge was observed. A synergistic effect between IL-
12 and B7-1 was observed in the established tumor model, whereby wild type tumors
could be cured by A20/IL-12 or A20/B7-1 AL-12 when the vaccines were injected into
the tumor site, but only by A20AL-12A37-1 when they were injected at a distal site.
Tumorigenicity experiments in nude mice demonstrated that T-cells were responsible for
tumor rejection, as A20 cells expressing IL-12 or IL-12 and B7-1 lost their
immunogenicity in these immunocompromised mice.
Gene Transfer Methodologies
A major issue in designing a gene-modified tumor vaccine, or any other DNA-based
vaccine is the type of vector to be used in the expression of recombinant constructs. The
choice of vector often depends on the approach of therapy and the type of response that is
desired. The methods of recombinant gene expression can be broadly broken up into
viral and non-viral (or physical), as discussed below.
Phvsical Methods of Gene Trader
Plasmid DNA Immunirarion
Many of the original studies examining the effects of in vitro genetic modification of
tumor cells on tumorigenesis and subsequent immunity, utilized plasmid DNA as the
vector expressing the gene of interest. These genes included IL-2 (44,45), IL4 (3 l), and
IFN-y (5 1) as well as costirnulatory molecules such as B7- 1 (6), B7-2 (1 9, and 4- 1BBL
(23). In addition, a study comparing the efficacy of 87-1 and IL- 12, both of which were
intratumorally encoded by plasmid vectors, was cmied out by Fallarino et al. (61). They
showed that while immunization with irradiated P8 15 variants expressing either IL- 12 or
B7-1 protected against wild type challenge, established tumors could only be cured by
injection of variants expressing IL-12 and not B7-1.
Because plasmids are not as constrained as most viruses in the exact arnount of DNA that
they need to incorporate, they are good candidates for gene transfer strategies utilizing
varying lengths of cDNA9s. As well, these vectors eliminate the need for working with
live viruses, minimizing health risks, as well as non specific immune responses in the
immunized host. The disadvantage associated with plasmids as vectors is the relatively
low eficiency of ceil transfection. This is particularly significant in the context of cancer
vaccination where stable ce11 luies cannot always be established, and primary cells need
to be transfected at eficiencies as high as possible.
To circumvent the problern of low transfection efficiency and longer periods of time
required to establish variants, an alternative strategy using a "gene gun" has been
developed (50). This strategy involves the coating of the Foreign DNA of interest
through precipitation, and bombarding the tissue of interest with these particles through
use of a helium powered accelerator. Following delivery, the DNA dissolves within the
aqueous environment of the cytoplasm and is available for expression.
In vitro modification of tumor cells via plasmid acceleration through a gene gun was
demonstrated by Mahvi et al. (62). In this report, Mahvi et al. initially bombarded an
adherent layer of B16 melanoma with DNA encoding GM-CSF, and obtained high
expression levels of this cytokine (1000 - 4000 ng/milIion celis/24 hrs). Further, a
vaccination of mice by these cells protected 58% of mice against challenge with wild
type B 16 cells. Finally, heterogeneous samples of primary human turnor ceils could be
successfi.dly transfected with hGM-CSF, upon homogenization of the tumor samples and
subjecting to DNA bombardment within 24 hours of surgical removal. Expression levels
of GM-CSF varied, depending on the patient and type of cancer, and ranged fiom
negligible to 140 ng/million celld24 hours. Lower levels of expression were attributed to
the clona1 nature of B16 (and an inherent ability to express cytokines at high levels),
greater ce11 death in primary cells, differential transfection efficiencies dependhg on
tumor type and stroma1 elements, as well as cytoplasmic size whch restricts the size of
the gold particles that can be incorporated.
Thus, genetic manipulation via plasmid DNA is an attractive approach for in vitro
modification of tumor cells, though traditional methods involving transfection may not be
as efficient. Further, approaches using DNA vaccines that have been implemented
include direct in vivo injection via gene p in murine models (63) and encapsulation
within lipids and direct intratumoral injection into patients (64,65).
Viral Methods of Gene Tmnsfer
Retrovirus
Retroviruses are double stranded RNA viruses which make specific contact with target
cells through surface envelope proteins on the viral capsid. Following initial binding, the
viral envelope fuses with the ce11 membrane and the RNA molecules enter the cell. The
encapsulated virai RNA polymerase then copies the RNA genome into a cDNA
molecule, which integrates into the cellular genome to fonn a provirus (7). The viral
genorne can be read in overiapping fiames, and the main products are gag (structural
protein), pol (reverse transcriptase), and env (trammembrane glycoprotein). The virai
DNA is flanked at either end by long terniinal repeats (LTR) and has a RNA polymerase
II promoter site at the 5' LTR (50).
Because retroviruses in their natural form are infectious and pathogenic, a two
component approach is used for gene therapy purposes. The recombinant gene is cloned
into the sites for the gag, pol, and env proteins, and the cDNA of interest is driven by
elements in the 5' LTR (50). Polycistronic messages can also be cloned, utilizing an
interna1 ribosome entry site (IRES) within the message (66). The recombinant retrovirus
can then be introduced into a packaging ce11 line which then provides the proteins that
cannot be encoded by the recombinant virus (66). This yields functional retroviruses
which are able to infect target cells, integrate into the host genome and express the
foreign product, but are unable to complete the lytic life cycle.
Many of the initial murine studies discussed above, involving cytokine gene-modified
tumor cells, used retrovimses as the vector expressing the gene of interest. These genes
included IFN-y (33), TNF-a (43), and GM-CSF (8). Subsequently, tumor cells
engineered to express retrovually encoded IL- 12 were also employed as a murine vaccine
by Tahara et al. (41). This vector encoded recombinant p40 and p35 subunits of IL-12 as
well as neomycin as a polycistronic message within the MCA 207 and MCA 102
sarcomas. Animals receiving this tumor vaccine rejected their tumor and were
significantly protected against challenge, while animals bearing tumor cells with
retrovirus encoding only neomycin succumbed to tumor formation.
Thus, recombinant retrovinises are aitractive as vectors for active immunotherapy as they
have higher fiequency of ce11 transformation than plasmids, and can generate high levels
of protein expression. In addition, the viral vector itself is non irnrnunogenic, and
therapeutic effects are specifically a fhction of the recombinant genes expressed.
The retrovirus is integrative within the host genome, and while this has the advantage of
conferring stable expression for the duration of the treatment period, it carries the
disadvantage of coderring constitutive, and even toxic levels of expression if the cells
carrying the virus are not eventually destroyed. Furthermore, because of this in tept ive
property, the retrovinis is mutagenic to the ce11 line it is introduced into. Cells also need
to be mitotically active in order to be infected by retroviral vectors. Finally because of
the compact nature of the retroviral genome, recombinant genes only up to about 9 Kb
c m be inserted (50).
Adenovirus
The limitations of the retroviral vector, namely, constitutive gene expression, requirement
for mitotically active cells, and mutagenicity toward host cells, have led to the
development of another viral vector that circumvents these disadvantages. Adenoviruses
have a 36 Kb DNA genome that encodes four early proteins (El to E4) and five late
proteins (L 1 to L5) @O), and like the retrovirus can accommodate approxirnately 8 Kb of
recombinant genetic material (67). Adenoviruses can be rendered replication defective
by deletion of the E 1 region of the genome (68), thus requiring a complementary ceil line
(293) to provide the necessary protein products in tram. Further deletion of the E3
region allows the incorporation of additional recombinant sequences.
Unlike the retrovinis, adenoviruses can be grown to hi& titers (69) and they c m infect
many cell types regardless of mitotic status (70). Furthermore. the virus exists
episomally, eliminating the risk of mutagenesis in the host cell. Also, because the virus
does not integrate into the host genome, and is replication defective, the recombinant
genes are expressed transiently (71). This eliminates the chance of toxicity that may be
incurred by prolonged expression of molecules like cytokines. The only disadvantage
associated with Adenovirus is that E l deteted vectors have been s h o w to be
imrnunogenic by thernselves (72). Repeated administration thus becomes difficult as the
immune system reacts specifically to the virus and the advantageous effects of the
recombinant gene are not obtained.
Despite the one disadvantage, the Adenovirus is still an efficient vector for antitumor
therapy. Warnier et al. (73) showed that a specific CTL response could be elicited
against the murine mode1 tumor antigen P8 15A, after mice were immunized
intradermally with adenovirus encoding this molecule, and their splenocytes were
restimulated with cells expressing P8 1 SA and B7-1. Adenoviruses expressing the
irrelevant protein B-galactosidase did not cause mice to develop a CTL response, even
following in vitro stimulation.
Adenoviruses encoding the recombinant cytokine IL-12 were used in antitumor therapy
by Bramson et al. (74) who showed that direct intratumoral injection of a mammary
adenocarcinorna with Adenovirus-mIL-12 produced significant tumor regression, and
animais who completely rejected their tumors were immune to secondary challenge. A
transient expression of IL- 12 was observed as expected, with IL- 12 levels being highest
between two and three days p s t injection.
Poxviruses
Poxvimses comprise a large family of DNA Wuses that have a wide range of hosts, both
vertebrate and invertebrate (75). The most well known poxviruses are variola,
responsibie for smallpox, and vaccinia, the virus used for vaccination purposes a g a k t
the former, more pathogenic agent (76).
In contrast to retrovinses and adenoviruses, poxviruses have a large complement of
genetic material, approximating about 200 - 300 Kilobase pairs, depending upon the
particular virus (76). The genome of the rnost well characterized poxvims, vaccinia, has
been sequenced (77), and it has been postulated to encode about 260 distinct proteins,
rnost of which are of unknown iùnction, Other poxviruses including canarypox, cowpox
and fowlpox, are thought to encode comparable numbers of genes (76).
Morphologically, poxviruses are roughly brick shaped or oval shaped virions about 400
nrn in diameter (76). Structurally, viruses are encapsulated at the outermost surface by a
network of surface tubules, followed by an outer membrane (75). At the core of the
virion is a nucleoprotein complex, which is flanked by two lateral bodies of wiknown
fünction. The entire genome is comprised of one linear DNA molecule with the single
stranded ends ligated together to form a hairpin loop at either end of the molecule. Also
present within the vaccinia nucleoprotein core are intact enzymes, including a
multisubunit RNA polymerase, a transcription factor, a poly A polymerase, a capping
enzyme, a methyltransferase and a DNA topoisornerase (76,78)-
Cunaryp0.r Virus (AL VAC)
The canarypox virus is a member of a related genus of poxvimses known as
uvipomiruses. Like vaccinia, the canarypox virus also has a large genome, measuring
about 325 Kb (79). DeveIoped at Virogenetics Corp. (Troy, New York), canarypox virus
vectors are appealing as vectors for gene therapy due to a number of reasons. Firstly,
they are able to infect a wide variety of ce11 types (80) with very high efficiencies of
infection (8 1 ). Also, like other poxvinises, the canarypox vectors can accommodate large
genes of up to 25 Kb (82). In addition, poxviruses exist cytoplasmically and so are not
mutagenic toward the host cell that they infect (76, 78). Finally, the added advantage of
the canarypox virus over other poxviral vectors is that it is replication defective within
mamnialian cells (80). While the v i n s can be maintained and propagated eficiently in
chicken embryonic fibroblasts (CEF), the canarypox virus life cycle is aborted in
mamallian cells before viral DNA replication takes place (83). The advantage of being
naturally defective is two fold: firstly, the virus cannot be pathogenic to the entire host
system once it has been targeted to a specific ce11 type, and secondly, genes are only
expressed transiently as the virus is diluted out and eventually lost in continually dividing
cells such as tumors. This helps to avoid chronic toxicities associated with continued
presence of protein products like cytokines. In summary, the advantages of wide tropism,
larger genome, episomal expression and replication defect make ALVAC an attractive
vector in gene therapy as an alternative to other vectors. The disadvantages associated
with retroviruses, such as the requirement for cycling cells, host mutagenicity and
permanent expression are overcome by this vector. Furthemore. an added advantage of
using ALVAC over other established Adenovims vectors is that the size of the
recombinant inserts may be increased to 25Kbp compared to about 8Kbp in
Adenovinses.
Generation of Recombinant ALVAC viruses
The ALVAC virai genome consists of a double stranded linear DNA molecule measuring
apporximately 325Kb (79). Although the genome has been characterized via XhoI
restriction mapping, a complete sequence is yet to be published. Recombinant cDNA
sequences expressed via ALVAC vectors are driven by promoters that are derived fiom
well characterized vaccinia virus genes (80). Specifically, for ALVAC B7-1 the human
B7- 1 cDNA is driven by the vaccinia virus prometer H6, and the expression cassette is
cloned into the C6 multiple cloning site. For ALVAC IL-12, expression of the p35
subunit is driven by the vaccinia E3L promoter and the expression of p40 is driven by
the 42K entomopox promoter. The expression cassettes for p35 and p40 are cloned into
the C5 and C6 multiple cloning sites, respectively (see figure 1).
Titration of the ALVAC viruses
The procedure used to titer ALVAC viruses has been described in detail by Puisieux et
al. (79). In this procedure, dilutions of viral Iysates are added to monolayers of chicken
embryo fibroblast cells (CEF) and incubated at 37"C, 5% COz. Subsequently, viral
media is removed and media containing 1.2 % agarose is added. 3 days later, media
containing 1 -2 % agarose is added again, 24 hours after which plaques are visualized and
counted.
The ALVAC Virus in Cancer Therap
The use of recombinant canarypox virus in cancer immunotherapy is gradually becoming
widespread. Toso et ai. (84) demonstrated that the ALVAC virus was a suitable vector in
providing stimulation of tumor infiltrating lymphocytes ex vivo. In this study , kadiated
pexipheral blood mononuclear cells infected with ALVAC encoding the tumor antigen
MAGE-1 specifically stimulated tumor infiltrating lymphocytes fiom a breast cancer
patient to proliferate. In addition, these lymphocytes recognized an allogeneic B-cell
lymphoma expressing vaccinia encoded MAGE- 1, but not the same ce11 line bearïng wild
type vaccinia virus.
The fact that ALVAC encoded proteins could also serve as effective antihunoral vaccines
was first shown by Roth et al. (85). In this report, mice imrnunized subcutaneously with
ALVAC expressing mutant human p53, or wild type hurnan p53, were significantly
protected against challenge with a fibroblast ce11 line 1 0(3)273.lNTX, which expressed a
mutant human p53 protein. Interestingly, irnmunization with ALVAC encoding mutant
murine p53 or wild type murine p53 also induced significant protection upon challenge
with the same ce11 line. in either case, subcutaneous injection with the non recombinant
ALVAC vector did not confer any protection.
Subsequently, Hodge et al. (86), working with ALVAC recombinants expressing the
tumor antigen CEA showed that immunization of mice intramuscularly elicited
lymphoproliferative as weH as cytolytic T-ce11 responses. Furthemore. significant titers
of ant i CEA IgG was observed in senim- Finally, 70% of mice which were immunized
three times with ALVAC CEA rejected a tumor challenge of the MC38 colon carcinoma,
which was expressing CEA. Injection of this ce11 line in animals receiving an irrelevant
vaccine (ALVAC RG (rabies glycoprotein)) resulted in turnor formation.
Very recently, in a clinical trial conducted by Marshall et al. (87), it was shown that after
vaccination of patients with ALVAC-CEA, an increase in fiequency of cytotoxic T-ce11
precursors specific for CEA could be observed in 7 out of 9 patients. ïhese patients al1
carried the K A - A 2 allele, and afier three intramuscular vaccinations with ALVAC-CEA
their peripheral blood T-cells were able to recognize a HLA matched ce11 line which
expressed CEA.
Active Immunothemy with Turnors Geneticallv Modified via ALVAC Vectors
In an expcrimental approach similar to the one undertaken in this project, Kawakita et al.
