fusobacterium nucleatum induces cytokine production through toll-like-receptor-independent mechanism

Fusobacterium nucleatum induces cytokineproduction through Toll-like-receptor-independentmechanism

S. Y. Quah1, G. Bergenholtz2 & K. S. Tan1

1Faculty of Dentistry, National University of Singapore, Singapore City, Singapore; and 2The Sahlgrenska Academy, G€oteborg

University, G€oteborg, Sweden

Abstract

Quah SY, Bergenholtz G, Tan KS. Fusobacterium

nucleatum induces cytokine production through Toll-like-

receptor-independent mechanism. International Endodontic

Journal.

Aim To determine whether Fusobacterium nucleatum’s

ability to invade cells allows the bacteria to activate

pro-inflammatory response through cytosolic pattern

recognition receptors, independent of surface Toll-like

receptors (TLRs).

Methodology HEK293T cells, which lack endoge-

nous TLRs, and overexpressing dominant negative

myeloid differentiation primary response gene 88

(MyD88DN) protein, were infected with F. nucleatum

and the production of interleukin-8 (IL-8) was deter-

mined. The necessity for intracellular invasion of the

bacteria for cytokine production was also investigated

by blocking bacterial invasion with cytochalasin D.

The roles of NFKB and p38 mitogen-activated protein

kinase (MAPK) and nucleotide-binding oligomerization

domain-1 (NOD-1) signalling pathways in F. nucleatum-

induced IL-8 secretion were determined.

Results Fusobacterium nucleatum-infected HEK293T

cells produced IL-8 independent of the MYD88 signal-

ling. This response was inhibited by preventing

F. nucleatum invasion into HEK293T cells. p38 MAPK

but not the NFKB signalling pathway was required for

F. nucleatum-mediated IL-8 production. HEK293T

cells expressed NOD-1 but not NOD-2. Yet, inhibition

of NOD-1 signalling did not affect F. nucleatum-

induced IL-8 secretion.

Conclusions Fusobacterium nucleatum invasion led

to cytokine production, which is mediated by the p38

MAPK signalling but independent of TLRs, NOD-1,

NOD-2 and NFKB signalling.

Keywords: bacterial invasion, Fusobacterium nucle-

atum, nucleotide-binding oligomerization domain-1,

nucleotide-binding oligomerization domain-2, p38

mitogen-activated protein kinase, Toll-like receptors.

Received 24 April 2013; accepted 16 August 2013

Introduction

Fusobacterium nucleatum, a Gram-negative obligate

anaerobic bacterium, is implicated in the pathogenesis

of brain abscesses, pericarditis and oral infections

including periodontal disease and root canal infection

(Socransky et al. 1998, Cheung & Bellas 2007, Kai

et al. 2008, Roc�as et al. 2010). In infected root canals,

this bacterial species is one of the most commonly iso-

lated organisms in untreated teeth. It has also been

associated with the development of severe forms of

interappointment endodontic flare-ups (Chavez de Paz

Villanueva 2002). F. nucleatum is capable of co-aggre-

gating with other bacterial species, often acting as a

bridge between early and late colonizers in biofilms

(Kolenbrander et al. 2002). Recent studies identified

F. nucleatum to be one of the few bacteria enduring

endodontic treatment procedures (Roc�as & Siqueira

2012). Its ability to invade dentinal tubules and orga-

nize into sessile biofilms likely contributes to its persis-

tence and difficulty in eradicating this bacterial species

during root canal treatment (Matsuo et al. 2003).

Correspondence: Kai S. Tan, Faculty of Dentistry, National

University of Singapore, 11 Lower Kent Ridge Road, Singapore

119083, Singapore (Tel.: +65 6516 4635; Fax: +65 6778

5742; e-mail: denkst@nus.edu.sg).

doi:10.1111/iej.12185

In the root canal milieu, immune cells such as

odontoblasts, dental pulp cells, neutrophils and mac-

rophages play important roles in the initiation of

innate immune responses (Hahn & Liewehr 2007).

