identification of new carbohydrate and membrane protein antigens in cardiac xenotransplantation

BASIC AND EXPERIMENTAL RESEARCH

Identification of New Carbohydrate and MembraneProtein Antigens in Cardiac Xenotransplantation

Guerard W. Byrne,1,2,3,4 Paul G. Stalboerger,1 Zeji Du,1 Tessa R. Davis,1

and Christopher G. A. McGregor1,2,3

Background. �1,3-Galactosyltransferase gene knockout (GTKO) pigs reduced the significance of antibody to galactosealpha 1,3-galactose (Gal) antigens but did not eliminate delayed xenograft rejection (DXR). We hypothesize that DXRof GTKO organs results from an antibody response to a limited number of non-Gal endothelial cell (EC) membraneantigens. In this study, we screened a retrovirus expression library to identify EC membrane antigens detected aftercardiac xenotransplantation.Methods. Expression libraries were made from GT�:CD46 and GTKO porcine aortic ECs. Viral stocks were used toinfect human embryonic kidney cells (HEK) that were selected by flow cytometry for IgG binding from sensitizedcardiac heterotopic xenograft recipients. After three to seven rounds of selection, individual clones were assessed fornon-Gal IgG binding. The porcine complementary DNA was recovered by polymerase chain reaction amplification,sequenced, and identified by homology comparisons.Results. A total of 199 and 317 clones were analyzed from GT�:CD46 and GTKO porcine aortic EC complementaryDNA libraries, respectively. Sequence analysis identified porcine CD9, CD46, CD59, and the EC protein C receptor. Wealso identified porcine annexin A2 and a glycosyltransferase with homology to the human �1,4 N-acetylgalactosaminyltransferase 2 gene.Conclusion. The identified proteins include key EC functions and suggest that non-Gal antibody responses maycompromise EC functions and thereby contribute to DXR. Recovery of the porcine �1,4 N-acetylgalactosaminyltransferase 2 suggests that an antibody response to a SDa-like carbohydrate may represent a new carbohydrate moietyinvolved in xenotransplantation. The identification of these porcine gene products may lead to further donor modifi-cation to enhance resistance to DXR and further reduce the level of xenograft antigenicity.

Keywords: Xenotransplantation, Cardiac, Antigen.

(Transplantation 2011;91: 287–292)

Preformed and induced antibody directed toward the vas-cular endothelium is considered to be the primary im-

mune mechanism that initiates delayed xenograft rejection(DXR). DXR is believed to result from chronic activation or

injury to the vascular endothelium mediated by antibodybinding, antibody-directed cell cytotoxicity, or complement-mediated damage. These processes promote the formation ofa thrombogenic vasculature, which, if unchecked, leads tomicrovascular thrombosis, ischemic injury, and coagulativenecrosis of the myocardium (1). Rejection may be furtherexacerbated by molecular incompatibilities in thromboregu-lation, which predispose the xenograft toward thrombosis(2). The preformed and induced anti-pig antibody responsewas believed to be primarily directed toward the � galactose(Gal) antigen that is expressed in high abundance throughoutthe porcine vasculature. The development of �Gal-specificpolymers (3) and pigs deficient in the expression of the �Galantigen (�1,3-galactosyltransferase gene knockout [GTKO])(4) have marginalized the role for anti-Gal antibody and re-vealed the potential significance of new preformed and in-duced non-Gal antibody in DXR (5, 6).

Preformed anti-pig non-Gal antibody is present in vari-able levels in both humans and nonhuman primates and eachexhibits a similar level of complement-dependent cytotoxicity toGTKO peripheral blood mononuclear cells (7). The inducednon-Gal antibody specificity is only partially characterized. Ini-tial studies found little evidence of anti-carbohydrate or donor-

This work was supported by NIH grant AI66310.G.W.B. and C.G.A.M. are the inventors of technology related to xenotrans-

plantation that has been licensed by the Mayo Clinic to a commercialentity. The other authors declare no conflict of interest.

1 Department of Surgery, Mayo Clinic, Rochester, MN.2 Department of Surgery, University College London, London, United

Kingdom.3 Department of Medicine, University College London, London, United

Kingdom.4 Address correspondence to: Guerard W. Byrne, Ph.D., University College

London, 74 Huntley Street, London WC1E 6AU, United Kingdom.E-mail: guerard.byrne@ucl.ac.ukG.W.B. participated in research design, writing of the manuscript, and data

analysis; P.G.S. and Z.D. participated in the performance of the researchand writing of the manuscript; T.R.D. participated in the performance ofthe research; and C.G.A.M. participated in research design and writing ofthe manuscript.