(81) looked at the in vivo growth of the RMI murine prostate cancer model, after
infection with recombinant ALVAC vectors. Cells were infected with ALVAC IL-2,
ALVAC B7-1, ALVAC IFN-y, or ALVAC TNF-a, or no virus at all, and injected
subcutaneously. Tumor growth was unaltered relative to cells alone in al1 cases except
with ALVAC TNF-a, where a delay in tumor growth was observed. Complete tumor
rejection was only observed with a combination of viruses encoding MF-a and IL-2,
while other combinations with ALVAC TNF-a had no effect-
To determine whether this prirnary rejection with cells bearing ALVAC TNF-a and
ALVAC IL-2 conferred imrnunity systemicaily, animals were vaccinated with irradiated
cells bearing the two recombinant vimses. and then challenged with wild type cells d e r
ten days. No protection, or delay in tumor formation, was observed after chdlenge.
SCID mice, which have no mature T or B cells also rejected a tumorigenic dose of RMI
cells infected with ALVAC IL-2 and ALVAC TNF-a, indicating that primary tumor
rejection is not mediated by specific immune effectors. In parailel. no CTL activity
against RM 1, or recombinant ALVAC infected RM 1 -variants, was observed with
splenocytes fiom wild type mice that were vaccinated with RM-I bearing ALVAC IL-2
and ALVAC TNF-a.
More recently, Puisieux et al. (79) showed that infection of TSIA marnmary
adenocarcinorna cells with ALVAC recombinants generated some nonspecific immunity
when tumor variants were injected subcutaneously. Cells were infected with ALVAC B-
galactosidase, ALVAC IL- 12, ALVAC IL-2, ALVAC GM-CSF, or ALVAC IFN-y, or no
virus at all. Significant survival was observed only in mice receiving cells bearing
ALVAC IL-12 at 30 days post injection. Interestingly, there was also a delay in tumor
formation in animals receiving cells bearing ALVAC Pgal, relative to animais receiving
cells alone.
A subsequent approach involved multiple intratumoral injections of pre-established 7-
day tumors with ALVAC IL-12 virus, or ALVAC P-gal, or PBS alone. At 46 days,
animals being treated with PBS had dl died, while animals given ALVAC IL- 12 survived
at a frequency of 100%. Surprisingly there was dso a 30% survïval in mice receiving
ALVAC P-gal.
In conjunction with treatment of established tumors with recombinant ALVAC vectors,
mice that displayed a non-necrotic tumor were fürther challenged with a lethal dose of
wild type cells on the opposite flank. 70% of mice that were receiving ALVAC IL12
within their original tumor cleared the contralateral challenge completely. Again,
ALVAC P-gal also conferred some protection as 30% of mice receiving ALVAC P-gal
into the original himor cleared the contralateral challenge.
Irnrnunohistochernical stainuig of tumors treated with ALVAC p-gal and ALVAC IL- 12
revealed a dense infiltrate of MAC-1 positive cells, indicating a presence of monocytes or
macrophages. In addition, in tumors treated with ALVAC IL-12, CD4+ and CDS+ T-
cells were also observed.
Injection of TS/A twnor cells into Nude mice proved to be lethal in al1 three scenarios of
treatment consisting of injections with ALVAC IL-12, ALVAC B-gal or PBS. Thus, in
contrast to the study by Kawakita et al. cited above, this experiment showed a complete
dependence on T-cells for tumor rejection.
The focus of this project was to characterize the mode of action of the ALVAC virus
vector within a lymphoid tumor model. Generally, we airned to observe whether a live
tumor vaccine bearing ALVAC done, ALVAC B7-1, ALVAC I L 4 2 or both ALVAC
B7- 1 and ALVAC IL- 12 would induce an anti-tumoral reaction, through specific T-ce11
activation and if so, whether prirnary rejection of tumor variants would confer systemic
irnmunity toward wild type challenge. The approach specificaily incorporated the
molecules B7- 1 and I L 4 2 for two reasons: fustly, both IL- 12 as well as B7- 1 are known
to have potent effects in specifkally augmenting T-ce11 activation andior killing through
unique mechanisms. Activation of tumor specific T-cells via these molecules may in turn
Iead to the formation of T-ce11 memory against hunor cells, facilitating systemic
irnmunity. Secondly, previous models established in our laboratory have shown the
efficacy of tumor vaccines expressing both IL-12 and B7-1, through plasmid and
retroviral expression vectors. Using the sarne molecules in the context of a novel viral
vector allows us to assess the differential effects of the viral vector aione in augmenting
cancer therapy.
For the purpose of this experirnent, we used the early T-cell lymphoma model STFI O.
We hypothesized that the ALVAC encoded molecules of B7-1 or IL-12, or both, would
indeed render the tumor cells more immunogenic, while the vector aione would not affect
the intrinsic properties of the tumor cells. Our in vivo experùnents show that frrst of all,
the ALVAC virus by itself is 100% immunogenic in that STFlO tumor cells bearing the
non-recombinant virus, are completely rejected in immunocompetent mice. Secondly,
the parental as well us the recombinant ALVAC vectors expressing B7-1 or IL-12 can
induce a protective effect against wild type tumor cells, when the initial cellular vaccine
is boosted before challenge. Thirdly, cytotoxic effectors specific for wild type tumor
cells can be detected in mice that have been immunized and boosted with
STFI O/ALVAC. Finally in athymic nude mice, STFlO tumor cells bearing ALVAC
vectors are rejected to a significant extent, even though not completely as in wild type
rnice. This indicates that primary rejection of tumor variants is mediated by both T-cells
as well as T-ce11 independent mechanisms.
Material and Methods
Ce11 Lines
The mature B-ce11 lymphomas A20, K46J, M12, the melanoma B16-F 1, the pro B-ce11
line NFS-70 and the mastocytoma P8 15 were purchased fiom American Type Cuiture
Collection (ATCC). The SCID thymorna Iule ST was derived from a spontaneous tumor
in a C-B-17 SCID mouse and was kindly provided by Dr. Gillian Wu (Ontario Cancer
Institute, University of Toronto, Toronto, Canada). The acute myeloid leukemia ce11 line
C-1498 was kindly provided by Dr. Andre Schuh @epartment of Medical Biophysics,
University of Toronto, Toronto, Canada).
AI1 cell lines were maintained in culture media (CM) of RPMI 1640 + 10% Fetal Calf
Serum (FCS) + 50 u M 2-mercaptoethano1, at 37OC, in 5% COz, with the exception of C-
1498 and B6-FI which were maintained in DMEM + 10% FCS.
To establish subclones, SClD Thymoma (ST) cells were plated into 96 well plates at
concentrations of 30, 3 and 0.3 cells / well in complete media. Plates corresponding to
each dilution were set up in duplicate. After 14 days, 8 ST subclones were observed on a
plate corresponding to 0.3 cells/well, and these were individually expanded. Two
representative clones were designated STF IO and STG4, and maintained in conditions
identical to those for the parental culture. B 16-FI was similarly cloned via limiting
dilution, and one representative subclone was designated B 16-F 1.2. B 16-F 1.2 was
maintained under conditions identical to those for the parental culture.
Infection of ce11 lines via ALVAC vectors
Al1 parental and recombinant ALVAC vinises were acquired fiom Virogenetics Corp.,
Troy, New York. For infection, ce11 lines except 816-FI were plated at a concentration
of 5 X 10' cells / mL in RPMI 1640 media with 2% Fetal Caif Serum (FCS). C- 1498 was
plated at the same concentration, using DMEM + 2% FCS, while B16-F1 was plated at
50% confluency within DMEM + 2% FCS. ALVAC B7-2 (vCP 1334, Virogenetics,
New York) was added at a rnultiplicity of infection MOI) of 20 P h / celL Cells were
incubated for 10 hours at 37°C and 5% COî, after which they were washed in semm fiee
media, and recovered overnight in their respective culture medium (CM) at 37°C and 5%
coz.
Flow Cvtometric Assessrnent of Ce11 Surface Marker Emression
For indirect immunofluorescent analysis, 1 x 106 cells were centrifuged for 8 minutes at
800 rpm, washed twice in phosphate buffered saline (PBS), and then treated with 1 ug of
the indicated primary antibody. An equal number of control cells were treated with 1 ug
of isotypic control antibody. Cells were incubated on ice for 30 minutes, and then
washed twice in PBS. Subsequently, cells were treated with polyclonal fluorescein
isothiocyanate (FITC) - conjugated goat anti mouse IgM / IgG secondary antibody. Cells
were then washed twice with PBS and then resuspended into 400 pL of 2%
paraformaldehyde / PBS fixative.
For direct immunofluorescent analysis, ceIls were trested with the indicated
Phycoerythrin (PE)- or Fluorescein isothiocyanate (FITC)- conjugated antibody
(Pharmingen), and a corresponding PE- or FITC- conjugated anti TNP isotypic control
antibody. Again, cells were incubated on ice for 30 minutes, and then washed twice with
PBS, after which they were fixed in 400 pL of 20/0 pparaformaldehyde fixative.
Antibodies used for stalliing included purified hamster IgG anti CD3, rat (r) IgG2b anti
CD4, rIgG2a anti CD8, mouse (m) IgG2a anti H - ~ K ~ D ~ , mIgG2a anti 1 - A ~ , rIgG2a anti
B7- 1, mIgM anti h.7-1 , rIgG2a anti B7-2, polyclonal FiTC-conjugated goat anti mouse
IgM/IgG, or FITC-conjugated Goat anti hamster IgG. CD44, CD25 and HSA were
assayed for by treating cells with PE-conjugated dgG2b anti CD44, rIgG2b anti CD25, or
FITC conjugated rIgG2b anti HSA. Al1 antibodies as well as non-specific isotypic
controls were purchased fiom Phanningen, except for anti CD3, FITC-Goat anti hamster
IgG and the corresponding isotypic control, which were purc hased fiom Cedariane.
Fluorescence emitted by specifically bound antibody was measured by flow cytometry on
a FACScalibur cytometer (Becton Dickinson) and data were anaiyzed using CellQuest
Software eecton Dickinson).
Immunoassav for IL- 12 Production
Prior to in vivo inoculation of mice with STFlO vaccines bearing parental and
recombinant ALVAC vectors (see below) supernatant: from virally infected cells were
assayed for the presence of IL-12 via Enzyme Linked IrnrnunoSorbent Assay (ELISA),
using the OptEIA kit (Pharmingen) according to manufacturer's protocol. Al1 values
presented in Table 1 are expressed as ng/mL./million celW24 hours.
Reverse Transcri~tion (cDNA synthesis)
10' cells from indicated samples were spun d o m and cellular mRNA was extracted
using a RN-easy Kit (Qiagen) according to manufacturer's protocol. For reverse
transcription, 2ug of RNA was used fiom each sample.
5 pL (2 ug) of RNA was added to 1.5 p..L of random hexarner (300 ng / uL), along with
5.5 pL of sterile water, and incubated at 65°C for 5 minutes. Subsequently, 4 pL of 1"
strand 5 x buffer, 2 pL of 0.1M DTT, 1 pL of 20 mM (WTP, and 0.5 pL of RNase
Inhibitor (RNguard) was added on ice, and then incubated at room temperature for 15
minutes. Each sample was done in duplicate. Following incubation at room temperature,
one of the duplicates fkom each sample was treated with 1 pL of Superscript II reverse
transcriptase (for +RT reactions). Samples were incubated for 1 hour at 37°C followed
by 1 hour at 48OC. Superscript II was then deactivated by incubation at 95°C for 5
minutes. mase A kvas then added to each tube, and samples were incubated at 37°C for
30 minutes, followed by incubation at 95°C for 5 minutes. The final volume of each
sample was then brought up to 40 pL with steriie water.
PCR for aene - expression
2.5 pL of the sense primer, and 2.5 pL of the antisense primer (both initially at 2.5 pmol /
uL) tvere added to 3 pL of indicated cDNA template, along with 5pL of 10 x PCR buffer,
5 pL of 10 rnM dNTP and 0.25 pL of Taq polymerase (Qiagen)- For TdT cDNA
amplification, samples were denatured for 5 minutes at 94OC followed by 30 cycles of
denaturation at 94°C for 30 seconds, reannealling at 61°C for 30 seconds and extension at
72°C for 30 seconds. Subsequently, a h a 1 extension took place at 72OC. For RAG-1,
RAG-2 and HPRT amplification, samples were denatured at 94°C for 5 minutes,
followed by 3 5 cycles of denaturation at 94°C for 30 seconds, annealing at 58OC for 48
seconds, extension at 72°C for 45 seconds. Subseq~entiy~ a final extension at 72°C took
place for 10 minutes.
Murine TdT cDNA was amplified to a 124 bp product using sense primer 171 with
sequence 5' ATATGCTTGCCAGCGAAGAACC 3' and antisense primer 172, with
sequence 5' GAG ATT TCA GTA CAG AGG ACG C 3'. TdT Primers were kindly
provided by Dr. Gillian Wu. Murine RAG-1 cDNA was amplified to a 545 bp product
using a sense primer of sequence 5' CCAAGCTCGAGACA'ITCTAGCACTC 3' and an
antisense primer of sequence 5' CTGGATCCGGAAAATCCTGGCAATG 3'. Murine
RAG-2 cDNA was amplified to a 471 bp product using sense primer 5'
CACATCCACAAGCAGGAAGTACAC 3' and antisense primer 5 '
GGTTCAGGGACATCTCCTACTAAG 3'. Murine HPRT was amplified using sense
primer 5' GCTGGTGAAAAGGACCTCT 3' and antisense primer 5'
CACAGGACTAGAACACCTGC 3'.
Positive control for TdT amplification comprïsed of a murine genomic sample from
mouse tail DNA. Genomic Positive controls contained 1 or 8 pL of 25mM MgClt, while
negative controls contained water in place of template. Positive controls for RAG- 1,
RAG-2 and HPRT consisted of two cDNA preps of the pro-B ce11 line NFS-70, while
negative controls contained water in place of template.
20 pL of amplification products of TdT, RAG-1, RAG-2 and HPRT were mixed with 4
pL of 6x loading bmer and electrophoresed on 1.5% agarose gel at 90 Volts for one
hour. A 1 Kb reference marker (Gibco BRL) was electrophoresed in parallel.
Growth Kinetics of ALVAC-infected STFl O cells
To detemine whether infection via ALVAC vectors affected the growth rate of STFf O
cells, 1 million STFlO cells were infected with ALVAC B7-1 as outlined above, and
following recovery, were replated at 2 X 10' cellslmL in CM (t=O). As a control, 1
million STF l O cells were treated similady, without ALVAC B7- 1 infection. Population
density (concentration in vitro) was then assayed at timepoints of t = 24, 48, 72 and 96
hours via trypan blue exclusion assay. Further analysis was not undertaken due to ce11
death in both cultures due to overwhelming population density.
Stabilitv of ALVAC Encoded ~roducts over time in ST
S t a b i l i ~ of ALVAC encoded products over tirne was assayed in both a continually
dividing culture as well as a non-dividing culture. 6 million ST cells were infected with
ALVAC B7- 1, as above. Subsequently, half the culture (3 million cells) was separated
and irradiated at 10,000 cGy and replated at 5 x 10' cells / mL in fiesh media. Post
irradiation, aiiquots were taken at 24, 48, 72 and 96 hours, and assayed for B7-1 as
described above. The cells did not divide M e r afier irradiation and afier 96 hours,
were completely non-viable. In pardlel, after infection and recovery, the non irradiated
cells were replated in fiesh media at 5 x 10' cells f mL and aliquots were takea at 24,48,
72, and 96 hours to assay for B7-1 expression. Since this culture was continually
dividing, cells were split and maintauied at 5 x 10' cells / mL at each of these timepoints.
Two M e r timepoints of 120 hours and 144 hours were assayed for 87-1 expression,
with this culture.
Tumorkenicip in Wild T v ~ e BALB/c rnice: Vaccination and Challenge
8-10 week old BALBk female mice were purchased from Charles River Laboratories
(Canada) and housed at the animal facility of the Division of Comparative Medicine,
University of Toronto. Al1 experiments were conducted in accordance with the
University of Toronto Animal Care guidelines.