Detection of invading bacteria occurs through pattern

recognition receptors (PRRs). The major PRRs include

Toll-like receptors (TLRs), which comprise a family of

closely related proteins (Akira et al. 2001). TLRs are

integral membrane glycoproteins containing an extra-

cellular domain with leucine-rich repeats (LRRs),

responsible for ligand recognition and a cytoplas-

mic toll/IL-1R homology (TIR) domain required for

intracellular signalling. TLRs recognize pathogen-

associated molecular patterns (PAMPs) of which

TLR2 and 4, respectively, are ligands for PAMPs such

as peptidoglycan and lipopolysaccharide. Other PRRs

include nucleotide-binding oligomerization domain-1

(NOD-1) and domain-2 (NOD-2) (Akira & Takeda

2004). These agents are cytosolic sensors for peptido-

glycan (Chamaillard et al. 2003). NOD-1 recognizes

gamma-D-glutamyl-meso-DAP, which is typically

found in Gram-positive bacteria, whilst NOD-2 recog-

nizes muramyl dipeptide (MDP) found in the peptido-

glycan of virtually all bacteria (Girardin et al. 2003).

Central to the response of TLRs and NOD-like recep-

tors (NLRs) is the downstream activation of nuclear

factor kappa B (NFKB) signalling. This is the main

transcription factor regulating the expression of pro-

inflammatory cytokines. The mitogen-activated protein

kinase (MAPK) signalling pathway also plays impor-

tant roles in this regulation (Lee & Kim 2007). Collec-

tively, activation of signalling pathways lead to the

production of inflammatory mediators such as tumour

necrosis factor alpha (TNFa), interleukin-1b (IL-1b),interleukin-6 (IL-6) and interleukin-8 (IL-8), all of

which play important roles in the control of invading

bacteria. In infected and inflamed pulps, as well as in

early lesions of apical periodontitis, high levels of these

pro-inflammatory cytokines have been reported (Kawa-

shima & Stashenko 1999, Hahn & Liewehr 2007).

Fusobacterium nucleatum is one of the few bacterial

species associated with root canal infections which

have demonstrated a capacity to invade living cells.

In fact, this organism has been shown to adhere to

and invade both oral epithelial and endothelial cells

(Fardini et al. 2011). It has also been observed that

F. nucleatum elicits strong inflammatory responses

compared with other oral pathogens (Han et al.

2000, Milward et al. 2007). Given its frequent associ-

ation with aggressive forms of apical periodontitis, it

was hypothesized that this organism’s unique ability

to invade host tissue cells may lead to inflammatory

responses through the activation of intracellular

PRRs. Activation of TLRs is considered the major sig-

nalling pathway responsible for immune responses

during pulpal and periapical infections; however,

cytokine production via TLR-independent mechanisms

may also modulate immune responses and thus con-

tribute to disease pathogenesis. However, the roles of

TLR-independent signalling in endodontic infections

have not been well studied. In this study, the

HEK293T cells that lack endogenous TLRs expression

were used as the cell model to study TLR-independent

host response elicited by F. nucleatum. Results

obtained from this study will contribute to the under-

standing of inflammatory response caused by invasive

bacteria during root canal infection.

Materials and methods

Cell culture

HEK293T cells were obtained from the American

Type Culture Collection (Manassas, VA, USA). The

cells were grown in DMEM (Hyclone, Logan, UT,

USA) supplemented with 10% heat-inactivated FBS

(Hyclone), 2 mmol L�1 L-glutamine (Gibco, Carlsbad,

CA, USA) and 19 penicillin/streptomycin (Gibco) in a

humidified atmosphere with 5% CO2 at 37 °C.