Received 7 September 2010. Revision requested 23 September 2010.Accepted 25 October 2010.Copyright © 2011 by Lippincott Williams & WilkinsISSN 0041-1337/11/9103-287DOI: 10.1097/TP.0b013e318203c27d

Transplantation • Volume 91, Number 3, February 15, 2011 www.transplantjournal.com | 287

specific anti-swine leukocyte antigen reactivity but suggestedthat induced non-Gal antibody was targeted to pan-pig or swineleukocyte antigen conserved protein epitopes (8, 9). A system-atic proteomic analysis of non-Gal antibody induced afterpig-to-baboon cardiac xenotransplantation demonstrated im-munoreactivity to a limited set of immunodominant GTKOporcine aortic endothelial cell (PAEC) membrane antigens (10).The identified target antigens included fibronectin and a series ofstress response and inflammation-related proteins. This analysisreported the presence of additional undefined GTKO PAECmembrane antigens, which were not adequately recovered bythe proteomic approach. The induced non-Gal antibody re-sponse may also react with carbohydrate or glycolipid epitopes.Consistent with this an induced primate response to an unde-fined acidic cardiac glycolipid has recently been reported(11, 12). In this report, we used retrovirus-encoded expressionlibraries, produced from GT�:CD46 and GTKO PAECs, toidentify the target antigens detected by induced non-Gal anti-body after pig-to-primate cardiac xenotransplantation.

RESULTS

Antibody SourcesFive pig-to-primate heterotopic cardiac xenotransplants

were performed in the absence of standard T-cell immunosup-pressants. Four transplants were performed using GT�:CD46hearts and a �Gal polymer to block anti-Gal antibody in vivo(13), and one transplant was performed using a GTKO heart. Alltransplants were subjected to a strong cellular and humoral im-mune response and rejected in 5 to 7 days. The xenografts wereexplanted at rejection, and the recipients were monitored for afurther 2 weeks before necropsy. Serum collected at necropsy,approximately 3 weeks after transplant, was enriched in antibodythat bound to GTKO PAECs. In this study, necropsy sera from theGTKO recipient and two GT�:CD46 recipients with the highestnon-Gal antibody titers were used to screen retrovirus-encodedPAECcomplementaryDNA(cDNA)expressionlibraries(Fig.1A).

Expression Library ScreeningA standard cDNA expression library was produced in

the pRETRO vector using polyA-selected messenger RNA(mRNA) from primary cultured GT�:CD46 or GTKOPAECs. We performed four independent analyses of the li-braries using the sensitized antibody represented in Figure 1(A). After selection, a total of 199 and 317 pRETRO-HEK-infected clones were analyzed from GT�:CD46 and GTKOlibraries, respectively (Table 1). Individual pRETRO-HEK in-fected clones exhibited variable level of non-Gal IgG binding(Fig. 1B). Approximately 20% to 50% of the isolated clonesexhibited a viral integration based on polymerase chain reaction(PCR) amplification of the cDNA insert (Table 1 and Fig. 1C).More than 80% of the PCR-positive pRETRO-HEK infectedclones showed 3-fold or greater binding of sensitized IgG com-pared with control pRETRO-infected HEK cells.

Sequence analysis and homology comparisons to theNational Center for Biotechnology Information GenBankdatabase identified six non-Gal target genes (Table 2). Four ofthese non-Gal antigens are type 1 (CD46 and EC protein Creceptor [PROCR]), glycophosphatidylinositol-linked (CD59)or multipass (CD9) membrane proteins, one protein (an-nexin A2 [ANXA2]) is closely associated with the extracellu-

lar surface, and one encodes a glycosyltransferase with stronghomology to the human �1,4 N-acetylgalactosaminyl trans-ferase 2 (B4GALNT2). A summary of the flow cytometry pro-file for each of the pRETRO infected HEK clone is presentedin Figure 2 (a–f).