STF l O celis were plated at 5 x 1 o5 cells / mL in RPMI 1640 + 2% FCS and idected in
vitro (as above) with the indicated ALVAC parental or recombinant virus, and incubated
for 10 hours at 37OC, 5% COz. Al1 infections were carried out at an MOI of 20, except
when combining ALVAC IL-12 and ALVAC B7-1 where an MOI of 10 was used for
each respective virus. Following infection, cells were washed twice and recovered
overnight in complete medium (CM).
Following recovery, cells were washed 4 times in serum fiee media, resuspended into
semm fiee media at a concentration of 5 x 106 cells / mL, and injected subcutaneously
into the right Bank of five corresponding groups of mice. A dose of 1 x 106 cells was
administered per mouse, with five mice per group. Tumor growth in vivo was monitored,
and animais were sacrificed when maximum tumor diameter reached 2 cm.
Surviving animals were challenged at day 55 with 1 x 1 o6 wild type STF 1 O cells on the
opposite (Ieft) flank. As a positive control for tumor growth, naive age-matched female
BALBIc rnice were also injected with wild type STF 10 cells.
To determine whether a vaccination regimen incorporating a cellular boost would induce
greater survival &er wild type challenge, a protocol utilizing two vaccines before wild
type challenge was undertaken. Mice were immunized with the indicated celIular
vaccines consisting of STF1O cells infected with parental or recombinant ALVAC
vectors. In this experiment, instead of using cells doubly infected with ALVAC 87-1 and
ALVAC IL-12 as one of the vaccine groups, a mixture of equal nurnbers of ALVAC B7-
1-infected and ALVAC IL-12-infected celis was used, 8 female BALBIc mice were used
per group, except in the group receiving STFlO/ALVAC IL-12, where 16 mice were
used.
34 days post vaccination, a new batch of STFlO cells were infected with parental or
recombinant ALVAC vectors- On day 35, animais nirviving the initial vaccination were
boosted with the exact same tumor vaccine (as they had received initially) via
subcutaneous injection on the same (nght) lateral flank. A boost of the same vaccine was
administered to al1 animals except those that had been immunized with STFlO/ALVAC
IL-12, where only 8 out of 16 were boosted, and 8 were lefi unboosted. A positive
control for tumor formation was included by the injection of wild type STFI O cells into 8
age-matched, previously unvaccinated BALBIc female mice.
On day 56 post initiai vaccination (or day 2 1 post boost), al1 rnice surviving the initial
vaccine as well as the boost (where applicable) were injected on the left lateral flank with
wild type STFlO cells at a dose of one million cells per mouse. Once again, positive
controls for tumor formation were included via the injection of wild type cells into
previousl y unvaccinated B ALB/c mice.
In experiments using athymic nude mice 8-10 week old fernale BALB/c ndnu mice were
purchased from Charles River Laboratories and maintained as above, except under sterile
conditions. A similac tumongenicity assay was perforrned, whereby STF 1 O cells were
infected with the indicated ALVAC virus, and injected subcutaneously on the right lateral
flank, at a dose of 1 x 106 cells per mouse. Agah, five mice were used per group, and
animals were euthanized when maximum tumor diameter reached 2 cm.
A follow-up tumongenicity experiment with nude mice incorporated 8 rnice per group,
with one modification, in that instead of doubly infecting one group of cells with
ALVAC B7-1 and ALVAC IL-12, a mixture of an equal number of ALVAC B7-1-
infected cells and ALVAC IL-12 infected cells, was used.
Statistical Analy sis
Kaplan Meier survival curves were compared using the log-rank test in the SPSS 6.1
Macintosh version statisticd package. Differences are considered statistically sigaiflcant
if p < 0-05.
Cvtotoxic T-lvmphocvte Assavs
Preparation of St imulator Cells
STF 1 O cells were plated at a concentration of 5 x 10' cells / mL in RPMI 1640 + 10%
FCS + 50 u M 2-Me (CM) and infected with ALVAC at an MOI of 20. and then grown
overnight at 37OC, 5% COz. Following incubation, ceils were washed twice in serum fiee
RPMI and resuspended in culture media (CM). Subsequently cells were irradiated at
10,000 =Gy, washed, and resuspended at 1 x 10' cells / mL in CM. 1 mL was
subsequently plated out in 24-well tissue culture plates.
Preparation of Eflecfor Cells
Because STF 1 OIALVAC IL- 12 consistently induced greatest antinimor protection after
one vaccination, mice were immunized with STFlO / ALVAC IL-12 via subcutaneous
injections and one mouse was euthanized at each timepoint of 13, 17,27 and 35 days post
injection to examine in vitro reactivity. In paraIlel, a naive mouse was also euthanized at
each timepoint. Animals were dissected under sterile conditions and spleens were
removed and resuspended in serum fiee RPMI. Subsequently, a single cell splenocyte
suspension was created by homogenizhg spleens and passing the homogenate through a
0.22 um ce11 strainer. The strainer was then washed tw-ice with 7 rnL of serum free
RPMI, and the flow through was pooled with the splenocyte suspension.
The splenocyte suspension was then centrifùged and washed twice with s e m fiee
RPMI. M e r the last wash, spienocytes were resuspended in 1 mL of Tris-Mt-Cl, pH
7.2 and incubated at 37°C for 2 minutes to lyse red blood cells. Following RBC lysis, the
ceils were washed once again in senun fiee RPMX and resuspended in cdture media
(CM) of RPMI + 10% FCS + 50 u M 2-Me at a concentration of 5 x 106 cells / mL. 1 mL
of this solution was then added to the 1 mL of the stimulator culture that had been
previously set up as indicated above. Each stimulator - effector well was set up in
duplicate. Cells were stimulated in vitro for 5 days, at 37OC. 5% COz.
Prepurution of Target Cells
4 days afier setting up the stimulator - effector CO-culture, 4 x 1o6 STFlO cells were
plated at 5 x lo5 cells / rnL in culture media (CM). 2 x 106 of these cells were infected
overnight with ALVAC IL42 at MOI of 20 and 2 x 106 were grown uninfected, at 37°C
5% CO2. Following ovemight incubation, 10 uCi of 3 ~ - ~ h y m i d i n e was added per
million cells for each group and cells were further incubated for 4 hours at 37OC, 5%
C o l . Subsequent to labeling, cells were washed in serum fiee RPMI and resuspended in
RPMI + 5% FCS at a concentration of 1 x 10' cells / mL.
CTL Setup
Effector cells fiom immunized mice and naive rnice that were being stirnulated with
S V 1 O / ALVAC IL42 were removed fiom the stimulation plate and resuspended via
vigorous pipetting into WMI 1640 -+ 5% FCS at a concentration of I x 10' cells / mL.
150 pL samples containing 1.5 x 106 cells were pipetted into 96 well plates, in duplicate
for lysis reactions against STFl O and STF 1 O / ALVAC IL- 12 target cells. Effector cells
were then serially difuted 3 times by taking out 50 pL and resuspendhg into 100 pL of
CTL medium RPM 1640 + 5% FCS. 100 pL of targets (at 1 x 10' cells / mL) were then
aliquoted into corresponding wells to yield final effector : target ratios of 100: 1, 3 3 : 1,
1 1 3 and3:l.
Plates were centrifùged for 8 minutes at 800 rpm (without brakes) and incubated at 37"C,
5% COz, for 4 hours. Following incubation, labelled unlysed cells were hatvested ont0
Unicell plates using a ce11 harvester. The Unicell plates containing the udysed cells were
washed, dned and baked at 42°C for 40 minutes. Subsequently, the porous membranes
of the plates were sealed at the back, and 25 pL of scintillant was added to each well.
The tops of the plates were then heat sealed and counts were read on a Packard-Top
Count scintillation counter. % Specific Lysis was calculated as outlined by Matzinger et
ul. (88), using the formula:
% Specific Lysis = 100% x (spontaneous cpm - experimental cpm) / spontaneous cpm
Differential Effects of in vitro stimulation on STF10 Lvsis
To determine whether unmodified STF l O cells differentially activated STFl O (parental
tumor) specific splenocytes Erom Unmunized mice, stimulation CO-cultures were set up as
above, against both STFlO/ALVAC as well as unmodified STF 10 cells. Responder cells
were obtained fiom mice that had been immunized with STFlO/ALVAC and then
boosted with the sarne tumor vaccine. Mice were at 21 days post boost, at the time of
splenocyte harvest, Targets of STFIO or STFIO/ALVAC were set up in the manner
described.
Results
Heterogeneitv in Tro~ism Viral Gene Expression
To determine whether the tropism or the gene expression of ALVAC encoded genes was
restricted to various subsets of lymphoid cells, a range of tumor ce11 lines were tested for
their ability to take up the ALVAC virus and express the recombinant hurnan B7-1 gene.
The ce11 lines tested included an acute myeloid leukeniic line C 1498, a melanoma B 16,
mature B-ce11 lymphomas K46J and A20, a mastocytoma P8 15, a pro B-ce11 line NFS-70,
a thymic lymphoma ST, as well as two ST subclones STFIO and STG4. As figure 2
shows, MO, K46J, P8 15 and C 1498 cells were completely negative for recombinant gene
expression, while the B 16 ce11 line displayed a very high fiequency of celts positive for
human B7- 1. In addition, the level of B7-1 molecule expression in this ce11 line was also
very high. NFS-70 and ST were the only murine lymphoid ce11 lines that showed
positivity for B7-1 expression, at fiequencies of 83% and 94%, respectively. STFlO and
STG4, which were subcloned fkom the parental ST population, could also be successfUy
infected with ALVAC B7- 1. Even though the subclones exhibited a high fiequency of
cells positive for B7-1 expression, there was some heterogeneity in the level of B7-1
expression by individual cells in the population. Despite the heterogeneity, the clonal
STFlO was chosen as a twnor mode1 rather than the bulk ST to minimize the level of
cellular heterogeneity that may result from successive mutations that take place in
individual cancer cells within the original tumor bulk.
Surface Marker Phenotye of STFl O
We were interested in evaluating the role of ALVAC based vectors in mediating
immunogenicity in lymphoid malignancies. For this reason, the thymic lymphoma
subclone STFlO was chosen as a tumor model. Because the parental thymic lymphoma
(ST) arose from a SCID mouse, the ce11 Luie was thought to be derived fiom early T-cells.
To c o n f i the developmental stage fiom which this thymic lymphoma arase? the ce11
line was screened for the presence of early T-ce11 markers.
As figure 3 shows, STFlO was CD&, CD25-, HSA+, CD4 low, CD8 low, and CD3-.
In addition, the ce11 line was B7-1 low, B7-2 low, MHC class 1 ( l 3 - 2 ~ ~ ~ ~ ) + and MHC
class II (1-A~) low. Further analysis of the intracellular enzyme constitution of STFlO
revealed positivity for recombination activating gene 1 (RAG-1) and recombination
activating gene 2 (RAG-2), as well as terminal deoxynucleotidyl transferase (TdT)
(figure 4). These results con fmed that STFlO was derived fiom an early double
negative thymic precursor T-lymphocyte.
Growth Kinetics of ALVAC Infected STFl O cells
To determine whether ALVAC infection affected the growth rate of STFlO cells, 1
million STF l O cells were infected with ALVAC B7- 1 and subsequently, population
growth was monitored over tirne, starting fiom a density of 2 X 105 c e l l d d . Figure 4
shows that compared to an uninfected control population, STF 10 cells that have been
infected with ALVAC vectors do not display growth kinetics that are notably diffèrent.
Both survival curves have sirnilar trends indicating that infection via ALVAC vectors has
no effect on the survival and proliferation of STF 1 0 celis.
MHC-class 1 ex~ression on ALVAC infected STFl O cells
To observe the effect of the intracellular ALVAC virus on MHC expression, the tevels of
l 3 - 2 ~ ~ and H - ~ D ~ were assayed at tirnepoints of 6 hours post initial exposure, and 24
hours post infection. As shown in figure 5, there is no downregulation of MHC class I
molecule expression due to the presence of ALVAC. Specifically a slight hcrease is
observed after poxvird infection, in that the georntnç mean £iuorescence fiom antibody
tagged MHC molecules is 17 and 19 for infected cells at 6 hours and 24 hours
respectively, and 14 and 15 for uninfected cells at 6 and 24 hours respectively.
Stabilitv of ALVAC encoded Products over Time
Because the ALVAC virus is non-integrative into the host genome, and is replication
incompetent in mammalian tissue, recombinant products encoded by this v ins will be
transiently expressed. To determine the duration of expression of ALVAC encoded
products, in both a rapidly dividing population, as well as in a non dividing population,
the STFlO tumor mode1 was used to monitor ALVAC B7-1 gene expression over time.
The number of cells positive for human 87-1 was assayed via cell sorting of both a log
phase as weI1 as an irradiated, non dividing culture.
As shown in figure 7, in a continually dividing culture, ALVAC encoded B7-1
expression was maximal at two days post infection (48 hours), as al1 the cells originally
infected with ALVAC B7-1 were still positive for the recombinant molecule. However,
by 72 hours post infection, the expression of human B7- 1 is Iost, and expression levels of
the recombinant molecule return to baseline. in contrast, in a culture where replication of
the cells is hdted via irradiation, the presence of ALVAC encoded products can be
detected nght up to the point at which the cells undergo apoptosis (> 96 hours). In
addition, the number of cells encoding ALVAC B7-1 remains fairly constant, at between
70 - 80% for the duration of this assay, though the level of protein expression (assayed
by fluorescence intensity) gradually decreases over time. These cells undergo apoptosis
at this time presumably due to an excess of DNA damage as a result of prier irradiation.
Viral infection does not induce apoptosis by itself, as the population which was infected,
but not irradiated, expanded continuously, leading eventually to the dominance of virus-
free daughter cells over virally infected cells.
This shows that fustly, the repiïcative index of the chosen ce11 line is an important factor
in how long cells can express ALVAC encoded products, as a population that is not
replicating maintains expression fiom the ALVAC vins longest. Secondly, the temporal
regdation and the half-life of the actual product being encoded are important factors as
even though cells may be positive for ALVAC B7-1, and hence the ALVAC virus, the
level of the recombinant product declines over time.
Decreased Turnorigenicitv of STFlO cells Modified b~ ALVAC Vectors
To determine if genetic modification of STFlO tumor cells by introduction of genes
encoding IL-12 and / or 87-1 could enhance antitumor imrnunity, STFlO turnor cells
containing ALVAC B7-1 or ALVAC IL-12, or both ALVAC B7-1 and ALVAC IL42
were injected into syngeneic mice. As controls, STFlO tumor cells bearing non-
recombinant ALVAC virus, and STFlO tumor cells with no virus were also injected in
parallel into syngeneic mice. Al1 irnmunizations were via subcutaneous injection in the
right flank.
While various previous models have used irradiated c e k as the initial vaccine inoculum
in order to achieve protective immunity against wild type tumor cells, we wanted to
examine whether a primary resonse could be generated against the vaccine before we
exarnined the issue of pretective immunity. As a result, in al1 o u experiments,
vaccination is carried out using [ive tumor cells, as opposed to imdiated cells so that in
the absence of an effective response against the vaccine, a clear indication is obtained via
turnor formation.
Control mice receiving STFlO cells alone al1 succumbed to tumor within 20 days post
injection, while mice receiving STF 1 O/ALVAC B7- 1, STF 1 O/ALVAC IL- 12 or
STF 1 O/ALVAC B7- I/ALVAC IL- 12, al1 remained completely tumor free, upto 55 days
post injection. Surprisingly, mice that received STFlO cells infected with the non
recombinant ALVAC virus (STF 1 O/ALVAC) also rejected their tumors and remained
100% turnor fkee up until day 55 (Figue 8).
Since al1 animals that received STFlO cells containing either parental or recombinant
ALVAC virus rejected their tumors at 100% fiequency, al1 anirnals were challenged with
an injections of wild type STFlO cells in the opposite (left) lateral flank, to determine if
systernic irnmunity against the wild type cells was conferred. As controls, previously
unvaccinated (naive) mice were also injected with wild type STFl O tumor cells.
Following challenge, 4/5 control (previously rinimmunized) mice developed tumors.