Reagents

The synthetic triacylated lipopeptide Pam3CSK4 (PAM),

ultra pure LPS (UP-LPS) isolated from E. coli K12 and

c-D-Glu-mDAP (iE-DAP) were purchased from Invivo-

gen (San Diego, CA, USA). Signalling pathway inhibi-

tors SB203580, BAY11-7082 and ML130 were

obtained from Cayman Biochem (Ann Arbor, MI,

Bacterial culture

Fusobacterium nucleatum ATCC 25586 and Prevotella

intermedia ATCC 25611 from the American Type

Culture Collection were grown in brain heart infu-

sion (BHI) broth (Acumedia, Lansing, MI, USA) sup-

plemented with yeast extract (Acumedia), hemin

(Sigma-Aldrich, St Louis, MO, USA) and vitamin K

(Sigma-Aldrich). Incubations were carried out in an

anaerobic chamber (DG250; Don Whitley Scientific,

Frederick, MD, USA) supplemented with 80% N2,

10% H2 and 10% CO2.

TLR-independent induction of cytokine by F. nucleatum Quah et al.

Bacterial infection

HEK293T cells originally derived from human embry-

onic kidney cells were infected with 24-h cultures of

F. nucleatum or P. intermedia at multiplicity of infec-

tion (MOI) of 50 : 1 for 8 h, which refers to the ratio

of bacteria to cell. Infection media consisted of DMEM

supplemented with 1% FBS without penicillin/strepto-

mycin. Infected cells were centrifuged at 200 9 g for

5 min to allow bacteria to cell contact.

Bacterial viability assay

Overnight cultures of F. nucleatum or P. intermedia at

1 9 106 colony-forming units were pelleted and

resuspended in 1 mL infection media in a 24-well tis-

sue culture plate and incubated at 37 °C in a humidi-

fied incubator supplemented with 5% CO2. Viability of

F. nucleatum and P. gingivalis at 4- and 8-h incuba-

tion under aerobic conditions was determined by

serial dilution and plating on BHI agar supplemented

with yeast extract, hemin and vitamin K. Bacterial

agar plates were incubated anaerobically as described

above for 3–5 days, and the number of bacterial colo-

nies were enumerated.

Invasion assay

HEK293T cells (0.5 9 105 cells) were infected with

F. nucleatum at MOI 50 : 1 in infection media with or

without cytochalasin D (Sigma-Aldrich) (2 lg mL�1)

treatment for 1 h prior to infection. Two hours post-

infection, the cells were washed twice with sterile

1 9 PBS (Bio-Rad, Hercules, CA, USA), and fresh

DMEM supplemented with 1% FBS, gentamicin

(300 lg mL�1) (Sigma-Aldrich) and metronidazole

(250 lg mL�1) (Sigma-Aldrich) was added for an

additional hour to kill extracellular bacteria. Follow-

ing antibiotics treatment, an aliquot of the media was

plated and incubated as described above to determine

the efficacy of the antibiotics to kill extracellular bac-

teria. Cells were lysed with 0.1% Triton X-100

(Sigma-Aldrich), and the number of intracellular bac-

teria were determined by serial dilution and plating

as described above.

Detection of IL-8

The amount of IL-8 protein in the culture superna-

tant was quantified by the enzyme-linked immunosor-

bent assay (ELISA), Biolegend (San Diego, CA, USA).

ELISA was performed according to the manufacturer’s

instructions.