Confirmation of Non-Gal Target AntigensTo insure that the identified non-Gal target antigens

listed in Table 2 are the authentic targets of the induced anti-body response, each cDNA was individually cloned intopcDNA3.1/V5-His-TOPO, transfected into HEK cells, and astable G418-resistant pcDNA-HEK cell line was established.These stable cell lines were rescreened for antibody binding to

FIGURE 1. Expression library screening and analysis.(A) The non-Gal antibody response after �1,3-galactosyl-transferase gene knockout (GTKO) and GT�:CD46 hetero-topic cardiac xenotransplantation were determined usingflow cytometry by measuring IgG binding to GTKO porcineaortic endothelial cells (PAECs). A comparison of pretrans-plant (white bars) and necropsy (black bars) IgG binding at1:20-fold, 1:80-fold, and 1:320-fold dilution is shown. All re-cipients show an increase in anti-pig non-Gal IgG aftertransplant. The donor organ genotype (GTKO or GT�:CD46) is shown below each data set. (B) Flow cytometry ofIgG binding to individual pRETRO-infected HEK clones.Each line represents a different pRETRO-infected clone.The lines are color coded to denote clones with similar lev-els of antibody binding. The filled histogram is an infectedcontrol HEK cell that does not express a non-Gal antigen.(C) Results of polymerase chain reaction (PCR) amplificationof the pRETRO-encoded porcine complementary DNA(cDNA) using genomic DNA of individual pRETRO-infectedHEK clones. The cDNA product was amplified using PCRprimers, which flank the multiple cloning site of the pRETROvector. These products were cloned and sequenced to iden-tify the non-Gal antigen.

288 | www.transplantjournal.com Transplantation • Volume 91, Number 3, February 15, 2011

validate that an induced antibody response was directed to-ward each of the non-Gal antigens (Fig. 2g–l). Expressionof the non-Gal– encoded genes in GTKO PAECs, heart,and the pcDNA-HEK cell lines was confirmed byreverse-transcriptase (RT)-PCR (Fig. 2m–r).

Antibody Response to Individual AntigensThe antibody response to HEK cells expressing each

non-Gal antigen was measured by comparing pretransplant andnecropsy antibody binding for the five xenograft recipients. Arepresentative IgG response for one baboon is shown (Fig. 3Aand B) as is the average IgG response for all recipients (Fig. 3C).Induced antibody to B4GALNT2, PROCR, CD9, CD59, andCD46 was present in all or at least three of five recipients. Lessconsistent antibody induction was observed for ANXA2.

DISCUSSIONSurvival of cardiac xenografts has significantly improved

during the past 10 years, yet remains limited by DXR, whichseems to be initiated by preformed or induced Gal and non-Galantibody. We hypothesized that a limited number of immuno-dominant non-Gal antigens were likely to be present and thatimmune responses to these antigens were primarily responsiblefor DXR of GTKO organs, at least within the current time frameof cardiac xenograft survival. Identification of these antigens isimportant for developing assays to monitor DXR, may be usedto promote antigen-specific tolerance, may create new opportu-nities for genetic modification, and are essential for understand-ing the mechanism(s) of non-Gal–mediated DXR.

In this study, we screened GT�:CD46 and GTKO PAECexpression libraries using antibody from sensitized pig-to-