Tumor formation was also observed in 5/5 mice immunized with ALVAC B7-1,4/5 mice
immunized with STF I O/ALVAC, 4/5 mice immunized with STF I O/ALVAC IL- 12, and
3/5 mice imrnunized with STF 1 O/ALVAC £37-l/ALVAC IL- 12 (Figure 9). Mice that
were vaccinated with STF lO/ALVAC IL-1 2 initially seemed to display a delay in tumor
formation when challenged with wild type cells. However, log-rank statistical andysis
revealed that compared to survival of naive mice, none of the STF10 vaccines (including
STF 1 O/ALVAC IL- 12) were efficacious in conferring a significantly greater level of
protection afier wild type challenge @ > 0.05 in al1 cases).
Tumorigenicitv in Nude Mice
To determine whether the rejection demonstrated in the above expenment was mediated
by T-cells, a tumorigenicity experiment was camed out in BALBlc nude mice, which
lack mature T-cells.
STFl O cells were infected as above with either a) ALVAC B7-1, b) ALVAC IL-12, c)
ALVAC B7-1 and ALVAC IL-12, d) ALVAC, or e) No virus, and injected
subcutaneously into nude mice. In contrast to results with wiId type mice, STFlO
variants bearing ALVAC 87- 1, or ALVAC IL4 2, or both were not 100% imrnunogenic,
and formed nimors in US, 415 and 2/5 mice, respectively. STF 1 O cells infected with non
recombinant ALVAC parental vector were 100% immunogenic in nude mice, as al1 mice
receiving this cellular variant rejected their tumor vaccine (Figure IOA). However,
relative to tumor formation via unrnodified STFl O tumor cells, tumor formation via
STFlO cells infected with either parental or recombinant ALVAC vectors was still
delayed to a significant extent @ < 0.05). There was no significant difference in the
rejection of STF 1 OIALVAC, relative tu STF 1 O/ALVAC B7- 1, STF I O/ALVAC IL-1 2, or
STF 1 OIALVAC B7-1IALVAC IL- 12.
Similar results were obtained upon repeating the expenment whereby mice received
either a) STF 1 O alone, b) STF 1 O/ALVAC, c) STF 1 OIALVAC B7- 1, d) STF 1 OIALVAC
IL- 12, or e) a mixture of STF I O/ALVAC B7-1 and STF 1 O/ALVAC IL- 12. In agreement
with the initial experiment, tumors resulting from STF IO cells bearing either parental or
recombinant ALVAC vectors were significantly delayed in formation. relative to those
resulting fkom uninfected STFIO cells (p < 0.05 in al1 cases) (Figure IOB). As well,
though there was a significant deIay in tumor formation when STFlO cells were modified
with ALVAC vimses, rejection was not 100% as seen with wild type micet suggesting
the possible role of T-cells in tumor variant rejection.
Taken together, these preliminary fmdings point toward three important conclusions.
Firstly, in contrast to previous assumptions, the ALVAC vector is by itself immunogenic,
in the context of a subcutaneously adrninistered whole ce11 tumor vaccine that has been in
vitro modified. Secondly, as nude mice reject the STFl O variants to some extent relative
to unmodified controls, but not as efficiently as wild type rnice, the effector mechanism
responsible for rejection of STFl O tumor variants is multifactorial. Finally, T-ceiis are
involved to some extent as there is greater mortality in nude mice receiving STFlO
vaccines; however, the vaccination regimen employed is ineffective in conferring
systemic antitumor immunity. Even though there appears to be a slight delay in tumor
formation in mice vaccinated with STF 1 OIALVAC IL- 12, this delay is not statistically
significant, with a sampie size of n=5.
Boosting with whole ce11 vaccines bearing ALVAC vectors confers antitumoral immunity
Because the initial vaccination regimen employing one tumor ce11 vaccine injection
followed by a lethal challenge at day 55 did not yield a statisticdly significant protective
response with any of the tumor vaccines, the protocol was modified in two main respects.
Firstly. the STF 1 OIALVAC B7-IIALVAC IL-1 2 vaccine was replaced with a vaccine
made up of a mixture of STF IOIALVAC B7- 1 cells and STFI OIALVAC IL- 12 cells at
equal arnounts. This was done to keep the infection level via each respective virus
consistent, as an infection procedure that subjects both viruses to the same culture at the
same tirne could not control for the infection of every ceLl by the two viruses at equimolar
ratios. Secondiy, in order to examine whether the vaccination regimen could be
improved to afford better protection upon challenge with wild type tumor cells, a prime
and boost approach was utilized.
Animals were injected at day O with either a) STF10, b) STFlOIALVAC, c)
STFI OIALVAC B7-1, d) STFlOIALVAC IL-12, or e) STFIOIALVAC B7-1 &
STF I OIALVAC IL- 12. Al1 anirnals survived except those that received STF 1 O cells alone
(not shown), and on day 35, al1 animals were boosted with the same respective vaccine.
As controls, naive mice were injected with STFlO cells alone, and half the mice which
previously had received STFIOIALVAC IL-12 were left unboosted. Again, naive mice
receiving STF 10 alone died by day 21 (not shown). Al1 other mice survived, as expected
upon vaccination with STFlO cells modified with parental and recombinant ALVAC
vinises.
21 days after boosting, ail animals were challenged on the opposite flank with wild type
STFlO cells to determine whether systemic immunity had been conferred. However 6
days after challenge, one mouse out of eight, which had been initially vaccinated with
STF IOIALVAC IL- 12 but Ieft unboosted succumbed to tumor formation on the right
flank. Because the challenge was administered on the lefi flank, and the kinetics of
tumor formation argued against this tumor being formed as a result of challenge, this
m o u e was taken out of the sample of survivors that were chdlenged.
As shown in figure 11, al1 naive animals that received STFlO ceils succumbed to tumor
with expected kinetics. Animals that had been vaccinated and boosted with
STF 1 OIALVAC, STF 1 O/ALVAC B7-1, STF 1 O/ALVAC IL- 12 or both STF 1OIALVAC
IL- 1 2 and STF I OIALVAC B7-1 showed significantly delayed tumor formation (relative
to naive mice) in al1 cases (p < 0.01). This showed that after boosting with whole ce11
vaccines bearing parental or recombinant ALVAC vectors, some measure of systemic
irnmunity against STF 1 O cells had been induced. Furthemore, survival fiequencies were
also increased relative to naive mice, as mice vaccinated with STFlO/ALVAC,
STF 1 O/ALVAC B7- 1, STF 1 O/ALVAC IL-1 2, or STFI O/ALVAC IL- 12 and
STFlO/ALVAC B7-1 showed overall survival rates of 50%, 12.5%, 25% and 25%
respectively. Notably, STF I O/ALVAC by itself was a potent immunogen, in that priming
and boosting with STFI O/ALVAC gave a level of protection that was comparable to that
with other vaccines incorporating recombinant ALVAC vectors in STF 10 celis.
Also of interest is the fact that even though a previous vaccination with STFIO/ALVAC
IL-12 (figure 9) failed to elicit a protective response after challenge, this time one
vaccination with STF 1 O/ALVAC IL- 12 was significantly protective against tumor
formation, relative to naive mice @ < 0.01) when the sample size was increased tn n=8.
In addition, a double vaccination with STF 1O/ALVAC IL- 12 does not confer a protective
effect that is superior to that mediated by a single vaccination with STFlO/ALVAC IL-
12. as rnice vaccinated twice displayed kinetics of tunior formation that were comparable
to that seen in mice vaccinated oniy once.
In Vitro Antitumoral Reactivitv
Mice were imrnunized with STFlO/ALYAC IL-12, and their splenocytes were assayed at
various tirnepoints for reactivity against both wild type STF IO and STF I O/ALVAC IL-
12. Spleens were taken at days 13, 17, 27 and 35 post immunization. and lymphocytes
were stimulated against STF 1 O/ALVAC IL-1 2 before they were incubated with STF l O
and STF 1 O/ALVAC IL-1 2 targets for lysis. Spleens fiom naive mice were also processed
similady, as negative controls.
Significant in vitra cytolytic activity could be observed fiom mice only on day 27, and
only against STFIO/ALVAC IL-12 targets, at effector : target ratios of 100:i and 33:l
(figure 12B). Specific lysis of wiinfected STF 1 O tumor cells was not observed at this
timepoint (figure 12D), indicating that STFl O specific CTL-precursors were either absent
or in very low fkquency in the population of splenocytes. Lymphocytes Fom naive
mice. stimulated similariy with STF lO/ALVAC IL-12 were not able to Lyse STFl O or
STF I OIALVAC IL-1 2.
Because in vivo experirnents had previously shown that immuniung and boosting mice
with the STF 1 O/ALVAC variant also increased antitumor responses against STF 1 O tumor
celk upon challenge at day 21, animals were immunized with STFlO/ALVAC, boosted
tvith the sarne respective tumor vaccine, and then assayed for splenic reactivity against
STF 1 O and STFl O/ALVAC at day 2 1. In addition, the differential in vitro effects of
stimulation were also examined in that lysis of the uninfected STFlO ce11 line was
assayed after in vitro stimulation of splenocytes with either wild type STFlO or
STF 1 O/ALVAC.
As shown in figure 13, splenocytes fiom naive mice were unable to lyse uninfected
STF 1 O cells when incubated with STFl O in viiro. However, specific cytotoxic activity
against uninfected STF 10 celis was obsewed fiom splenocytes of mice immunized with
STF 1O/ALVAC, after stimulation ex vivo with STFlO cells (figure 13A). In addition,
specific activity against STF 1 O/ALVAC could dso be elicited from splenocytes
stimulated with wild type STF10, with comparably higher kiiling at the lower effector :
target ratio of 30: 1 (figure 1 3B).
In contrast, stimulation of splenocytes with STF 1 O/ALVAC yielded results that were
simiiar to previous experiments, in that specific cytolytic activity of splenocytes fiom
imrnunized mice was not appreciably greater than that elicited fiom splenocytes of naive
mice, when assayed against STF10 cells (figure 13C). There was also a higher level of
background killing by splenocytes fiom naive mice.
Taken together, these data imply that STFlO specific CTL precursors are indeed present
at day 21, in the splenocyte population of mice that are imrnuaized and boosted with
STFlO/ALVAC. Their clonal expansion, and their subsequent detection is dependent on
the stimulus provided, Le., they are selected more eficiently by uninfected STFIO cells
and cannot be detected if splenocytes are stimulated against STF1 O/ALVAC.
Discussion
The most significant observation descnbed here is that the ALVAC vector itself is
immunogenic and cari elicit a systemic cellular immune response. That is, in the context
of whole ce11 tumor vaccines with STFlO cells, the ALVAC vector was 100%
immunogenic and the additional benefits fiom the encoded B7-1 or IL42 could aot be
detected. Initial experiments indicated that protection against challenge with STFl O
could be elicited at appreciable, though statistically insignificant levels, with STF 1 O cells
modified with ALVAC IL-12. Repeating the in vbo experiment with a greater sample
size indicated that vaccination with STF 1 O/ALVAC IL- 1 2 is indeed significantly
protective; however, boosting with this vaccine does not confer a greater protective
effect.
AIthough protection fkom ALVAC IL- 12 modified STF l O ceils was not enhanced by
boosting the initial immunization, tumor protection was enhanced by boosting using ail
the other STFIO/ALVAC immunogens. A vaccination and boost with STFIOIALVAC is
significantly protective against wild type challenge, at levels that are comparable to that
induced by vaccinating and boosting with STF1 OIALVAC IL- 12. Thus, STF 1 O/ALVAC
is a potent irnmunogen in eliciting an anti-Sm10 response by itself, and in this mode1
there is no added benefit of IL-12 or 87-1 expression.
Experirnents in nude mice indicate that rejection of ALVAC - infected STF IO variants is
mediated in part by T-celis, due to reduction in rejection eficiency, but other effector
mechanisms are also responsible as ALVAC - infected cells are not completely
turnorigenic in nude mice. Lastly, in mice immunized with STFlO/ALVAC, splenic
cytotoxic T-celfs specific for wild type STFlO tumor cells can be detected in vitro but
this detection is dependent on stimulation (ex vivo) with STF10, and is abrogated on
stimulation with STF lO/ALVAC.
Immunogenicitv of the ALVAC Vector
We have shown that both the ALVAC recombinants and the non-engineered ALVAC
vector can induce immunogenic responses in immune competent as well as athymic nude
mice. In wild type mice, tumor cells bearing either parentai or recombinant ALVAC
vectors were always rejected at a fiequency of 100% except in one case where one 1 out
of 16 mice injected with STF lO/ALVAC IL-1 2 developed a tumor. As well, in nude
mice, STFIO cells bearing parental or recombinant ALVAC vectors were rejected at
vary ing, though statistically significant, fkequencies relative to unmodified STF 1 O ce1 1s
which were 100% turnorigenic.
These results indicate that the ALVAC virus by itself is immunogenic and can elicit an
immune response without the added expression of recombinant genes like TL-12 and / or
87-1 when applied in a whole ce11 vaccine. Immunogenicity of the ALVAC virus in
antitumor models was also demonstrated by Puisieux et al. (79) who showed firstly, that
whole ce11 immunization with TS/A adenocarcinorna cells bearing ALVAC P-gal caused
a delay in turnor onset, but did not confer total rejection as did TS/A cells bearing
ALVAC IL12. In our case we saw complete tumor rejection with the ALVAC virus,
comparable to that with ALVAC IL-12. This discrepancy may be resolved by
considering the fact that the multiplicity of infection employed by Puisieux et ai. (79)
was 5 Pfû / celI, whereas the MOI used here was 20 P h / cell. A lower MOI may lead to
a lower efficiency of infection by ALVAC in viiro, providing fewer stimulating signals
and targets in vivo during turnor rejection. Cells bearing ALVAC IL12 wouid in this case
be better rejected because IL-12 is secreted and can modulate effectors in the local
environment to a greater extent than can the parental virus by itself,
Immunogenicity of the ALVAC virus was aiso demonstrated in an additional experiment
by Puisieux et al. (79), whereby intra~unoral injection with the non-specific virus
ALVAC P-gal showed increased survival of mice relative to those injected with PBS.
However, mice injected with ALVAC IL-12 showed increased survival relative to any
other group. Again, this discrepancy may be resolved by the mode of administration:
intraturnoral injection only allows the virus to access those cells that are in close
proximity to the site of injection. As a result, oniy a few cells receive the vector, and any
immune response directed towards the vector alone is directed only to those cells, and not
the majority of the tumor mas. Injection with ALVAC IL-12, however, may have a
better effect because in this case even though a few cells receive the vector, IL-12 c m
affect the entùe local environment once secreted, Effectors al1 around the tumor can be
activated even though only a subset of cells produces IL- 12. in our case, the tumor cells
are modified in vitro, where parental viruses can interact with tumor cells more
homogeneously, allowing most cells to be infected before injection into mice.
Having established that the ALVAC virus is immunogenic, it still remains to be
elucidated which aspect of the virus is providing the immune stimulus. The primary
immune response may be directed against the virions and the protein components
themselves, or may be a function of the viral DNA, which becomes exposed once the
virus uncoats intracetlularly. The related poxvirus, vaccinia, is naturally immunogenic,
and various antigenic determinants have been characterized (89). In this report, it was
shown that antibodies specific for polypeptides fÏom the viral core as weU as the virai
envelope could be detected in sera from Lnmunized humans. Because the poxviruses are
related in structure, it is possible that antigenic detenninants are present in ALVAC both
at the core, which consists of structural proteins and enzymes, as well as the viral coat.
While T-ce11 determinants have yet to be characterized for either vaccinia or ALVAC, it
is possible that initial antitumoral reactivity by T-cells can be a Function of activation
against viral epitopes. These viral epitopes may be presented either indirectly by APC
which pick up determinants fiom apoptotic / necrotic turnor cells, or directly by the hunor
cells that harbour the virus.
