keys lab training – dna barcoding: identification of species pipetting: measuring volumes...

Post on 11-Jan-2016

217 Views

Category:

Documents

0 Downloads

Preview:

Click to see full reader

TRANSCRIPT

KEYS Lab Training – DNA Barcoding: Identification of Species

• Pipetting: Measuring Volumes Accurately• DNA Extraction• PCR and Gel Electrophoresis• Sequencing and Analysis

– Protein Profile: Evolutionary Relationships• Protein Extraction• Determine Protein Concentrations• SDS-PAGE• Stain Protein Gels and Analyze

THE INS AND OUTS OF PIPETTINGPush Button• First Stop: Measurement• Second Stop: Expel volume

Sizes & Volumes• P10 Measures 0.5-10 l• P20: Measures 2-20 l• P200: Measures 20-200l• P1000: Measures 200-1000l

Tips & Tip Ejectors• Match the tip to the Pipet

Tip ejector button

Volume Adjustment Knob

MEASURING VOLUMES

DNA Sequence Data is Obtained for Genetic Research

…TTCACCAACAGGCCCACA…

Extract DNA from Cells

Sequence DNA

Identify matching DNA sequence(s) in

databases

Obtain DNA-bearing tissue samples:

blood , saliva, hair follicles, feathers,

scales

TTCAACAACAGGCCCACTTCACCAACAGGCCCACTTCATCTACAGCCCCAC

• Sample• Extract the DNA• Amplify R.O.I.• Ensure amplification ok• Analyze DNA

– Restriction analysis– Hybridization– Sequencing

• Various Sushi Fish• Dilution Buffer cracks cells• Release Cores pick DNA• Phire Animal Tissue Direct PCR

Kit uses primers to amplify DNA R.O.I.

• Agarose Gel Electrophoresis• DNA Sequencing

From Sample to Sequence

…TTCACCAACAGGCCCACA…

Fish DNAbarcode Primers

Primer mix: 2 forward, 2 reverse•5’- TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC-3’•5’- TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC-3’ •5’- CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA-3’•5’- CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA-3’

From Sequence to Conclusion

PCR is like DNA replication

• DNA Replication• Nuclear DNA • DNA polymerases • Helicase• Primers (from Primase)• dNTPs

• Polymerase Chain Reaction• Sample DNA (from fish)• DNA polymerase• Heat• Primers (specific to COI gene)• dNTPs

PCR Ingredients• 1. DNA “template” Your purified DNA sample

• 2. DNA Polymerase Special DNA polymerase enzyme that is heat stable

• 3. Deoxynucleotides (dNTPs) Building blocks of DNA

• 4. Primers Small pieces of DNA that match the flanks of your

gene or DNA region of interest

• 5. Buffer and water Environment necessary for DNA Polymerase to work; mimics conditions in nucleus

The Power of PCR

http://www.nature.com/scitable/topicpage/the-biotechnology-revolution-pcr-and-the-use-553

View the animation at http://www.dnalc.org/resources/animations/pcr.html

(may require Flash player or Shockwave player)

Fish DNA extraction for PCR• Add 20 µl of Dilution Buffer to a 0.2 ml tube.• Place your fish sample on a clean weigh boat, or other clean surface.• Remove the protective cap of the Uni-Core tool.• Gently push the cutting edge downward into the sample, rotating

gently. Do not press the plunger while cutting.• Lift the tool from the sample, position tool over tube and press the

plunger so that the tissue drops directly into the dilution solution (make sure that you can see the sample in the solution).

• Add 0.5 µl of DNA release solution and vortex briefly, then spin down the solution (make sure the tissue is covered).

• Incubate 2-5 minutes at room temperature, then 2 minutes at 98°C.• Spin down the tissue and move supernatant to a clean 0.65 ml tube.

PCR Ingredients1. Label top of tube 2. Add 20.5 l of nuclease free H203. Add 25 l of 2X Phire PCR Buffer4. Add 2.5 l of DNA sample in Dilution buffer5. Add 2 l of primer mix (both forward and reverse)6. Add 1 l of Phire Hot Start DNA polymerase

PCR Reaction1. 98°C 5 min-denaturation of all DNA in tube2. 98°C 5 sec-denaturation 3. 52°C 20 sec-anneal4. 72 °C 20 sec-extension5. Repeat steps 2-4 30 times6. 72°C 10 min-final extension

Agarose Gel ElectrophoresisMolecular Weight

Standard (DNA of Known Sizes)

1 2 3 4 5 6

Samples of DNA

2000 bp

1000 bp750 bp

Lanes:

Agarose Gel Electrophoresis

• 1. Make the agarose gel: prepare TAE and agarose

• 2. Prepare your sample: mix 10ul DNA with Loading Dye

• 3. Load your sample on the gel

• 4. Run the gel

• 5. Stain and view the gel

Agarose Gel Electrophoresis• Agarose: from agar (seaweed)• Melt the agarose and pour

into a form or gel mold• Small wells in the top of the

gel for DNA samples

• 1. Prepare agarose gel

• 2. Prepare your sample

• 3. Load your sample

• 4. Run gel

• 5. Stain & view gel

Agarose Gel Electrophoresis• 1. Prepare agarose gel

• 2. Prepare your sample

• 3. Load your sample

• 4. Run gel

• 5. Stain & view gel

• 10 L DNA• Loading Buffer

– 6X concentrated– Color– Glycerol

Agarose Gel Electrophoresis

• 1. Prepare agarose gel

• 2. Prepare your sample

• 3. Load your sample on the gel

• 4. Run gel

• 5. Stain & view gel

http://oceanexplorer.noaa.gov/explorations/03bio/background/molecular/media/gel_plate.html

Agarose Gel Electrophoresis

• 1. Prepare agarose gel

• 2. Prepare your sample

• 3. Load your sample

• 4. Run gel

• 5. Stain & view gel

http://bristoluniversityfacultyofscience.blogspot.com/2010/06/tanias-tales-from-lab-part-3.html

Power Supply

Gel Box with Gel

ElectrodesRed = PositiveBlack = Negative

Voltage/Amps

Molecular Weight

500bp

1000bp

2000bp

Samples 2 3 4 5 6

Agarose Gel Electrophoresis• 1. Prepare agarose gel• 2. Prepare your sample• 3. Load your sample• 4. Run gel• 5. Stain & view the gel

Ethidium Bromide & UV Light

http://scienceblogs.com/moleculeoftheday/2/10/ethidium_glowing_dna.php http://www.vernier.com/biotech/wht-dbs.html http://www.vernier.com/biotech/wht-dbs.html

Fast BlastBlack & White image of UVSeparating pieces of DNA

based on size

DNA Sequencing

http://www.scq.ubc.ca/genome-projects-uncovering-the-blueprints-of-biology/

• 1. DNA “template”Your PCR fragment, purified

• 2. Taq PolymeraseHeat-stable DNA polymerase

• 3. Deoxynucleotides (dNTPs) and DideoxynucleotidesBuilding blocks of DNA; regular and altered

• 4. PrimersSpecific for your gene of interest

• 5. Buffer and water

Genetic Researchers Developed Primers for Barcoding

Pool COI-2: mammals, and insects

Pool COI-3: fish

Ivanova et al. 2007. Universal primer cocktails for fish barcoding. Mol Ecol Notes.

top related