primate cardiac xenograft recipients. Historically screeningmammalian expression libraries by flow cytometry has suc-cessfully been used to identify both protein- and glycan-related surface antigens (14 –16). The proteins identified inour study are well-defined membrane surface proteins, pro-teins known to associate with the extracellular surface or pro-teins, which alter the extracellular glycan. These proteins areinvolved in regulation of inflammation (ANXA2), comple-ment (CD46 and CD59), and hemostasis (PROCR and CD9).Antibody responses to each protein would potentially be ableto block important endothelial cell (EC) functions that mightcontribute to the pathology of DXR. CD46 and CD59 arecomplement regulatory proteins (CRPs) (17, 18) that actlocally to establish an intrinsic barrier to complementmediated damage. Antibody directed to porcine CRPs couldplace the donor organ at greater risk for complementmediated damage and reinforces the significance of express-ing human CD46 or other CRPs to control complementmediated injury. ANXA2 is found on the extracellular surfaceand functions as an EC surface receptor for plasminogen andtissue-type plasminogen activator (19). Anti-ANXA2 anti-bodies in patients with antiphospholipid syndrome can causeEC activation and the induction of tissue factor (20). A loss ofANXA2 function leads to reduced levels of tissue-type plas-minogen activator-dependent plasmin generation and mightthereby contribute to microvascular thrombosis during DXR(21). Anti-ANXA2 antibody reactivity was previously re-ported using a proteomic analysis (10). In our library screen,we isolated HEK expressing ANXA2 cells multiple times butsee a relatively infrequent response to ANXA2 in our xeno-graft recipients. This may be an under estimate of the fre-quency of anti-ANXA2 antibody because ANXA2 surfaceexpression on HEK cells may not accurately represent expres-sion on ECs. CD9 is a tetraspanin protein family member.Anti-CD9 antibodies efficiently activate platelets, in some in-stances inducing a lethal thrombosis (22). CD9 is alsoexpressed on ECs where antibodies to CD9 promote neutro-phil adhesion (23). PROCR acts on the EC surface to enhancethe formation of activated protein C by the complex ofthrombin and thrombomodulin (24). Activated protein C is apotent anticoagulant. There is also a soluble form of PROCRthat seems to bind to neutrophils and decrease their bindingto the endothelium (25). Detection of an induced antibodyresponse to these proteins strongly suggests that non-GalDXR involves not only in antibody-directed injury and acti-vation of the endothelium but also in antibody-mediatedblocking of key EC functions. This suggests that substitution

TABLE 2. Non-Gal antigens identified from a porcine cDNA expression library

Species Gene name Gene symbol NCBI ref. Function

Sus scrofa Tetraspanin 29 CD9 NM_214006.1 Platelet and EC activation

Sus scrofa Membrane cofactor protein CD46 NM_213888.1 Complement regulation

Sus scrofa Protectin CD59 NM_214170.1 Complement regulation

Sus scrofa EC protein C receptor PROCR NM_001163406 Thrombosis

Sus scrofa Annexin A2 ANXA2 NM_001005726.1 Inflammation

Bos taurusa � 1,4 N-acetylgalactosaminyl transferase 2 B4GALNT2 XM_584835.3 Glycosylation

a The sequence with closest homology is presented.cDNA, complementary DNA; EC, endothelial cell; Gal, galactose.

TABLE 1. Summary of library screen

Libraries

GT�:CD46 GTKO

Clones isolated 199 317

Detected PCR inserts 116 (0.58) 75 (0.24)

Antibody reactive 114 (0.98) 62 (0.83)

Data represent the number of clones isolated from the GT�:CD46 andGTKO expression libraries, the number of clones with amplifiable inserts,and the number of antibody reactive clones. Values in parenthesis indicatethe fraction of total clones with PCR inserts and the fraction of clones withPCR inserts which bound non-Gal antibody.

GTKO, �1,3-galactosyltransferase gene knockout; PCR, polymerasechain reaction; Gal, galactose.

© 2011 Lippincott Williams & Wilkins 289Byrne et al.

or transgenic expression of the corresponding human genefunction may be useful for maintaining hemostasis and pro-moting resistance to non-Gal DXR.

We have also identified a porcine gene with high ho-mology to human and mouse B4GALNT2. In humans andmice, the B4GALNT2 enzyme catalyzes the �1-4 addition ofN-acetylgalactosamine (GalNAc) to terminal �2-3 sialylatedGal residues to produce the SDa antigen (also known as CAD)(26, 27). This carbohydrate structure is most abundant on theTamm-Horsfall urinary glycoprotein. A similar carbohydratestructure, produced by a separate glycosyltransferase, is alsopresent in the GM2 glycolipid. High levels of B4GALNT2 en-zymatic activity have been reported in porcine intestinal epi-thelial cells, but the overall expression of B4GALNT2 RNAand distribution of SDa antigen in the pig are apparently notknown (28). We show that B4GALNT2 RNA is present inporcine heart and GTKO PAECs (Fig. 2r) and have prelimi-nary evidence of RNA expression in the kidney liver, spleen,and peripheral blood mononuclear cells (data not shown).The recovery of the porcine B4GALNT2 gene in our libraryscreen suggests that an anti-SDa antibody or an antibody re-

sponse to a SDa-like carbohydrate present on the vasculatureof the xenograft may be part of the non-Gal immune re-sponse. This later interpretation seems likely as an anti-SDa