RNA extraction and RT-PCR

Nucleotide-binding oligomerization domain-1 expres-

sion and NOD-2 mRNA expression were determined

by RT polymerase chain reaction (PCR). Total RNAs

were isolated using the RNeasy Mini Kit (Qiagen,

Valencia, CA, USA) with on-column DNaseI treatment

to remove any contaminating DNA present in the

RNA samples. Reverse transcription (RT) was per-

formed using GoScript Reverse Transcription System

(Promega, Madison, WI, USA) according to the man-

ufacturer’s protocol. Briefly, each reverse transcription

reaction mixture consisted of 500 ng DNase I-treated

RNA, 500 ng oligo-dT15, 2 mmol L�1 dNTPs, 19

reaction buffer, 2 mmol L�1 MgCl2, 20 units of RNa-

sin and 1 lL GoScript Reverse Transcriptase. An ini-

tial annealing step was carried out at 25 °C for

5 min, followed by complementary DNA (cDNA) syn-

thesis at 42 °C for 1 h. Inactivation of the reverse

transcriptase was performed by heating at 70 °C for

15 min. The thermal cycling protocol used was an

initial denaturation at 94 °C for 3 min and denatur-

ation at 94 °C for 30 s, annealing at 56 °C for 30 s

and extension at 72 °C for 50 s. PCR was carried out

for 30 cycles in a iCycler (Bio-Rad). The primers used

were NOD-1 (forward 5′-TGACAAGGTCCGCAAAAT-

TCT and reverse 5′-ACAGCACGAACTTGGAGTCAC),

NOD-2 (forward 5′TGGTTCAGCCTCTCACGATGA

and reverse 5′-CAGGACACTCTCGAAGCCTT). The

expression of housekeeping gene glyceraldehyde-3-

phosphate dehydrogenase (GAPDH) was used as the

loading control. Primers used for GAPDH were for-

ward 5′-TGTTGCCATCAATGACCCCTT and reverse

5′-CTCCACGACGTACTCAGCG. PCR products were

visualized on a 1.5% agarose gel (Bio-Rad) stained

with GelRed (Biotium, Hayward, CA, USA) and visu-

alized using a GelDoc systems (Bio-Rad).

Plasmids, transfection and reporter assays

Reporter assay was carried out to determine changes

in cellular NFjB activity. The pNFjB-SEAP reporter

vector (Clontech, Palo Alto, CA, USA) was used as the

reporter. This vector possesses jB sites fused to

secreted alkaline phosphatase (SEAP). Upon activation

of cellular NFjB pathway, NFjB will bind to the

jB sites and activate the expression of SEAP. The

amount of SEAP, which was secreted into the culture

Quah et al. TLR-independent induction of cytokine by F. nucleatum

supernatant, is a quantitative measure of cellular

NFjB activation triggered by either bacterial infection

or agonist treatment. Plasmids expressing TLR2 or 4,

and myeloid differentiation primary response gene 88

(MyD88) dominant negative were gifts from Dr Y.H.

Gan (National University of Singapore). HEK 293T

cells were transfected with pNFjB-SEAP using Fugene

HD (Promega). Control plasmid pcDNA3.1 was pur-

chased from Life Technologies (Carlsbad, CA, USA).

Transfection was carried out in a 24-well tissue cul-

ture plate according to the manufacturer’s instruc-

tions. Where applicable, the amount of plasmid DNA

per well was adjusted using the empty vector

pcDNA3.1 such that all cells were transfected with the

same amount of plasmid DNA. Cell stimulation experi-

ments were performed 24 h after transfection. The

culture medium was changed to remove the accumu-

lated SEAP prior to treatment of cells with bacteria,

agonists or chemical inhibitors. The cells were infected

with F. nucleatum or P. intermedia at a MOI of 50 : 1

for 4 h after which the culture medium was collected

and subjected to the SEAP activity assay. The SEAP

activity in the culture medium was measured with a

Phospha-Light assay kit (Life Technologies), according

to the instructions of the manufacturer.

Western blot

Western blotting was carried out to determine the

phosphorylation status of signalling proteins. Cells

were lysed in M-PER buffer (Pierce, Rockford, IL,

USA) supplemented with 19 protease inhibitor cock-

tail (Pierce) and 19 phosphatase inhibitor cocktail

(Pierce). Proteins were resolved on 10% SDS-PAGE

gels and transferred to nitrocellulose membranes (Bio-

Rad). Membranes were blocked with 5% nonfat milk

(Bio-Rad) at room temperature for 1 h and probed

with the specific antibodies overnight. All antibodies

were obtained from Cell Signalling Technologies (Dan-

vers, CA, USA). Blots were developed using Western C

reagent (Bio-Rad) and developed on an X-ray film

(Pierce).

Statistical analysis

Each experiment was carried out in triplicate. Statisti-

cal significance was determined by performing Stu-

dent’s t-test using GraphPad Prism software 4.0 (San

Diego, CA, USA). Differences were considered signifi-

cant with P < 0.05.