Altematively, the nucleotide sequence of the viral genome itself may contain elements
that are immunostimulatory. For example, unmethylated CpG sequences have been
shown to elicit responses fiom various arms of the immune system. f i e g et al. (90)
showed that unmethylated bacterial DNA, as well as synthetically manufactured
oligonucleotides bearing a motif of a CpG island flanked by two 5' purines and two 3'
pyrimidines induce murine B-ceils to activate and secrete immunoglobulin. The response
is potent in that close to all splenic B cells react in this marner. Stacey et al. (91) showed
that macrophages (both prirnary and ce11 line) also react to CpG motifs by secreting
NOS, and Ballas et al. (92) demonstrated enhanced NK killing in vivo and in viîro, in
response to CpG motifs. Finally, dendritic cells have also been implicated in the
response to CpG motifs in that murine fetal skin derived dendritic cells undergo
maturation, upregulate MHC class II and B7-2, and secrete IL42 at arnounts far greater
than when activated by LPS (93). This activation of dendntic cells as a result of CpG
treatment has been shown to be abie to provide a positive stimulus for allogeneic T-cells
to proliferate in vitro (93).
Thus, if the genome of the ALVAC virus contaias CpG motifs, then it may be a mode
through which it is exerting its immunogenicity. Antigen presenting cells consisting of
macrophages and dendritic cells may take up cellular debris fiom apoptotic tumor cells,
and instead of presenting viral epitopes, they are presenting of tumor antigen epitopes
with the concurrent activation of costirnulatory molecules. The upregulation of
costimuIatory molecules in conjunction with turnor antigen presentation may serve to
activate previously anergized T-cells against tumor epitopes. Once activated, CDS+ T-
cells can reject the twnor efficiently.
Antiturnoral Protection followine Vaccine Boost
We showed that systemic antitumor protection against wild type STF l O tumor cells could
be enhanced by boosting the initial STFlO cellular vaccine. This was true for
immunogens containing both parental or recombinant ALVAC vectors, except those
modified with ALVAC IL-12, which proved to be protective afier a single vaccination.
Thus, in a double vaccination protocol, STFlO/ALVAC is as protective as al1 other tumor
vaccines, and the protective effect can be attributed to the virus alone.
These results indicate that potent T-ce11 memory against STFIO can be induced by
vaccination with STFlO/ALVAC by itself; however, this is dependent on a boost with the
relevant tumor vaccine. This agrees with the view that T-cells need to be exposed to
tumor or virai antigens more frequently in order to maintain immunity against tumor
cells, Le., T-ce11 memory is dependent on the increased presence of turnor antigens over
tirne. I f the host encounters an antigen at day 0, clears it and does not see it again until
day 55, the subsequent response is not as potent as that when the antigen is encountered
again partway through this period at day 35. The issue of whether T-ceil memory is
mediated by long Lived lymphocytes that have encountered antigen once, versus those
that continually need to mount a low level immune response against persistent antigen to
maintain memory, was addressed by Kundig et al. (94). lmmunization with a completely
immunogenic Vesicular Stomatitis Virus carrying the nucleoprotein N (VSV-N), and
subsequent challenge with pathogenic vaccinia vîmes containing the same immunogenic
CDS+ restricted protein N (Vacc-N), caused mice to lose T-ce11 rnediated reactivity
against N protein (and hence Vaccinia) over time. Further, the level of imrnunity is a
function of immunization dose, in that at lower doses of the original immunogen, the
immunity is lost faster.
Further, the role of antigen persistence was demonstrated (94), by vaccinating with a low
dose of VSV-N and challenging with Vacc-N with or without boosting wîth EL-4 cells
carrying N protein. Without boosting, mice were cornpletely susceptible to challenge at
day 44; however a boost at day 40 abrogated this susceptibility, and that multiple boosts
before this time point were not necessary.
Thus, T-ce11 memory responses against peripheral antigens rnay indeed be a fiinction of
the time following initial antigen clearance as weli as fiequency of antigen encounter. If
the antigen is completely cleared from the periphery, then T-ce11 respnses against the
antigen can only be observed if splenic T-cells are reactivated. According to Kundig et
al, in order to maintain peripheral immunity, the immunogen must persist in low arnounts
such that at the time of challenge, T-cells are already present in the periphery and
activated. This was demonstrated by showing that LN lymphocyte reactivity against
antigen is lost over time, while splenic activity is not, and that LN reactivity can be
regained by a boost.
An analogous situation may be applicable in antitumor responses, especially in the mode1
that is presented here. Challenge with wild type STF 10 too long after initial vaccination
may result in tumor formation due to the fact that T-cells have already cleared the initial
vaccine and have left the periphery. If however, a boost is administered, an additional
stimulus is provided for traficking T-cells to remain activated in the periphery. At the
time of challenge, these activated T-cells may be sufficient to mediate antitumor activity.
Protection against Tumor Epitopes as a Result of Viral Irnmunogenicity
Since wild type STFlO cells can in fact be cleared after vaccinating and boosting with
STF I O cells bearing parental and recombinant ALVAC vectors, it can be concluded that a
memory response can be induced via the activation of STF I O rumor speci fic T-cells upon
systemic challenge. While experiments in nude mice confirm that there are additional T-
ce11 independent mechanisms responsible for STF l O variant clearance, the presence of a
protective immunity against unmodzjied tumor ceiis suggests T-ceii involvement, How a
T-ce11 response agaînst STFlO cells c m be gained as a result of a virally infected cellular
vaccine is still unclear, but a number of possibilities exist. If, as discussed above, the
viral DNA is irnrnunostirnulatory, then during rejection of STF 1 O cells bearing ALVAC
vectors, tumor antigen specific T-cells that recognize cellular epitopes are being
activated. This would require tumor antigen uptake, processing and presentation by APC
that have upregulated their costimuIatory molecule and cytokine expression levels, in
response to ALVAC sequences. ln this way, previousiy anergized or ignorant T-cells are
activated against turnor epitopes, and can eff~ciently reject even wild type tumor cells
upon challenge.
Alternatively however, the ALVAC protein epitopes may themselves be the primary
imrnunogenic stimulus that is king presented to T-cells. Regardless of this, what we are
observing is that T-ce11 activation against non-viral, tumor epitopes can also be induced.
This transference of specificity may be explained either by the action of cross reactive T-
cells that are activated by viral epitopes and can now recognize twnor epitopes, or by the
phenomenon of epitope / detenninant spreading.
The phenornenon of epitope spreading has usually been associated with autoimmune
disorders in animal modets of disorders such as uisulin dependent diabetes (95) as well as
relapsing rernitting experimentai autoimmune encephalomyelitis (R-EAE) (96), which is
a Th1 mediated demyelinating disease responsibte for chronic CNS damage. R-EAE can
be induced in mice by the administration of an immunodominant peptide epitope fiom
the proteolipid (PLP) molecde (96), or an epitope from myelin basic protein W P ) (97)-
The initial reports of epitope spreading came fiom experiments whereby immunkation of
mice with the MBP protein allowed the isolation of proliferative T-ce11 clones specific for
the irnmunodominant epitope Acl- 1 1, as weli as non cross reactive T-ce11 clones specific
for additional determinants in peptides 35-47, 8 1- 100 and 12 1 - 140 (97). Importantly
however, reactivity to these epitopes could also be observed upon immunizhg mice with
only MBP Ac 1 - 1 1 and not the whole protein. Determinant spreading across different
molecules was demonstrated by Cross et ai. (98) who injected mice with epitope p87-99
of MBP, and found non cross reactive LN lymphocyte reactivity against epitopes of the
PLP protein during acute or chronic stages of disease.
Both interrnolecular as well as intramolecular epitope spreading were demonstrated by
McRae et ai. (96) where firstly, adoptive transfer of T-cells specific for MBP epitope 84-
104 resulted in generation of T-cells in vivo that were specific for the PLP determinant
139- 15 1. Secondly, adoptive transfer of T-cells of mice primed with PLP 139-1 5 1,
resulted in reactivity against a non cross reactive intramolecular epitope PLP 178-191,
dunng acute phase of EAE.
While the above studies are examples of epitope spreading as a result of initial prirning
via "self' epitopes, pnming via viral epitopes has also been shown to give nse to
determinant spreading. Like R-EAE, multiple sclerosis (MS) is also a T-ce11 mediated
autoimmune demyelinating disease, and it has been found that infection of rnice with
Theiler's murine encephaiomyelitis virus (TMEV) induces a chronic CD4+ T-ce11
rnediated disease that models progressive MS (99). Miller et al. (99) have shown that
injection of TMEV intracerebrally results in disease at about 40-50 days. Starting about
7 days post injection, and for the duration of the disease, infected mice continue to
display T-ce11 proliferative behaviour as well as DTH responses against wal epitopes
only. In contrast, there are no DTH or proliferative responses against a panel of myelin
epitopes. However, at 30 days post onset (Le., 80 days post viral infection), T-ce11
responses to myelin epitopes appear sequentially. Fust, responses are seen against PLP
139-15 1, followed by responses against epitopes 56-70 and 178-191 by day 164.
According to Miller et al. (99), the kinetics of this differentiai specificity argue against a
cross reactivity of T-cells against both cellular and viral epitopes as a result of molecula.
mimicry. if indeed there was cross reactivity. then reactivity against myelin epitopes
should also have been detected at tirnepoints when reactivity against virus was detected.
The mode1 put forth by Vanderlugt et al, (100) explains epitope spreading as a cascade
resulting from recognition of a single epitope. Antigen presenting cells first present
either the administered peptide epitope or viral epitope to CD4+ heiper cells. These T-
ceIIs activate the APC's to upregulate costirnulatory signals and at the same time initiate
an inflarnrnatory response. This results in destruction of cells carrying these epitopes.
However, following tissue destruction, cellular debns is taken up by the same group of
activated APC's. Subsequent presentation of cellular epitopes by the activated APC in
turn can Iead to priming of T-cells against self-detenninants.
T-ceil mediated immunity against unmodified STF 1 O tumor cells may also arise from
determinant spreading afier initial pruning with ALVAC epitopes- M C ' S picking up
turnor debns can present ALVAC epitopes fiom the initial cellular vaccines to CD4+ Th1
helpers, leading to APC activation. The APC in tum could activate CD8+ T-ceiis against
cells bearing ALVAC epitopes, while Th1 helpers could initiate an inflammatory
response- The resdting destruction of ALVAC bearing tumor cells could lead to the
uptake of cellular debris by activated denciritic cells and B-celis. These APC's which still
express upregulated costirnulatory molecules can now prime T-cells against cellular
epitopes. This in turn can induce a protective antitumor response when animais are
chailenged wiîh wild type tumor cells.
T-ce11 Independent Antitumor Mechanisms
in the experiments presented here, mice were shown to be significantly protected fiom
challenge after two respective vaccines of STFlO celfs bearing parental or recombinant
ALVAC vectors. While this level of antitumor immunity implicates imrnunologicai
memory, and hence, T-ce11 activity, primary tumor vaccines consisting of STFlO cells
bearing parental and recombinant ALVAC vectors were also significantly rejected in
homozygous nude mice which lack mature T-cells. Again, the added expression of IL-12
or B7-1 or both did not confer any additionaiiy protective effect over that mediated by the
vector alone. That this rejection of STFlO variants is not as potent as in wild type mice is
evidence that T-cells are indeed involved in primary rejection; however, the significant
level of protection over rnice receiving unmodified cells suggests the added role of other
effectors, such as macrophages, NK cells or neutrophils.
One of the fust studies of T-ce11 independent reactivity against gene modified tumor
vaccines was carried out by Golumbek et ai. (31) who showed that while growth of
Renca cells in nude or SCID rnice resulted in 100% mortality within 20 days, Renca cells
expressing IL-4 did not grow at al1 in nude or SCID mice until after two months post
injections. Histologic examination of the injection site in wild type mice showed a
presence of macrophages, as detennined by both gross characteristics, as well as Mac-1
positivity. This showed that in some cases, the initial phases of tumor rejection may be
carried out by non specific effectors, though T-cells may be required for ultimate
clearance.
A more specific mode1 of TA3 - independent NK - mediated antitumoral reactivity was
demonstrated by Alosco et al. (1 0 1) where murine fibrosarcoma CMS-5 cells either did
not grow, or regressed in SCID mice. This turnor rejection was ablated when mice were
treated with anti-asialo GM-1, which reduces NK activity. In parallel, in vitro
cytotoxicity of splenocytes was reduced against al1 of CMS-5, CMS-5 + IL-2 and YAC-1
cells when mice were treated with anti-asialo GM-1.
T-ce11 independent antinimor reactivity as a result of non specific responses against a
viral vector was observed by Siders et al. (102) using a renal carcinoma metastasis
model. In this report, Siders et al. established a metastatic hepatic malignancy by
intrasplenic injection of Adenovhs expressing IL- 12, or P-gal. In wild type mice, the
number of metastases were cured by 94% with injection of Ad EL42 (relative to no
treatment), and by 25-40% with injection of Ad P-gal. Staining of hepatic sections
revealed the existence of CD3+ T-celis, as well as lysozyme containing cells (neutrophils
or macrophages) around hepatic blood vessels of animals treated with Ad vectors.
To clarify the mode of antitunoral reactivity, the experiment was repeated in SCID mice,
where it was observed that treatment with Ad P-gal reduced the number of metastases by
46% while treatment with Ad IL-12 reduced the number of metastases by 95%. This
showed that firstly, an antitumoral response could by elicited by administration of the
virus alone, although not as efficiently as with IL-12 expression, and that the response
may not be T or B ce11 mediated. NK-ce11 depletion in SCID mice abrogated the
antitumoral activity in response to Ad P-gal, but Ad-IL-12 still atlowed for efficient
rejection of turnors. This showed that in this scenario, IL-12 exerts a greater effect in
mediating tumor rejection that is greater than that af5orded by the vector alone. However,
even the effect that is mediated by the vector is significant, and may not be entirely
dependent on T-cells.
A sirnilar model may be applicable in rejection of tumor cells bearing ALVAC vectors.
While T-cells may be responsible for ultimate clearance of tumors, such as in the case
with Golumbek et ai. (3 l), other effectors such as macrophages, neutrophils or NK celis
may be responsible for the partial clearance that is observed in nude mice. Because there
is no enhancement of the antitumor response with ALVAC-IL- 12 and / or ALVAC B7-1
over ALVAC alone, the immunogenicity of the tumor cells in nude mice can be
attributed to the virus alone. In nude mice, non adaptive effectors such as macrophages
and NK cells may be recognizing the tumor cells as targets that have been rnodified by
the virus in such a way as to be more likely candidates for killing- The virai effects on
the tumor cells are unclear at this point, but in addition to possible T-ce11 stimulatory
effects as dîscussed above, they are dehitely immunostimulatory towards other effectors
as well.
In Vitro CTL Activi-
In the in viîro CTL experiments presented here, splenocytes fiom mice immunized with
STF1 O/ALVAC IL-12 react against STFlO tumor cells infected with ALVAC IL- 12 but
not STF 1 0 alone, when stimulated in vitro with STF 1 O/ALVAC IL- 12. Subsequently, a
side-by-side comparison of different in viîro stimuli of either STF 1 OIALVAC or STF 10,
showed that stimulation by STF 10 alone allowed generation of T-cells specific for both
STF 1 O/ALVAC as well as unmodified STF 10, while stimulation with STF 1 OIALVAC
reduced the amount of observed reactivity against unmodified STFIO. Thus, it can be
concluded that STF10-specific CTL's can be amplified in vitro from spleens of
immunized mice, however, their amplification is dependent on the mode of stimulation.
Stimulation via STF 1 O/ALVAC (or STF 1 O/ALVAC IL- 12) allows the generation of T-
cells specific only for STF 10 infected with ALVAC viruses, while stimulation via STF l O
allows amplification of C m ' s specific for either STF 1 O or STF 1 O/ALVAC. Incidentally,
cells that were stimulated with Sm 1 O o d y displayed higher killing of STF 1 O/ALVAC
targets, relative to STFlO targets, at lower effector to target ratios. This may be due to
the fact that these splenocytes consist of T-cells that are specific for STFlO epitopes, as
well as T-cells specific for viral epitopes, and wbat we are observing is a synergistic
effect of these two groupe of cells, during lysis of STFlO cells beaing ALVAC.