antibody (KM694, Tokyo Research Laboratories, KyowaHakko Kirin Co. Ltd., Tokyo, Japan) binds to porcineB4GALNT2-expressing HEK cells but does not bind to GT�

or GTKO PAECs (data not shown). The lectin DBA binds toGalNAc residues and is often used for SDa staining and candistinguish SDa� and SDa� human samples (29). This lectinalso binds A1-type blood antigen. Dolichos biflorus aggluti-nin (DBA) has long been known to bind to porcine vascularECs at high levels irrespective of their ABH blood group, con-sistent with the presence of a SDa-like antigen (30 –32). We donot know the precise structure of the glycan(s) displayed byHEK cells expressing the porcine B4GALNT2 product or byGTKO PAECs, but it seems likely to include a sialylated Gal ora �-linked terminal GalNAc structure similar to the SDa car-bohydrate. A carbohydrate of this type would be consistentwith recent reports of induce non-Gal antibody to terminalGalNAc glycans and of baboon reactivity to acidic glycolipids(11, 12). Targeted inactivation of the porcine B4GALNT2

FIGURE 2. The identification, confirmation, and expression of non-Gal porcine aortic endothelial cell (PAEC) antigens.(A) Flow cytometry of IgG binding to pRETRO-infected HEK cells for individual non-Gal antigens. (B) Flow cytometryshowing IgG binding to G418-resistant pcDNA3.1/V5-His-TOPO transfected cell lines expressing individual non-Gal anti-gens. (C) Reverse-transcriptase polymerase chain reaction analysis of non-Gal gene expression. RNA samples: lane 1, pigheart; lane 2, GTKO PAECs; lanes 3 to 5, independent G418-resistant HEK transformants; lane 6, untransformed HEK cells;lane 7, a flow cytometry negative HEK cell line; and lanes 8 to 10, the same as lanes 3–5 but without reverse transcriptase.Non-Gal antigen expression: (a, g, and m) CD9; (b, h, and n) PROCR; (c, i, and o) CD46; (d, j, and p) CD59; (e, k, and q)ANXA2; and (f, l, and r) B4GALNT2.

290 | www.transplantjournal.com Transplantation • Volume 91, Number 3, February 15, 2011

gene in combination with the existing �-galactosyltransferase(GGTA-1) mutation may be useful to further reduce the an-tigenicity of porcine xenografts.

The frequency of identifying an individual clone in thisscreening procedure is dependent on the abundance and size ofthe mRNA in PAECs, the efficiency of cloning, the level of pro-tein expression, and the prevalence and affinity of antibody inthe serum. In this study, all the clones except CD46 and PROCRwere identified multiple times during the screening process. Itremains possible that additional non-Gal antigens could beidentified by further screening or that different antigens mightbe detected using sensitized sera from islet or kidney transplantrecipients. These results identify for the first time a glycosyltrans-ferase that produces a non-Gal carbohydrate antigen that maycontribute to DXR. They also suggest that non-Gal–inducedDXR may in part result from antibody responses that can poten-tially block key PAEC functions. Our results support furthermodification of the donor to promote resistance to non-GalDXR or to further minimize the level of porcine antigenicity.Additional characterization of these antigen-antibody interac-tions and those defined by proteomic analysis will be requiredaccurately to determine the frequency of an antibody response toeach antigen and to validate their contribution to DXR.

MATERIALS AND METHODS

Library Formation and SelectionExpression libraries were constructed in the pRetro-LIB vector (Clon-