Results

F. nucleatum but not P. intermedia induced IL-8

production independent of TLR signalling

HEK293T cells that lack endogenous TLRs were used

as the cell model to study bacterial-induced cytokine

production (Hornung et al. 2002). Infection of

HEK293T cells with F. nucleatum resulted in IL-8

secretion. In contrast, infection of cells with P. inter-

media did not stimulate IL-8 secretion (Fig. 1a). To

confirm that HEK293T cells lack endogenous TLRs,

cells transfected with NFKB-SEAP reporter were trea-

ted with either TLR2 or 4 agonists. As expected, NFKB

activation was not observed in these cells (Fig. 1b). In

contrast, when HEK293T cells were transfected with

either TLR2 or 4 expressing plasmids, robust activa-

tion of cellular NFKB was observed following treat-

ment with the respective TLR agonists (Fig. 1b). TLRs

initiate intracellular signalling pathways by recruiting

adaptor molecules. MyD88 is a TIR domain contain-

ing adaptor required for the initiation of signalling by

all TLRs except TLR3. This adaptor molecule associ-

ates directly with TLRs through its C-terminal toll

homology domain (Akira & Takeda 2004). To deter-

mine whether F. nucleatum induced IL-8 in a MyD88-

dependent or MyD88-independent manner, a plasmid

over-expressing a MyD88 dominant negative

(MyD88DN) protein was transfected into HEK293T

cells. MyD88DN consists of the C-terminal domain of

MyD88, and when over-expressed on its own, it acts

as a dominant negative inhibitor of TLR signalling.

F. nucleatum-induced IL-8 secretion was not affected

in the absence of MyD88 signalling (Fig. 1c). This is

in contrast to TLR2-dependent NFKB activation,

which was completely abolished in cells over-express-

ing MyD88DN (Fig. 1d).

To rule out the possibility that the results observed

were due to differences in the viability of F. nucleatum

and P. intermedia during the infection period, viability

of the bacteria was determined under cell infection

conditions. As expected, viability of both bacterial spe-

cies decreased significantly as their exposure time to

oxygen increased (Fig. 1e). However, the viability of

F. nucleatum and P. intermedia during the experimen-

tal conditions used was comparable. In fact, signifi-

cantly more viable P. intermedia were observed at the

4-h time-point. Therefore, the lack of IL-8 production

in P. intermedia infected cells is not due to insufficient

survival of viable bacteria.

Bacterial invasion is required for IL-8 production

To determine whether F. nucleatum was able to

invade HEK293T cells, the amount of intracellular

F. nucleatum present in the cells after infection was

enumerated. From an initial inoculum size of

~2.50 9 107 cfu mL�1, approximately (1.00 � 0.52)

9 105 cfu mL�1 (0.4%) of the initial bacterial inocu-

lum had invaded the cells during a 2-h infection per-

iod. In contrast, no intracellular P. intermedia were

detected, indicating that this bacterial species was

noninvasive (data not shown). To establish whether

bacterial invasion is a prerequisite for IL-8 produc-

tion, HEK293T cells were treated with cytochalasin

(a) (b)

Figure 1 (a) IL-8 production in HEK293T cells infected with either F. nucleatum or P. intermedia. HEK293T cells were infected

with either F. nucleatum or P. intermedia after which the culture supernatant was subjected to IL-8 ELISA analysis. (b)

HEK293T cells were co-transfected with NFKB-SEAP reporter and TLR2, TLR4 or pCDNA3.1 plasmids after which cellular

NFKB activity was determined by SEAP assay. (c) MYD88 is not required for IL-8 response to F. nucleatum infection. HEK293T

cells were transfected with MYD88DN over-expressing plasmid or pCDNA3.1 empty vector. The cells were infected with

F. nucleatum after which the amount of IL-8 produced was determined by ELISA. (d) MYD88DN is able to block TRL2 NF-jBresponse to agonist PAM3CSK. HEK293T cells were co-transfected with NFjB-SEAP reporter, TLR2 and either MYD88DN or

PCDNA3.1 control vector. Cellular NFKB activity was determined by measuring SEAP assay. (e) Viability of F. nucleatum and

P. intermedia under infection condition. Cultures of F. nucleatum or P. intermedia were incubated in a 37 °C, 5% CO2 atmo-

sphere for 4 or 8 h. The amount of viable bacteria was determined by plating. ***P < 0.001.