Alternaiively, however, there is an increase in MHC class 1 expression (around 33%) in
STF 1 O cells after infection via recombinant ALVAC vectors. The higher level of MHC I
could provide a greater number of targets for T-cells that are specific for tumor epitopes,
leading to greater overall killing.
The fact that wild type tumors can be killed by splenocytes after stimulation via STFlO
shows that splenic T-cells specific for STFlO are indeed present around day 25; however,
their in vitro amplification is somehow being blocked during stimulation with STFl O
cells that have been infected with ALVAC. This inhibition of STFlO-specific T-ce11
amplification may be explained either by an inefficient presentation of tumor epitopes
during stimulation via STFlO/ALVAC (and hence an inefficient expansion of STF IO-
specific T-cells), or an inherently low level of tumor ce11 specific T-cells in the original
splenic population.
Suboptimal levels of T-ce11 activation due to differential antigen presentation was
demonstrated by Gallimore et al. (103) using LCMV viral antigens as immunogens. In
this report, it was shown that iaimunization of vaccinia immune mice with vaccinia
encoding a subdominant LCMV glycoprotein epitope (GP117) protected mice when
challenged with LCMV bearing GP 1 1 7. However, the same mice were not protected
when they were challenged with LCMV bearing GPI 17 as well as two other
immunodominant epitopes GP33 and GP276. Stability assays showed the GP117 - H-2b
cornplex to have a half life of less than 2 hours, while the GP33 - H-2b and GP-276 - H-2b
complexes had half-lives greater than 4 hours. Furthemore, peptide elution experiments
showed that while MC57 cells infected with the LCMV variant bearing GP117 but not
GP33 and GP276 gave an active fraction for GP117 as expected, cells that had been
infected with wild type LCMV did not display GPI 17. This suggested that in the
presence of other immunodominant epitopes in the cell, subdominant epitopes may not be
presented as efficiently. Gallimore et ai. (103) propose a mode1 whereby the presentation
of a subdominant epitope may be "competed out'' either due to higher dissociation rate
fiom MHC molecules or due to differentid processing via the ER.
Sirniiarly, in STFlO cells that have been infected with ALVAC viruses, it may be
possible that viral epitopes are being presented to T-cells more efficiently d u ~ g ex vivo
stimulation of spienocytes h m immunized mice. This difference in efficiency may be
due to a number of reasons, including a higher affinity of the viral epitopes for MHC
class 1, more efficient processing of viral epitopes via the ER, or the presence of a greater
number of viral epitopes that can effectively compete out the cellular epitopes for binding
to MHC. Regardless, cellular epitopes are excluded to the end-effect that in vitro, STFlO
epitope specific T-cells are not being expanded when stimulated STFlO/ALVAC or
STF 1 O/ALVAC IL- 12.
Alternatively, în animals that have k e n vaccinated with STF IO infected with parental or
recombinant ALVAC vectors, cytotoxic T-celi clones specific for TRA epitopes may be
fewer in number than those specific for ALVAC epitopes, and hence are not being
effrciently expanded when stimulated with STFlO/ALVAC. A significant difference
between the total number of peripherai T-cells that are specific for one antigen versus
another antigen may arise due to CDS+ T-ce11 cornpetition, a phenornenon described by
Freitas et al. (104).
Freitas et al. have demonstrated that reconstitution of irradiated hosts with a mixture of
transgenic (Tg) and non-transgenic (non-Tg) lymphocytes allows establishment of
peripheral CD8+ T-celts at frequencies that are dependent on the specificity of the
transgenic K R . Generally, in chimeras reconstituted with mixtures of Tg and non Tg
cells at Iow ratios of Tg/ non Tg, mature transgenic CDS+ cells in the periphery were rare
or absent. In chimeras with higher initial frequencies of Tg bone marrow cells, the
percentage of CDS+ single positive Tg cells was significant in the peripheral pool, but the
frequency was dependent on the TCR specificity. T-cells that were specific for HY
antigen constituted less than 10% of the peripheral (splenic and LN) population (relative
to non Tg cells), and T-cells specific for LCMV P 14 antigen constituted greater than 50%
of cells in periphery, when reconstituted separately with non transgenic cells. A
subsequent experîment, which looked at the effect of mixing the two transgenic
lymphocyte precursors, showed that at low anti HY: anti Pl4 precursor ratios, anti HY T-
cells in the periphery were rare. In contrast at high ratios, anti HY cells constituted the
majority of peripheral CD8+ T-cells after the f h t weeks of reconstitution, but at 3 weeks,
both populations reached identicai sizes. Finally, at 16 weeks, P l4 transgenic cells
became the dominant population. In vivo BrdU staining reveaied that while proliferation
of peripheral CD8+ transgenic was poor relative to wild type cells overall, in chimeras
injected with both anti HY and anti P14, there was an increased accumulation of stained
anti P l 4 ceIIs relative to anti HY cells. Further, the majority of the anti P l4 cells are
activated (CD44t) while only I O - 1 5% of anti KY ceUs are activated. These results Led
to the postulation that cornpetition does exist in selection of T-cells and that cellular
dominance may occur by preferential ce11 activation. In other words, a state of activation
may confer a "selective advantageY7 in establishing a dominant population (1 04).
This mode1 may be applicable in explaining why in vitro stimulation of splenocytes from
immunized mice with STF 1 O/ALVAC preferentially amplifies cells specific for
STFIO/ALVAC and not STFlO. In the in vivo situation T-cells specific for tumor
epitopes may initially constitute a smaller proportion of the entire population relative to
other T-ce1ls which are specific for non self peptides such as ALVAC epitopes. During
immunization with STFlO/ALVAC, the anti-ALVAC T-cells may be activated more
efficiently than anti STFIO ceIIs due to reasons such as immunodominance. This in tuni
could result in the dominance of ALVAC specific T-cells over STF10 specific T-cells in
the spleen. When these splenocytes are harvested and stimulated with STFlO/ALVAC,
anti-ALVAC T-cells preferentially expand due to the selective advantage gained by their
superior numbers and activation stahis. This leads to masking of STF10 specific T-cells
as these cells cannot establish a dominant population. In contrast, when stimulating with
STFlO oniy, anti-ALVAC T-celb are not re activated ex vivo and this time, anti STFlO
T-cells may regain a selective advantage due to their preferential activation.
Future Directions
The usefùlness of the ALVAC vector in immunotherapy of cancer has been demonstrated
by other investigators through use of murine models. In previous reports, therapeutic
effects have been gained through the expression of recombinant genes via the ALVAC
vector, while the vector itself has been shown ta be moderately immunogeaic by itself.
This report established the inherent imrnunogenicity of the ALVAC virus vector M e r ,
in a mode1 whereby the virus itself is 100Y0 immunogenic, as well as protective towards
wiId type tumor challenge.
A natural progression of this work would be to extend this particular turnor mode1 in
order to make it more representative of actual human malignancies, where disease may
often by well established before gene therapy is applied. Thus, the efficiency of the
ALVAC vector has to be evaluated in the treatment of established turnors whereby wild
type STFlO cells are inoculated within the mode1 animal, and treatment begins at a
subsequent tirnepoint. The nature of the treatment could involve the intratumoral
injection of ALVAC virues bearing IL42 or B7-1, to directly modiQ the existing tumor
cells such that the local immune effectors are subsequently activated. Altemativeiy, the
treatrnent could consist of an injection of radiation-inactivated tumor cells expressing IL-
12 or B7-1, and in this scenario, effectors are activated initially by the gene rnodified
vaccines. If systemic immunity is conferred, a subsequent response may then be directed
against the established wiid type turnor.
To ultimately make this vector suitable for cancer therapy in humans, a balance has to be
established in minimizing the immunogenicity of the ALVAC virus, while maximizing
the therapeutic effects of the recombinant genes. Factors affecting the level of
immunogenicity may include attributes unique to the model itself, such as tumor type and
MHC background. but also general treatment approaches such as route of administration,
dose of vim, as well as model of tumor establishment and treatrnent, So fa. the cancer
treatment modeis utilizing ALVAC have not been established with the differential effects
of these characteristics in mind. Thus, while the ALVAC virus is still an attractive vector
for cancer gene therapy, the relative effects of each of these parameters should be
established with regard to ALVAC immunogenicity. While clinicd trials utilizing
ALVAC are already underway, parameters influencing viral immunogenicity need to be
better defined before the ALVAC virus vector is applied more extensively for therapeutic
purposes.
References
1. Burnet, F. M. 1 970. The concept of immunological surveillance. Prog EXp Turnor
Res 13:L
2. Boon, T., J. C. Cerottini, B. Van den Eynde, P. van der Bruggen. and A. Van Pel.
1994. Tumor antigens recognized by T lymphocytes. Annu Rev Imrnunol12:337.
3 . Bodmer, W. F., M. J. Browning, P. Krausa, A. Rowan, D. C. Bicknell, and J. G.
Bodmer. 1993. Twnor escape fiom immune response by variation in HLA expression and
other mechanisms. Ann N Y Acad Sci 690:12.
4. Maryanski, J. L., M. Marchand, C. Uyttenhove, and T. Boon. 1983- Immunogenic
variants obtained by mutagenesis of mouse mastocytoma P8 15. VI. Occasional escape
from host rejection due to antigen-loss secondary variants. Int J Cancer 3 1 : 11 9.
5. Torre-Arnione, G., R. D. Beauchamp, H. Koeppen, B. H. Park, H. Schreiber, H.
L. Moses, and D. A. Rowley. 1990. A highly immunogenic tumor transfected with a
murine transforming growth factor type beta 1 cDNA escapes immune surveillance. Proc
Nat2 Acad Sci U S A 87:1186.
6. Chen, L., S. Ashe, W. A. Brady, 1. Hellstrom, K. E. Hellstrom, J. A. Ledbetter, P.
McGowan, and P. S. Linsley. 1992. Costimulation of antitumor imrnunity by the B7
counterreceptor for the T lymphocyte molecules CD28 and CTLA-4. Cell 71.-1093.
7 . Janeway, C. A. 1997. hmunobiology: The hrnune System in Health and
Disease. Current Biology/Garland f ublishing Inc.
8. Dranoff, G., E. Jaffee, A. Lazenby, P. Golumbek, H. Levitsky, K. Brose, V.
Jackson, H. Hamada, D. Pardoll, and R. C. Mulligan. 1993. Vaccination with irradiated
tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating
factor stimulates potent, specific, and long-lasihg anti-tumor immunity. Proc Nati Acad
Sci U S A 90r3539.
9. Huang, A. Y., P. Golumbek, M. Ahmadzadeh, E. Jaffee, D. Pardoll, and H.
Levitsky. 1994. Role of bone marrow-derived cells in presenting MHC class 1-restricted
tumor antigens. Science 264: 961.
10. Mueller, D. L., M. K. Jenkins, and R. H. Schwartz 1989. Clonal expansion versus
fùnctional cional inactivation: a costimuiatory signalling pathway determines the
outcome of T ceil antigen receptor occupancy. Annu Rev lmmunol7:445.
1 1. Baskar, S. 1996. Gene-modified tumor cells as cellular vaccine, Cancer Imrnunol
lrnrnunother 43: 165.
12. Townsend, S. E., and J. P. Allison. 1993. Tumor rejection after direct
costirnulation of CDS+ T cells by 87- transfected melanoma cells [see comments].
Science 259:368.
13. Chen,L.,P.McGowan,S.Ashe,J.Johnston,Y.Li,I.Hellstrom,andK.E.
Hellstrom. 1994. Turnor immunogenicity determines the effect of B7 costimulation on T
cell-mediated turnor ünmunity. J E X p Med 1 79:%?3.
14. Freeman, G. J., J. G. Gribben, V. A. Boussiotis, J. W. Ng, V. A. Restivo, Jr., L. A.
Lombard, G. S. Gray, and L. M. Nadler. 1993. Cloning of B7-2: a CTLA-4 counter-
receptor that costirnulates human T ce11 proliferation [see comments]. Science 262,909.
15. La Motte, R. N., M. A. Rubin, E. Barr, J. M. Leiden, J. A. Bluestone, and M. B.
Mokyr. 1996. Therapeutic effectiveness of the imrnunity elicited by P8 15 tumor cells
engineered to express the B7-2 costimuiatory molecule. Cancer hmrinol lmrnunother
42.- 161.
16. Yang, G., K. E. Hellstrom, 1. Hellstrom, and L. Chen. 1995. Antitumor immunity
elicited by tumor cells transfected with B7-2, a second ligand for CD28KTLA-4
costirnulatory molecules. J lmrnunolI51:2794.
17. Sartor, W. M., N. Kyprianou, D. F. Fabian, and A. T. Lefor. 1995. Enhanced
expression of IC AM- 1 in a murine fibrosarcorna reduces tumor gro wth rate. J Surg Res
59: 66.
18. Brno. D. K., N. Kyprianou, W. M. Sartor, D. F. Fabian, J. Turner, TT. Vu, A-
Patel, C. Trirnbach, and A. T. Lefor. 1995. Transfection of a m u ~ e fibrosarcoma with
intercel lular adhesion molecule- l enhances the response to adoptive immunotherapy.
Surgery I l 8-23 7.
19. Uzendoski, K., J. A. Kantor, S. 1. Abrams, J. Schlom, and J. W. Hodge. 1997.
Construction and characterization of a recombinant vaccinia virus expressing murine
intercellular adhesion molecule- 1 : induction and potentiation of antitumor responses.
Hztm Gene Ther 8 :8 j 1.
20. Pollok, K. E., Y. J. Kim, J. Hurtado, 2. Zhou, K. K. Kim, and B. S. Kwon. 1994-
4-IBB T-ce11 antigen binds to mature B cells and macrophages, and costirnulates anti-
mu-primed splenic B cells. Eur J lmmunol24.-367.
21. DeBenedette, M. A., N. R. Chu, K. E. Pollok, J. Hurtado, W. F. Wade, B. S.
Kwon, and T. H. Watts. 1995. Role of 4-1BB ligand in costimulation of T lymphocyte
growth and its upregulation on Ml 2 B lymphomas by CAMP. J f ip Med 181:98j.
22. DeBenedette, M . A., A. Shahinian, T. W. Mak, and T. H. Watts. 1997.
Costimulation of CDî8- T lymphocytes by 4- 1 BB ligand. J Zmmunol I j 8 : j j l .
23. Guinn, B. A., M. A. DeBenedette, T. H. Watts, and N. L. Berinstein. 1999. 4-
IBBL cooperates with B7-1 and 87-2 in converting a B ce11 lymphorna cell Luie into a
long-lasting antitumor vaccine. J Imrnunol162:5003.
24. Melero, I., N- Bach, K. E. Hellstrom, A. A d o , R. S. Mitder, and L. Chen. 1998.
Amplification of tumor immunity by gene transfer of the CO-stimulatory 4-1BB ligand:
synergy with the CD28 CO-stimulatory pathway. Eur J Immun02 28: 11 16.
25- Melero, I., W- W- Shuford, S. A. Newby, A. A d o , J- A. Ledbetîer, K. E,
Hellstrom, R S. Mittler, and L. Chen. 1997. Monoclonal antibodies against the 4- 1 BB T-
ce11 activation molecule eradicate established tumors. Nar Med 3:682-
26. Colombo, M. P., and G. Fomi. 1994. Cytokine gene transfer in tumor inhibition
and tumor therapy: where are we now? Immunol Toduy 15:48.
27. Tepper, R. I., and J. J. Mule. 1994. Experiniental and clinical studies of cytokine
gene-modified hunor cells. Hum Gene Ther 5: 153.
38. Douvdevani, A., M. Huleihel, M. Zoller, S. Segai, and R. N. Apte. 1992. Reduced
tumorigenicity of fibrosarcomas which constitutively generate IL-1 alpha either
spontaneously or following IL- 1 alpha gene transfer. Inr J Cancer 5 1 :8X.
29. Fearon, E. R., D. M. Pardoll, T. Itaya, P. Golurnbek, H. 1. Levitsky, J. W. Simons,
H. Karasuyama, B. Vogelstein, and P. Frost. 1990. Interleukin-2 production by tumor
celIs bypasses T helper function in the generation of an antitumor response. Cell60:397.