tech, Takara Bio, Japan) using poly (A)� mRNA from GT�:CD46 or

GTKO PAECs. The cDNA libraries contained 2.6 to 3.0�106 clones, 80%to 93% of which had cDNA insertions. The average insert size was 2.0 kb,with a size ranging from 0.8 to 4.8 kb. Library plasmid DNA was cotrans-fected with pVSV-G into GP2-293 packaging cells to produce a high-titer(�106 colony-forming unit) viral stock. The titer of the viral stock wasestimated using an alkaline phosphatase encoding control vector accordingto manufacturer’s recommendations. For infection, HEK cells (1�106) wereincubated with 2 mL of virus stock containing 4 �g/mL of polybrene. In-fected HEK cells were collected after 48 hr, labeled with sensitized serumfrom a pig-to-primate cardiac xenograft recipient, and stained with Goatanti-human IgG-fluorescein isothiocyanate (FITC; Zymed Laboratories, SanFrancisco, CA). Approximately 5�106 cells were sorted by flow cytometry,and the brightest 10% to 30% of the cells were collected. These bright cellswere culture for 48 to 72 hr before additional selection. A total of three toseven rounds of selection were performed to enrich for non-Galantigen-expressing cells. After the final round of selection, individual cellswere sorted into 96-well plates, and pRETRO-HEK infected clones were iso-lated. Clones were screened for antibody binding, and the cDNA insert wasrecovered by PCR amplification of genomic DNA. The amplified productwas cloned into a TA-cloning vector and sequenced using BigDye Termina-tor v1.1 cycle sequencing and an ABI3730XL sequencer (Invitrogen and ABI,Life Technologies Corp., Carlsbad, CA). A basic local alignment search tool(BLAST) search of the NCBI GenBank database was used to identify theencoded gene.

Flow CytometryNon-Gal antibody binding to GTKO PAECs and to HEK cells expressing

individual non-Gal antigens was detected by flow cytometry. Primary GTKOPAECs were isolated as described previously (10) and grown in 10% fetalbovine serum/Dulbecco’s minimum essential medium supplemented with50 �g/mL endothelial cell growth supplement (ECGS) (BD Biosciences, San

FIGURE 3. A characterization of the specific non-Gal antibody responses detected after pig-to-primate cardiac xeno-transplantation. Pretransplant and sensitized necropsy serum from five cardiac xenograft recipients, not treated with T-cellimmunosuppression, were individually screened for IgG reactivity to HEK cells expressing porcine non-Gal antigens. Theimmune response for a single transplant recipient is shown (A and B). The non-Gal antigen names are indicated above eachcolumn. (A) Pretransplant serum 1:40 dilution. (B) Necropsy serum 1:40 dilution. Filled histograms represent IgG binding tonegative control HEK cells not expressing a non-Gal antigen, and lines indicate specific IgG binding to the indicatedantigen. Specific antibody reactivity was calculated as indicated in the Materials and Methods. (C) The average antibodyresponse for all five recipients to each antigen at 1:40, 1:160, and 1:640 serum dilutions (black, white, and gray filled boxes,respectively). Pretransplant serum (PreTx) and necropsy serum (Nec.). For each antigen, the number of recipients out offive showing a positive induction of antibody is indicated. A positive response was considered to be a 2-fold or greaterincrease in antibody binding in necropsy serum detected in two or more serum dilution.

© 2011 Lippincott Williams & Wilkins 291Byrne et al.

Jose, CA). Baboon serum was diluted (1:20, 1:80, and 1:320) in 1% bovineserum albumin/phosphate-buffered saline and incubated with 2�105 GTKOPAECs for 30 min at 4°C. Cells were washed with 4 mL 1% bovine serumalbumin/phosphate-buffered saline and labeled with goat anti-human IgG-FITC (Invitrogen, Life Technologies Corp., Carlsbad, CA) for 30 min at 4°C,washed, and analyzed using a FACSCalibur (BD Biosciences). HEK cellsexpressing non-Gal antigens were cultured in 10% fetal bovine serum/Dul-becco’s minimum essential medium. Cells were incubated with baboon seraas described, and binding of IgG and IgM was detected with goat anti-humanIgM-FITC (Invitrogen, Life Technologies Corp.) and goat anti-human IgG-RPE (Southern Biotech. Birmingham, AL). Specific antibody binding tonon-Gal– expressing HEK cells was calculated as the difference in mean flu-orescence for antibody binding to HEK cells expressing a given non-Galantigen and antibody binding to pRETRO- infected or pcDNA3.1-trans-fected G418-resistant control HEK cell line, which did not express a porcinenon-Gal antigen.

Expression of Specific Non-Gal Target AntigensThe cDNAs encoding non-Gal antigens identified from the pRETRO li-

brary screen were cloned into pcDNA3.1/V5-His-TOPO (Clontech) andtransfected into HEK cells using Lipofectamine 2000 (Invitrogen, Life Tech-nologies Corp.). The HEK transformants were selected for G418 resistance(500 �g/mL), and a stable cell line for each non-Gal antigen was produced.Stable cell lines were rescreened with sensitized sera as described to confirmantibody reactivity to the non-Gal target antigen.