D, an inhibitor of actin polymerization prior to

bacterial infection. Cytochalasin D treatment sig-

nificantly reduced the number of intracellular

bacteria, approximately 116.67 � 98.52 cfu mL�1

compared with (1.71 � 0.78) 9 105 cfu mL�1 with

DMSO vehicle control treatment. The lack of bacterial

entry into cells completely blocked IL-8 production

(Fig. 2).

F. nucleatum-mediated IL-8 production occurs

through the p38, but not the NFKB signalling

pathway

The NFKB and MAPK are the major signalling path-

ways responsible for IL-8 production. It was observed

that F. nucleatum-induced IL-8 secretion was com-

pletely blocked in the presence of p38 (SB203580),

but not NFKB (BAY-11-7082) inhibitors (Fig. 3a).

Although BAY-11-7082 did not inhibit IL-8 secretion,

this inhibitor potently blocked bacterial-induced NFKB

activation in the same experimental set-up (Fig. 3b).

Furthermore, F. nucleatum infection induced phos-

phorylation of p38 MAPK in HEK293T cells (Fig. 3c).

p38 MAPK phosphorylation was found to peak at

15–30 min following stimulation. In contrast, infection

Figure 2 Effect of cytochalasin D on F. nucleatum-induced IL-8

secretion. HEK293T cells were pretreated with cytochalasin D

or DMSO (vehicle control) prior to infection with F. nucleatum.

F. nuleatum-induced IL-8 production was determined by ELISA.

Figure 3 (a) IL-8 production in response to F. nucleatum occurs through p38 MAPK, but not the NFKB signalling pathway.

HEK293T cells were transfected with NFKB-SEAP. Cells were treated with DMSO control, BAY-11-7082 (10 lmol L�1) or SB

203580 (10 lmol L�1) for 1 h after which the cells were infected with F. nucleatum. The amount of IL-8 produced was determined

by ELISA.***P < 0.001. (b) Effect of BAY-11-7082 on F. nucleatum-induced NFKB activity. HEK293T cells were treated with BAY-

11-7082 (10 lmol L�1) for 1 h after which the cells were infected with F. nucleatum. Cellular NFKB activity was determined by

SEAP assay.***P < 0.001. (c) p38 MAPK is activated by F. nucleatum infection. Cell lysates were harvested at 15, 30, 45 and

60 min after infection, and Western blot for phosphorylated p38 was performed. Alpha-tubulin served as the loading control.

of HEK293T cells with P. intermedia did not induce

p38 phosphorylation (data not shown).

Effect of NOD-1 receptor on F. nucleatum-induced

IL-8 production

The expression of NOD-1 and NOD-2 mRNA in

HEK293T cells was examined by RT-PCR. NOD-1

transcripts were abundantly expressed in HEK293T

cells (Fig. 4a, lanes 3-4), with little change in the

amount of NOD-1 transcripts following F. nucleatum

infection. However, these cells lacked NOD-2 expres-

sion (Fig. 4a, lanes 5-6). To determine whether

NOD-1 signalling is involved in F. nucleatum-induced

production of IL-8, HEK293T cells were treated with

NOD-1 inhibitor (ML130) prior to infection with

F. nucleatum infection or stimulation with NOD-1 ago-

nist. HEK293T cells did not produce IL-8 in response

to stimulation by NOD-1 agonist. In contrast,

F. nucleatum infection resulted in a robust production

of IL-8. This response was unaffected by ML130

(Fig. 4b). To confirm that ML130 was effective in

inhibiting NOD-1 activation, the NFKB activity was

examined. As expected, iE-DAP-induced NFKB activity

was completely blocked by ML130 (Fig. 4c). Taken

together, the results showed that F. nucleatum-medi-

ated IL-8 production occurred in a NOD-1-indepen-

dent manner.