30. Gansbacher, B., K. Zier, B. Daniels, K. Cronin, R. Bannerji, and E. Gilboa. 1990.
lnterleukin 2 gene transfer into tumor cells abrogates tumorigenicity and induces
protective irnmunity. J Exp Med 1 72: 12 1 7.
3 1. Golurnbek, P. T.3 A. J. Lazenby, H. 1. Levitsky, L. M. JaEee, K. Karasuyama, M.
Baker, and D. M. Pardoll. 1991. Treatment of established reaal cancer by tumor cells
engineered to secrete interleukin-4. Science 254: 713.
3 2 Tepper, R, I., P. K. Pattengale, and P. Leder. 1989. Murine interleukin-4 displays
potent anti-tumor activity in vivo. Ce22 5 7:jO3.
33. Gansbacher, B., R Banne rji, B. Daniels, K. Zier, K. Cronin, and E. Gilboa. 1990.
Retroviral vector-mediated gamma-interferon gene transfer into tumot cells generates
potent and long lasting antitumor immunity. Cancer Res 50: 7820.
34. Porgador, A., R. Banneji, Y. Watanabe, M. Feldman, E. Gilboa, and L.
Eisenbach. 1993. Antirnetastatic vaccination of tumor-bearing rnice with two types of
IFN- gamma gene-inserted tumor cells. J ïmmzrnal150: 11/58.
35. Esumi, N., B. Hunt, T. Itaya, and P. Frost. 199 1. Reduced tumorigenicity of
murine tumor cells secreting gamma-interferon is due to nonspecific host responses and
is unrelated to ctass I major histocompatibility complex expression. Cancer Res ji:lZ85.
36. Porgador, A., E. Tzehoval, A. Katz, E. Vadai, M. Revel, M. Feldman, and L.
Eisenbach. 1992. Interleukin 6 gene transfection into Lewis lung carcinoma turnor cells
suppresses the malignant phenotype and confers irnmunotherapeutic cornpetence against
parental metastatic cells. Cancer Res 52:3679.
37. Sun, W. H., R- A. Kreisle, A. W. Phillips, and W, B. Ershler. 1992. In vivo and in
vitro characteristics of interleukin 6-transfected B 16 melanoma cells. Cancer Res
52:5312.
38. Hock, H., M. Dorsch, T. Diamantstein, and T. Blankenstein. 199 1. Interleukin 7
induces CD4+ T cell-dependent tumor rejection. J E X p Med 1 74: 129 1.
39. McBride, W. H., 5. D. Thacker, S. Comora, J. S. Economou, D. Kelley, D. Hogge,
S. M. Dubinett, and G. J. Dougherty. 1992. Genetic modification of a murine
fibrosarcoma to produce interleukin 7 stimulates host ce11 infiltration and turnor
irnmunity. Cancer Res S2:393 1.
40. Zitvogel, L., H. Tahara, P. D. Robbins, W. J. Storkus, M. R. Clarke, M. A.
Nalesnik, and M. T. Lotze. 1995. Cancer immunotherapy of established turnors with IL-
12. EEective delivery by geneticaliy engineered fibroblasts. Jlmmunoll55:1393.
41. Tahara, H., L. Zitvogel, W. J. Storkus, H. J. Zeh, 3rd, T. G. McKimey, R. D.
Schreiber, U. Gubler, P. D. Robbins, and M. T. Lotze. 1995. Effective eradication of
established murine tumors with IL-12 gene therapy using a polycistronic retroviral
vector- J lmrnunol154:6466.
42. Asher, A. L., J. J. Mule, A. Kasid, N. P. Restifo, J. C. Salo, C. M. Reichert, G.
Jaffe, B. Fendly, M. Kriegler, and S. A. Rosenberg. 1991. Murine tumor cells transduced
with the gene for tumor necrosis factor- alpha. Evidence for paracrine immune effects of
tumor necrosis factor against tumors. J Immunol I46:322 7.
43. Blankenstein, T., Z. H. Qin, K. Uberla, W. Muller. H. Rosen, H. D. Volk, and T.
Diamantstein. 199 1. Tumor suppression after tumor cell-targeted tumor necrosis factor
alpha gene transfer. J &CI Med 173: IO.17.
44. Ley, V., P. Langlade-Demoyen, P. Kourilsky, and E. L. Larsson-Sciard. 1991.
Interleukin 2-dependent activation of tumor-specific cytotoxic T lymphocytes in vivo.
Ezrr J lmrnzrnol2 1 :8j 1.
45. Cavallo, F., M. Giovarelli, A. Gulino, A. Vacca, A. Stoppacciaro. A. Modesti, and
G. Forni. 1992. Role of neutrophils and CD4+ T lymphocytes in the primary and memory
response to nonimmunogenic murine mammary adenocarchoma made immunogenic by
IL-2 gene. J hrnunol149:3627.
46. Karp, S. E., A. Farber, J. C. Salo, P. Hwu, G. M e , A. L. Asher, E. Shiloni, N. P.
Restifo, J. J. Mule, and S. A. Rosenberg. 1993. Cytokine secretion by genetically
modified nonimmunogenic murine fibrosarcoma Tumor inhibition by IL-2 but not tunor
necrosis factor. J Immun01 IjO:896.
47. Cornor, J., R. Banne rji, S. Saito, W. Heston, W. Fair, and E. Gilboa, 1993.
Regression of bladder tumors in mice treated with interleukin 2 gene- modified tunor
cells [published erratum appears in J Exp Med 1993 Jun 1 : 177(6):following 183 11. J Erp
Med 177:1127.
48. Porgador, A., B. Gansbacher, R. Bannerji, E. Tzehoval, E. Gilboa, M. Feldman,
and L. Eisenbach. 1993. Anti-metastatic vaccination of tumor-bearing mice with IL-2-
gene- inserted tumor cells. Int J Cancer 53:471.
49. Cohen, M. C., and S. Cohen. 1996. Cytokine function: a study in biologic
diversity. Am J Clin Parhol105:589.
50. Berinstein, N. L. 1998. Biological Therapy of Cancer. In The Basic Science of
O n c o l o ~ . 1. F. Tannock, and R. P. Hill, eds. McGraw-Hill Health Professions Division.
New York.
51. Watanabe, Y., K. Kuribayashi, S. Miyatake, K. Nishihara, E. Nakayama, T.
Taniyama, and T. Sakata. 1989. Exogenous expression of mouse interferon gamma
cDNA in mouse neuroblastoma Cl300 cells results in reduced tumorigenicity by
augmented anti-tumor imrnunity. Pruc Nat1 Acad Sci U S A 86:9456.
52. Stem, A. S., F. J. Podlaski, J. D. Hulmes, Y. C. Pan, P. M. Quim, A. G.
Wolitzky, P. C. Familletti, D- L. Stremlo, T. Truitt, R. Chizzonite, and et al. 1990.
Purification to homogeneity and partial characterization of cytotoxic lymphocyte
maturation factor fiom human B-lymphoblastoid celts- Proc Natl Acad Sci U S A
8 7: 6808.
53. Kobayashi, M., L. Fitz, M. Ryan, R M. Hewick, S- C. Clark, S- Chan, R- Loudon,
F. Sherman, B- Perussia, and G- Truichieri- 1989- Identification and purification of
natural killer ceIl stimulatory factor (NKSF), a cytokine with multiple biologic effects on
human lymphocytes. J EXp Med I70:827,
54. Schoenhaut, D. S., A. O. Chua, A. G. Wolitzky, P. M. Quim, C. M. Dwyer, W.
McComas, P. C. Familletti, M. K. Gately, and U. Gubler. 1992. Cloning and expression
of murine IL- 12. J Immunol H8:3433.
55. Gately, M. K., R. R. Warrier, S. Honasoge, D. M. Carvajal, D. A. Faherty, S. E.
Co~aughton , T. D. Anderson, U. Sarmiento, B. R. Hubbard, and M. Murphy. 1994.
Administration of recombinant IL- 12 to normal mice enhances cytolytic lymphocyte
activity and induces production of IFN-gamma in vivo. Int Immunol6: 157.
56. Gerrnann, T., M. K. Gately, D. S. Schoenhaut, M. Lohoff, F. Mattner, S. Fischer,
S. C. Jin, E. Schmitt, and E. Rude. 1993. Interleukin-I2/T ce11 stimulating factor, a
cytokine with multiple effects on T helper type 1 (TH) but not on Th2 cells. Eur J
Imrnunol23: 1762.
57. Kubin, M., M. Kamoun, and G. Tnnchieri. 1994. Interleukin 12 synergizes with
B7/CD28 interaction in inducing efficient proMeration and cytokine production of human
T cells. J Exp Med 2 8O:2ll.
58. Coughlin, C. M., M. Wysocka, H. L. Kurzawa, W. M. Lee, G. Triachieri, and S.
L. Eck. 1995. B7-1 and interleukin 12 synergistically induce effective antitumor
immunity. Cancer Res 55.4980.
59. Rao, J. B., R S. Chamberlain, V. Bronte, M. W. Carroil, K. R Irvine, B. Moss, S.
A. Rosenberg, and N. P. Restifo. 1996. IL-12 is an effective adjuvant to recombinant
vaccinia virus-based tumor vaccines: enhancement by simultaneous B7-1 expression. J
lmmunol156:3357.
60. Pizzoferrato, E., N. R. Chu, T. S. Hawley, F. H. Lieu, B. H. Barber, R. G.
Hawley, T. H. Watts, and N. L. Berinstein. 1997. Enhanced immunogenicity of B ce11
lymphoma genetically engineered to express both B7- 1 and interleukin- 12. Hum Gene
Ther 8 : Z 1 7 .
6 1. Fallarino, F., A. Ashikari, T. Boon, and T. F. Gajewski. 1997. Antigen-specific
regression of established tumors induced by active immunization with irradiated IL-12-
but not B7-1-transfected tumor cells. Int Immunol9:1259.
62. Mahvi, D. M., J. K. Burkholder, J. Turner, J. Culp, J. S. Malter, P. M. Sondel, and
N. S. Yang. 1996. Particle-mediated gene transfer of granulocyte-macrophage colony-
stimulating factor cDNA to turnor cells: implications for a clinically relevant tumor
vaccine. Hum Gene Ther 7: 1535.
63. Irvine, K. R., J. B. Rao, S. A. Rosenberg, and N. P. Restifo. 1996. Cytokine
enhancement of DNA immunization leads to effective treatment of established
pulmonary metastases. J Immunol 1 56:238.
64. Nabel, G. J., E. G. Nabel, 2. Y. Yang, B. A. Fox, G. E. Plautz, X. Gao, L. Huang,
S. Shu, D. Gordon, and A. E. Chang. 1993. Direct gene transfer with DNA-liposome
complexes in melanoma: expression, biologic activity, and lack of toxicity in humans.
Proc Nat2 Acad Sci U S A 90: 1 130 7.
65. Nabel, G. J., D. Gordon, D. K. Bishop, B. J. Nickoloff, 2. Y. Yang, A. Aruga, M.
J. Cameron, E. G. Nabel, and A. E. Chang. 1996. h u n e response in human melanoma
after transfer of an allogeneic class 1 major histocompatibility complex gene with DNA-
liposome complexes. Proc Narl Acad Sci U S A 93: Ij388.
66. Hawley, R- G-, F. H- Lieu, A- Z- Fong, and T- S- Hawtey- 1994- Versatile
retroviral vectors for potential use in gene therapy. Gene Ther 1:136.
67. Hitt, M., A. J. Bett, L. Prevec, and F. L. Graham. 1994, Construction and
Propagation of Hurnan Adenovirus Vectors. In Ce21 Biology: A laboratory handbook. J.
E . Celis, ed. Academic Press, San Diego.
68. Bett, A. J., W. Haddara, LI Prevec, and F. L. Graham. 1994. An efficient and
flexible system for construction of adenovirus vectors with insertions or deletions in early
regions 1 and 3. Proc Natl Acad Sci U S A 91:8802.
69. Mittal, S. K., A. J. Bett, L. Prevec, and F. L. Graham. 1995, Foreign gene
expression by human adenovins type 5-based vectors studied using firefly luciferase and
bacterial beta-galactosidase genes as reporters. Virology 210:226.
70. Li, Q., M. A. Kay, M. Finegold, L. D. Stratford-Perricaudet, and S. L. Woo. 1993.
Assessment of recombinant adenoviral vectors for hepatic gene therapy. Hum Gene Ther
./:-/O3.
71. Bramson, J. L., F. L. Graham, and J. Gauldie. 1995. The use of adenoviral vectors
for gene therapy and gene transfer in vivo. Curr Opin Biotechno26:590.
72. Yang, Y., F. A- Nunes, K. Berencsi, E. E. Furth, E, Gonczol, and J. M. Wilson.
1 994. Cellular immunity to viral antigens lirnits E 1 -deleted adenoviruses for gene
therapy . Proc Natl Acad Sci U S A 91:4307.
73. Waniier, G., M. T. Duffour, C. Uyttenhove, T. F. Gajewski. C. Lurquin, H.
Haddada, M. Perricaudet, and T. Boon. 1996. Induction of a cytolytic T-ce11 response in
mice with a recombinant adenovirus coding for tumor antigen PSISA. Int J Cancer
67:303.
74. Bramson, J. L., M. Hitt, C. L. Addison, W. J. Muller, J. Gauldie, and F- L.
Graham. 1 996. Direct intratumoral injection of an adenovirus expressing interleukin- 1 2
induces regression and long-lasting immunity that is associated with highly localized
expression of interleukin- 12. Hum Gene Ther 7: 1995.
75. Fenner, F. 1996. Poxvinises. In Fields ViroZogy. B. N. Fields, D. M. Knipe, and P.
M. Howley, eds. Lippincott-Raven Press, Philadelphia.
76. Moss, B. 1990. Poxviridae and their Replication. In Virology. B. N. Fields, and D.
M. Knipe. eds. Raven Press Limited, New York.
77. Goebel, S. J., G. P. Johnson, M. E. Perkus, S. W. Davis, J. P- Winslow, and E.
Paoletti. 1990. The complete DNA sequence of vaccinia virus. Virotogv 1 79:247.
78. Moss, B. 1991. Vaccinia virus: a tool for research and vaccine development.
Science 252: 1662.
79. Puisieux, I., L. Odin, D. Poujoly P. Moingeon, J. Tartaglia, W. Cox, and M.
Favrot. 1998. Canarypox virus-mediated interleukin 12 gene transfer into murine
mammary adenocarcinorna induces tumor suppression and long-term antitumoral
irnmunity [see comments]. Hum Gene Ther 9:248l.
80. Tartaglia, J., M. E. Perkus, J. Taylor, E. K. Norton, J. C. Audomet, W. 1. Cox, S.
W. Davis, J. van der Hoeven, B. Meignier, M. Riviere, and et al. 1992. NYVAC: a highly
attenuated strain of vaccinia v h . Virology 18812 1 7.
81. Kawakita, M., G, S. Rao, J. K. Ritchey, D. KI Omstein, M. A. Hudson, J.
Tartaglia, E. Paoletti, P. A. Humphrey, T. J- Harrnon, and T. L. Ratliff- 1997. Effect of
canarypox virus (AL,VAC)-mediated cytokine expression on murine prostate turnor
growth [see comments] . J Nat2 Cancer I . 8 9 : 4 2 8 .
82. Roth, J. A., and R. J. Cristiano. 1997. Gene therapy for cancer: what have we
done and where are we going? J Nat1 Cancer lnst 8912 1.
83. Paoletti, E., J. Tartaglia, and W. 1. Cox. 1993. Immunotherapeutic strategies for
cancer using poxvirus vectors, Ann N Y Acad Sci 6901293.
84. Toso, J. F., C. Oei, F- Oshidari, J. Tartaglia, E. Paoletti, H. K. Lyerly, S. Talib,
and K. J. Weinhold. 1996. MAGE- 1 -specific precursor cytotoxic T-lymphocytes present
among turnor- infiltrathg lymphocytes fiom a patient with breast cancer: characterization
and antigen-specific activation. Cancer Res 56: 16.