RT-PCR Analysis of Non-Gal Antigen ExpressionExpression of non-Gal antigens was determined by RT-PCR of RNA samples

from HEK cell lines, porcine hearts, and cultured PAECs. Total RNA wasextracted from cells and pig heart tissue using RNeasy Mini Kit (QIAGEN, Valencia,CA) and RNA-STAT (Iso-Tex Diagnostics Inc., Friendswood, TX), respectively.For RT-PCR, 500 ng of total RNA was used in a 25 �L One-step RT-PCR reac-tion (USB Corp. Cleveland, OH). The reverse transcriptase reaction was per-formed at 42°C for 30 min, followed by 30 cycles of amplification (95°C for 30min, 58°C for 3 min, and 72°C for 2 hr). The amplified products were electro-phoresed through 1% agarose gels, and the ethidium bromide-stained DNA wasimaged using a GelDoc-It imaging system (UVP Inc., Upland, CA). Primers fordetections were CD9: forward, ACCATGGTAATGCCGGTCAAAGGAGGCAand reverse, ATTCTAGACCATCTCTCGGCTC; CD46: forward, ACCATGG-TAATGATGGCGTTTTGCGCGCT and reverse, ATTCCACGTCCTCTCAG-CAAC; CD59: forward, ACGATGGGAAGCAAAGGAGGGTT and reverse,CAGTTAGAGACAAAAGTGCCAGG; PROCR: forward, ACCATGGCGAT-GTTGACAACATTGCTG and reverse, AATTAACATCGCCGCCGTCCAC;ANXA2: forward, ACCATGGCAATGTCTACCGTTCATGA and reverse,CTTCAGTCATCCCCACCACACAGGTAC; and B4GALNT2: forward, AC-CATGGAGATGACTTCGTACAGCCCTAG and reverse, CAGATACCTTAG-GTGGCACATTGGAG.

REFERENCES1. Platt JL, Lin SS, McGregor CG. Acute vascular rejection. Xenotrans-

plantation 1998; 5: 169.2. Cowan PJ. Coagulation and the xenograft endothelium. Xenotrans-

plantation 2007; 14: 7.3. Byrne GW, Schwarz A, Fesi JR, et al. Evaluation of different alpha-

galactosyl glycoconjugates for use in xenotransplantation. BioconjugChem 2002; 13: 571.

4. Lai L, Kolber-Simonds D, Park KW, et al. Production of alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science2002; 295: 1089.

5. Lam TT, Paniagua R, Shivaram G, et al. Anti-non-Gal porcine en-dothelial cell antibodies in acute humoral xenograft rejection ofhDAF-transgenic porcine hearts in cynomolgus monkeys. Xeno-transplantation 2004; 11: 531.

6. Chen G, Qian H, Starzl T, et al. Acute rejection is associated with anti-bodies to non-Gal antigens in baboons using Gal-knockout pig kid-neys. Nat Med 2005; 11: 1295.

7. Rood PP, Hara H, Ezzelarab M, et al. Preformed antibodies to alpha1,3-galactosyltransferase gene-knockout (GT-KO) pig cells in humans, ba-

boons, and monkeys: Implications for xenotransplantation. TransplantProc 2005; 37: 3514.

8. Buhler L, Xu Y, Li W, et al. An investigation of the specificity of inducedanti-pig antibodies in baboons. Xenotransplantation 2003; 10: 88.

9. Ezzelarab M, Hara H, Busch J, et al. Antibodies directed to pig non-Galantigens in naïve and sensitized baboons. Xenotransplantation 2006; 13:400.

10. Byrne GW, Stalboerger PG, Davila E, et al. Proteomic identification ofnon-Gal antibody targets after pig-to-primate cardiac xenotransplan-tation. Xenotransplantation 2008; 15: 268.

11. Diswall M, Angstrom J, Karlsson H, et al. Structural characterization ofalpha1,3-galactosyltransferase knockout pig heart and kidney glycolip-ids and their reactivity with human and baboon antibodies. Xenotrans-plantation 2010; 17: 48.

12. Blixt O, Kumagai-Braesch M, Tibell A, et al. Anticarbohydrate anti-body repertoires in patients transplanted with fetal pig islets revealed byglycan arrays. Am J Transplant 2009; 9: 83.