Discussion

Recent evidence suggests that dental pulp cells play

important roles in innate immune responses against

microorganisms invading the dentine. These cells

express TLR1-6 and 9, endowing them the ability to

sense various PAMPs including lipopeptides, lipotei-

choic acid lipopolysaccharide, double-stranded RNA of

viruses, flagellin and bacterial DNA (Farges et al.

2009). Furthermore, odontoblasts have been shown

to express the cytosolic PRRs, NOD-1 and NOD-2,

which are important for sensing bacterial cell wall

components (Hirao et al. 2009, Keller et al. 2011). In

fact, NOD-1 expression was increased in inflamed

pulp, suggesting a role in host tissue defence during

pulpal infections (Lee et al. 2011). A recent study

showed that although F. nucleatum activated NFjB in

a TLR2- and TLR4-dependent manner, the activation

of these receptors was not required for IL-8 production

(b) (c)

Figure 4 (a) Expressions of NOD-1 and NOD-2 transcripts in HEK293T cells. Total RNAs from control (lanes 1, 3 and 5) or

F. nucleatum-infected cells (lanes 2, 4 and 6) were extracted from HEK293T cells and reversed-transcribed into cDNA for PCR

with primers targeting GAPDH (lanes 1-2), NOD-1 (lanes 3-4) or NOD-2 (lanes 5-6). Lane M is the 100 bp DNA ladder (Pro-

mega). (b) F. nucleatum-induced IL-8 production is NOD-1 independent. HEK293T cells were treated with the NOD-1 inhibitor

(ML130, 10 lmol L�1) prior to infection with F. nucleatum. The amount of IL-8 produced was quantified by ELISA. (c) NOD-1

signalling contributes to NFKB activity in HEK293T cells. HEK293T cells transiently expressing NFKB-SEAP reporter were trea-

ted with ML130 (10 lmol L�1) for 1 h before exposure to iE-DAP (10 lg mL�1). Cellular NFKB activity was determined via

SEAP assay. ***P < 0.001 compared with the untreated.

(Zhang et al. 2011). As F. nucleatum is able to invade

cells (Han et al. 2000), it was hypothesized that cur-

rently known or novel intracellular PRRs may be

important in sensing and initiation of immune

response against this organism. In this study, the

HEK293T cell model was used to dissect the cellular

signalling pathways responsible for F. nucleatum-medi-

ated IL-8 production. The lack of endogenous TLRs in

the HEK293T cells allowed the discrimination of cyto-

kine responses that are independent of TLRs

(Hornung et al. 2002).

The results of the present study demonstrate that

HEK293T cells infected with F. nucleatum but not

with P. intermedia produced IL-8 secretion. To further

confirm that F. nucleatum-induced IL-8 secretion

occurred in a TLR-independent manner, HEK293T

cells were transfected with MyD88-dominant-nega-

tive-expressing plasmid. MyD88 is the main cytoplas-

mic adapter protein that mediates signalling from all

TLRs except TLR3 (Akira et al. 2001). MyD88 associ-

ates with the TLRs through its C-terminal toll homol-

ogy domain. When the C-terminal domain of MyD88

is expressed alone in cells, it functions as an inhibitor

of TLRs by preventing downstream signalling media-

tors from associating with the protein molecule

(Dupraz et al. 2000). In contrast to F. nucleatum,

P. intermedia failed to induce IL-8 production in the

absence of TLRs. Thus, induction of cytokine secretion

in the absence of TLRs is not a universal phenome-

non in response to bacterial infection but is an occur-

rence that seems specific to F. nucleatum infection.

The observation that F. nucleatum was able to

invade the HEK293T is in itself not new. In fact, pre-

vious studies have demonstrated that F. nucleatum

possesses the ability to invade both epithelial and

endothelial cells (Han et al. 2000, Ikegami et al.