85. Roth, J., D. Dittrner, D. Rea, J. Tartaglia, E. Paoletti, and A. J. Levine. 1996. p53
as a target for cancer vaccines: recombinant canarypox virus vectors expressing p53
protect mice against lethal turnor ce11 challenge. Proc Naft Acad Sci U S A 93.4 78 1.
86. Hodge, J. W., J. P. McLaughlin, J. A. Kantor, and JI Schlom. 1997. Diversified
prime and boost protocols using recombinant vaccinia virus and recombinant non-
rep licating avian pox virus to enhance T-cell imrnunity and antitumor responses. Vaccine
15: 759.
87. Marshdl, J. L., M. J. Hawkins, K. Y. Tsang, E. Richmond, J. E. Pedicano, M. 2.
Zhu, and J. Schlom. 1999. Phase I shidy in cancer patients of a replication-defective
avipox recombinant vaccine that expresses human carcinoembryonic antigen. J C h
Oncol 17:332.
88. Matzinger, P. 199 1. The JAM test. A simple assay for DNA fragmentation and
ce11 death. Jimmunol Merhods 14.5:185.
89. Demkowicz, W. E., J. S. Maa, and M. Esteban. 1992. Identification and
characterization of vaccinia virus genes encoding proteins that are highly antigenic in
animals and are immunodominant in vaccinated humans. J C/irol66:386.
90. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale,
G. A. Koretzky, and D. M. Klinman. 1995. CpG motifs in bacterial DNA tngger direct B-
ce11 activation. Naiure 374346.
91. Stacey, K. J., M. J. Sweet, and D. A. Hume. 1996. Macrophages ingest and are
activated by bacterial DNA. J lmmrtnol157:2116.
92. Ballas, S . K., W. L. Rasmussen, and A. M. Krieg. 1996. Induction of NK activity
in murine and human cells by CpG motifs in oligodeoxynucleotides and bactenal DNA. J
lrnmunol157:1840.
93. Jakob, T., P. S. Walker, A. M. Krieg, M. C. Udey, and J. C. Vogel. 1998.
Activation of cutaneous dendritic cells by CpG-containing otigodeoxynucleotides: a role
for dendritic cells in the augmentation of Thl responses by immunostirnulatory DNA. J
lmmunol161:3042.
94. Kundig, T. M., M.F. Bachmann,S. Oehen, U. W. H o f i a m , J. J. Simard, C. P.
Kalberer, H. Pircher, P. S. Ohashi, H. Hengartner, and R. M. Zinkernagel. 1996. On the
role of antigen in maintainhg cytotoxic T-ce11 memory. Proc Natl Acad Sci U S A
93~9716.
95. KaufÏnan, D. L., M. Clare-Salzler, J. Tian, T. Forsthuber, G. S. Ting, P. Robinson,
M. A. Atkinson, E. E. Sercarz, A. J. Tobin, and P. V. Lehmann. 1993, Spontaneous loss
of T-ce11 tolerance to glutamic acid decarboxylase in murine insuiin-dependent diabetes
[see comments] . Nature 366169.
96- McRae, B. L.+ C. L. Vanderlugt, M. C. Dal Canto, and S. D. Miller. 1995.
Fwictional evidence for epitope spreading in the relapsing pathology of experimental
autoimmune encephalomyelitis. J Ejrp Med 182: 75.
97. Lehmann, P. V., T. Forsthuber, A- Miller, and E. E, Sercarz. 1992- Spreading of
T-ce11 autoimmunity to cryptic determinants of an autoantigen. Nature 358: 155.
98. Cross, A- H-, V. K. Tuohy, and C. S. Raine. 1993. Development of reactivity to
new myelin antigens during chronic relapsîng autoimmune demyelination. Cell Immunol
1-/6:261.
99. Miller, S. D., C. L. Vanderlugt, W. S. Begolka, W. Pao, R. L. Yauch, K. L.
Neville, Y. Katz-Levy, A. Carrizosa, and B. S. Kim. 1997. Persistent infection with
Theiler's virus leads to CNS autoimmunity via epitope spreading [see comments]. Nat
Med 3r1133.
100. Vanderlugt, C. L., W. S. Begoka, K. L. Neville, Y. Katz-Levy, L. M. Howard, T.
N. Eagar, J. A. Bluestone, and S. D. Miller. 1998. The functional sigaificame of epitope
spreading and its regulation by CO-stimulatory molecules. Immunol Rev 164.63.
101. Alosco, T., B. A. Croy, B. Gansbacher, H. Q. Wang, U. Rao, and R. Bankert.
1993. Antitumor response independent of functional B or T lymphocytes induced by the
local and sustained release of interleukin-2 by the tumor cells, Cancer immun01
Imrnunother 3 6:3 64.
102. Siders, W. M., P. W. Wright, J. A. Hixon, W. G . Alvord, T. C. Back, R. H.
Wiltrout, and R. G. Fenton. 1998. T cell- and NK cell-independent inhibition of hepatic
metastases by systemic administration of an IL- 12-expressing recombinant adenovulis. J
Imrnunol Z6O:S.f6.j.
103. Gallimore, A., J. Hombach, T. Dumrese, H. G. Rammensee, R. M- Zinkernagel,
and H. Hengartner. 1998. A protective cytotoxic T ce11 response to a subdominant epitope
is influenced by the stability of the MHC class Ilpeptide complex and the overall
spectnim of Wal peptides generated within uifected cells. Eicr J Irnmunol28:3301.
104. Freitas, A. A., F. Agenes, and G. C. Coutinho. 1996. Cellular cornpetition
modulates survival and selection of CD8+ T cells. Eur J Immun01 26:2640.
Table 1 : Level of IL- 1 2 secreted by STF 1 O cells pnor to immunization of mice
Experiment purp~se STF 10 vaccine constituent Level of IL- 12 (ng/mL)
Tumorigenicity in Wild Vaccination Type BALBlc
Turnorigenicityinwild Prime Type BALBlc
(prime / boost)
Tumorigenicity in Wild Boost Type BALB/c
(prime / boost)
Tumorigenicity in Nude Vaccination Mice
Tumorigenicity in Nude Vaccination Mice
(Repeat)
Uninfected ALVAC ALVAC B7-1 ALVAC IL-12 ALVAC B7- I/ALVAC CL- 12
Uninfectecf ALVAC ALVAC B7-1 ALVAC IL- 12
Uninfected ALVAC ALVAC B7-1 ALVAC IL-12
Uninfected ALVAC ALVAC B7-I ALVAC L-12 ALVAC B7-I/ALVAC IL-12
Uninfecteci ALVAC ALVAC B7-1 ALVAC IL-12
4.5 f 0.56 Not Assayed Not Assayed 97.3 f: 4.4 54.5 I 2 - 4
Al1 Values are expressed in ng/ml/million ceIld24 hours
I
ALVAC hB7- 1 (vCP 1334)
C6 MCS
1 I ALVAC mIL- 12 (vCP 1303)
C5 MCS C6 MCS C5 MCS
Figure 1: Genomic Organization of recombinant ALVAC viruses
The ALVAC virus vector consists of a linear double stranded DNA molecule meüsuriiig about 325 Kbp. The multiple cloning sites C5 md C6 have been inserted us shown above. The ALVAC 87- 1 construct consists of a Iiumun 87- 1 cDNA dnven by the vaccinia H6 promoter inserted into the C6 MCS. The ALVAC IL- 12 constnict consists of two p35 subunit cDNA sequences each clriven by one E3L vaccinia promoter, and a p40 subunit cDNA driven by the entomopox 42K proinoter. The p35 and p40 subunit constructs are inserted into the C5 and C6 loci, respectivety.
A20 NFS 70 Cl498 B16 K46J
F
Fluorcsccncc Intensity
Figure 2: Heterogeneity in ALVAC Viral Transduction
To determine the tropism exhibited by the Canarypox virus ALVAC, cell lines of different lineages and stages were assayed for the ability to successfully take up the vinis and express the virally encoded protein B7-1. Clear histograms represent cells that were specifically stained by anti-human B7-1 antibody, while shaded Iiistograms represent staining via iln isotype matched non specific antibody. Result indicûte that recombinant 87- 1 is expressed only in select tissues represented by NFS-70, B 16, ST, as well as two ST subclones STFI O and STG4. A20, K46J. C 1498 and P8 15 are comyletely negative for ALVAC encoded produc ts.
94
CD 44 CD 25 HSA
I
Fluorcsccncc lnlcnsily
Figure 3: Surface Marker Phenotype of STF10
STFlO cells were staincd with antibodies specific for the surke-expressed proteins indicated, and then assayed by cell cytornetiy as outlined in Materiils and Methods. Clear histograrns represent specific staining for the mürker indicated, while shaded histograms represent irrelevant staining of STF10 vin a non-specific isotype inatched ontibody.
Water
NFS-70 Prep 3
NFS-70 Prep 2
NFS-70 Prep 1
ST-FI0 + ALVAC *fV 1 +RT
100 bp marker
Water Mouse Genomic DNA
NFS-70 Prep 1 / +RT
ST-FI 0 + ALVAC 1 +RT
Water
NFS-70 Prep 3
NFS-70 Prep 2
NFS-70 Prep 1
100 bp marker
Water NFS-70 Prep 3
NFS-70 Prep 1
STf I O Growth Characteristics
Cell Line:
O 20 40 60 80 100
Time Aïter Infection (Hours)
Figure 5: Growth Characteristics of STFlO Cells alter infection via ALVAC vectors
STFlO cells were infected with ALVAC 87-1 as outlined in Materials and Methods, and then replated in culture media at a concentration of 20,000 cellslml. Growth was monitored over a period of 4 days, and was compared to the growth rate of a STFlO culture that was plated at the same concentration, but was uninfected with ALVAC B7-1. Results indicate that infection of cells via recombinant ALVAC vectors does not alter the growth characterstics of the STFI O cells as the rate of expansion of the two cultures is similar.
6 Ilouts inlo Viriil Iiifcctioii 24 Hours Foltowitig Virril Iiifirciioii
Figure 6: E(iect of ALVAC viral Infection on MHC class 1 expression via STFlO cells
STFlO cells were infected with ALVAC 87-1 es outlined in Materials and Methods, and assayed for the expression of MHC 1 at tirnepoints corresponding to 6 hours into viral infection, aiid 24 hours following viral infection. Uesults indicnte that there is iio downregulütion of classical MHC class 1 ( H - 2 ~ b n d H-2Dd) as the georntric mean fluoresceiice of infected cells is 17 at 6 hours, and 19 at 24 hours, complired to uninfected cells whicli display il geoinetric mcan fluorescence of 14 at 6 hours and 15 at 24 hours.
98
- . . -
Survival of Mice Post STF10 Variant Injection
100 @-* a&
O 2 0 40 6 0
Dayr ?out Injection
STÇ10 Tumor Vaccines:
-+- Uninfected + ALVAC
-t ALVACIB7- 1 1
Figure 8: Survival of Mice Post STF10 Tumor Variant Vaccination
STFlO cells were infected with one of a) No Virus b) ALVAC c) ALVAC 87- 1 d) ALVAC IL- 12 or e) ALVAC IL12 & ALVAC B7- 1, and injected subcutaneously into mice (using 5 mice per vaccine). Mice rcceiving cells alone succumbed to tumor, whereas mice that received cells coniaining eithcr parental or recombinant ALVAC vectors, al1 rejected their tumors at a frequency of 100%.
Percentage Survival
1 Survid of Nude Mire Following STFIO Tumor Variant InjDrtion I A i o o i
80
(a 6 0 .L 2
40 al m m 0 2 0 2 al a O
O
STFI 0 Vaccine:
Days Post Injection - . . . . - .
-&- Üninfected + ALVAC + ALVAC 87-1 + ALVAC IL-12 +ALVAC 87-1 / IL-12
.. . . . -.. - - - ..
STF10 Vaccine::
Days Post Injection . . -
+ Uninfected + ALVAC + ALVAC 87-1 * ALVAC IL- 1 2 *AL 87-1/lL-12
Figure 10: Tumorigenicity of STFlO Variants in Nude Mice
STF! O cells were infected with parental or recombinant ALVAC viruses as described in Materials and Methods, and injected subcutaneously into nude mice. All onimals receiving cells alone succumbed to tumor in botli experiments (A & B). Animals receiving STFlO cells containhg either parental or recombinant ALVAC vectors displayed tumor rejection at statisitically significant (p < 0.05) frequencies, relative to inice receiving cells alone, in both independent experiments.
102
Suwival ot Mice Following Wild Type STF10 Challenge
P
O 20 40 6 0
0 8 ~ 8 P08t Challenge
Initial Vaccination Status:
-+- Naïve Control
+ ALVAC
+ ALVAC 87-1
-Jt ALVAC IL- 1 2
+ ALVAC 1112 (Unboosted)
-+ ALB71IALIL12
Figure 11: Survival of Mice Post W U Type STPlO Challenge Following Vaccine Boost
Mice were primed and boosted with cellular vaccines of a) STFlO / ALVAC b) STFlO / ALVAC 87 1 c) STFlO / ALVAC I L 4 2 d) STF IO/ALVAC B7- I and STF 10 1 ALVAC IL- 12. In addition, one group of mice was only primed with STF 10 1 ALVAC IL- 12, but left unboosted. Vaccinations and boosts were administered subcutaneously, on the right flank, with the boost taking place 35 days after the initial vaccination. 21 days post the boost, mice were challenged subcutaneously on the left flank with wild type STF10 cells and assayed for survival. Naive controls that had not been previously vaccinited al1 developed tumors, while al1 other vaccinated groups displayed improved survival relative to naive mice (p < 0.05 for al1 groups relative to nnive mice).
1 Target : STFlO 1 ALVAC IL-12 Cells 1
A Specltk Lyds et Day 17
w -, 5 0 Immunization Status -' 40 -& STF1 OIALVAC @ 30 IL-12
P 20 . .
V) + Naïve
8 O b
O 50 100 150
Effector : Target Ratio
B Speclflc Lysls i t Day 27 6 0 1 1
2 5 0 lmmuniratlon Status
+ STF? OIALVAC IL- 12
U)
/ + NaTve
$ 1 0
O 50 1 O0 150 EHsctor : Target Ratlo
C Speclflc Lysk at Day 17
1 Targets: Wild Type STFlO Cells I
lmmunization Status
O 5 0 100 150
Effector : Target Ratlo
Speciflc Lysis at Dey 27
lrnmuniratlon Status - . - + STF1 OIALVAC
IL-12
-C- Nalve
O 1 O0 200
Effector : Target Ratio
13, 17,27 riiid 35. Splcnocylcs wcrc stimulatcd with STFIOIALVAC ILI 2 nnd spccific killing iigiiinst STFIOIALVAC IL-12 (A & B) or wild type STFIO (C & D) cells wris cvaluatcd. Cytolytiç activity w u obscrvcd on dny 27 agninsi STFIOIALVAC IL-12 cclls (B) and nui STFIO cclls (D). No cyiolyiic iiciivity agninsi cithcr iypc of cclls was obscrvcd on dav 13 (nui show). dav 17 (A & C) und dav 35 (nui shown).
1 O4
- . . - - . -. - 1 In Mtro Stimulation with wild Type STFlO 1
Figure 13: ECtccts of Diflerential Stimulation on Splcnocytt Rtrctivity igainst STF10: Mice were immunized with STFlOlALVAC and then boosted with the same vaccine, 21 days followeing the boost, splenocytcs from an immunired mouse and R naïve conrol were Iiarvesied and stimulated with STFlO (A Rt B) or STFIO/ALVAC (C). Results indicate that cytolytic pwursors specific for STFlO are indeed present in the splenocyte culture (A). in addition to those specific for STF l OlALVAC (B); however. their detection is dependent on stimulation with wild type STFI O. Stiniulation via STP 1 OlALVAC does not yield entcient cytotoxicity against wild type STFI 0, relative to naive controls (C).
105
top related