13. Davila E, Byrne GW, LaBreche PT, et al. T-cell responses during pig-to-primate xenotransplantation. Xenotransplantation 2006; 13: 31.

14. Keusch JJ, Manzella SM, Nyame KA, et al. Expression cloning of a newmember of the ABO blood group glycosyltransferases, iGb3 synthase,that directs the synthesis of Isoglobo-glycosphingolipids. J Biol Chem2000; 275: 25308.

15. Kitamura T, Onishi M, Kinoshita S, et al. Efficient screening of retro-viral cDNA expression libraries. Proc Natl Acad Sci USA 1995; 92: 9146.

16. Dorman BP, Shimizu N, Ruddle FH. Genetic analysis of the human cellsurface: Antigenic marker for the human X chromosome in human-mouse hybrids. Proc Natl Acad Sci USA 1978; 75: 2363.

17. Liszewski MK, Post TW, Atkinson JP. Membrane cofactor protein(MCP or CD46): Newest member of the regulators of complementactivation gene cluster. Annu Rev Immunol 1991; 9: 431.

18. Meri S, Morgan BP, Davies A, et al. Human protectin (CD59), an18,000 –20,000 MW complement lysis restricting factor, inhibits C5b-8catalysed insertion of C9 into lipid bilayers. Immunology 1990; 71: 1.

19. Ling Q, Jacovina AT, Deora A, et al. Annexin II regulates fibrin ho-meostasis and neoangiogenesis in vivo. J Clin Invest 2004; 113: 38.

20. Cesarman-Maus G, Ríos-Luna NP, Deora AB, et al. Autoantibodiesagainst the fibrinolytic receptor, annexin 2, in antiphospholipid syn-drome. Blood 2006; 107: 4375.

21. Cockrell E, Espinola RG, McCrae KR. Annexin A2: Biology and rele-vance to the antiphospholipid syndrome. Lupus 2008; 17: 943.

22. Kawakatsu T, Suzuki M, Kido H, et al. Antithrombotic effect of ananti-glycoprotein IIB/IIIA antibody in primate lethal thrombosis.Thromb Res 1993; 70: 245.

23. Forsyth KD. Anti-CD9 antibodies augment neutrophil adherence toendothelium. Immunology 1991; 72: 292.

24. Van de Wouwer M, Collen D, Conway EM. Thrombomodulin-proteinC-EPCR system: Integrated to regulate coagulation and inflammation.Arterioscler Thromb Vasc Biol 2004; 24: 1374.

25. Esmon CT. Structure and functions of the endothelial cell protein Creceptor. Crit Care Med 2004; 32(5 suppl): S298.

26. Renton PH, Howell P, Ikin EW, et al. Anti-Sd(a), a new blood groupantibody. Vox Sang 1967; 13: 493.

27. Montiel MD, Krzewinski-Recchi MA, Delannoy P, et al. Molecularcloning, gene organization and expression of the human UDP-GalNAc:Neu5Acalpha2–3Galbeta-R beta1,4-N-acetylgalactosaminyl-transferase responsible for the biosynthesis of the blood group Sda/Cadantigen: Evidence for an unusual extended cytoplasmic domain. Bio-chem J 2003; 373(pt 2): 369.

28. Malagolini N, Dall’Olio F, Guerrini S, et al. Identification and charac-terization of the Sda beta 1,4, N-acetylgalactosaminyltransferase frompig large intestine. Glycoconj J 1994; 11: 89.

29. Wu AM, Wu JH, Watkins WM, et al. Differential binding of humanblood group Sd(a�) and Sd(a�) Tamm-Horsfall glycoproteins withDolichos biflorus and Vicia villosa-B4 agglutinins. FEBS Lett 1998; 429:323.

30. Smith DM, Newhouse M, Naziruddin B, et al. Blood groups and trans-fusions in pigs. Xenotransplantation 2006; 13: 186.

31. Johnson EK, Schelling ME, Quitadamo IJ, et al. Cultivation and char-acterization of coronary microvascular endothelial cells: A novel por-cine model using micropigs. Microvasc Res 2002; 64: 278.

32. Solanes N, Rigol M, Ramirez J, et al. Histological basis of the porcinefemoral artery for vascular research. Anat Histol Embryol 2005; 34: 105.

292 | www.transplantjournal.com Transplantation • Volume 91, Number 3, February 15, 2011