2009). Bacterial invasion occurred via a zipping

mechanism requiring host cell actin, microtubules

and bacterial protein synthesis. Yet, the finding of a

TLR-independent induction of IL-8 secretion is novel

and interesting. Blocking bacterial invasion using

cytochalasin D, an actin polymerization inhibitor,

completely abolished F. nucleatum-induced IL-8 pro-

duction. Therefore, failure of P. intermedia to induce

IL-8 production is likely to be due to its inability to

invade cells. The data presented are consistent with a

previous study reporting P. intermedia to be only

weakly invasive, if at all (Han et al. 2000).

It has been reported that F. nucleatem upregulates

IL-8 mRNA mainly through the activation of the

NFKB pathway (Huang et al. 2004, Zhang et al.

2011). The findings rather point to MAPK signalling

as the key pathway, as the p38 MAPK inhibitor

(SB203580) completely abolished F. nucleatum-

induced IL-8 secretion, whilst the NFKB inhibitor

(BAY-11-7082) had no effect.

Previous studies have shown F. nucleatum to elicit

strong inflammatory responses in comparison with

other oral bacteria (Han et al. 2000, Milward et al.

2007). However, the mechanisms behind these obser-

vations are not well understood. It is proposed that

the strong inflammatory response induced by F. nu-

cleatum could be due to its ability to stimulate both

TLRs and intracellular host receptors. In this study,

the HEK293T cells expressed only NOD-1 but not

NOD-2. NOD-1 is important for IL-8 induction of

intracellular bacterial pathogens such as Listeria mon-

ocytogenes (Opitz et al. 2006). The requirement for

both NOD-1 and NOD-2 in F. nucleatum-induced IL-8

production was not evident. It can be postulated that

F. nucleatum activates the p38 signalling pathway to

produce IL-8 through the activation of other cytosolic

Interleukin-8 is a strong chemoattractant and acti-

vator of neutrophils (Baggiolini et al. 1989). There-

fore, the presence of intracellular PRRs that are able

to sense F. nucleatum may serve as an additional

immune defence mechanism to activate a robust

immune response to combat the infection. High levels

of IL-8 can serve as a continuous stimulus to attract

polymorphonuclear cells to the site of infection, where

these immune cells are required to control the out-

growth of infectious agents (Nair 1987).

The high inflammatory response induced by

F. nucleatum is consistent with clinical studies that

show F. nucleatum to be highly prevalent during

stages of inflammation associated with root canal

infections (Matsuo et al. 2003, Jacinto et al. 2008,

Roc�as et al. 2010). The highly immuno-stimulatory

nature of this bacterial species may be a reason as to

why F. nucleatum is predominantly found in severe

root canal infections and in symptomatic cases (Sas-

sone et al. 2008). The presented data support a cen-

tral role for F. nucleatum in disease pathogenesis.

Conclusions

The present study provides evidence that F. nucleatum

is able to induce cytokine production independent of

TLRs. Hence, a pathogen’s ability to activate different

host PRRs is likely to impact the outcome of immune

responses in both pulpal and root canal infections.

Acknowledgement

This study is supported by a grant from the Ministry

of Education Singapore (R222-000-042-133). The

authors deny any conflict of interests.

References

Akira S, Takeda K (2004) Toll-like receptor signalling. Nat-

ure Reviews Immunology 4, 499–511.

Akira S, Takeda K, Kaisho T (2001) Toll-like receptors: criti-

cal proteins linking innate and acquired immunity. Nature

Immunology 2, 675–80.

Baggiolini M, Walz A, Kunkel SL (1989) Neutrophil-activat-

ing peptide-1/interleukin 8, a novel cytokine that activates

neutrophils. Journal of Clinical Investigation 84, 1045–9.

Chamaillard M, Girardin SE, Viala J, Philpott DJ (2003)

Nods, Nalps and Naip: intracellular regulators of bacterial-

induced inflammation. Cellular Microbiology 5, 581–92.

Chavez de Paz Villanueva LE (2002) Fusobacterium nucleatum

in endodontic flare-ups. Oral Surgery, Oral Medicine, Oral

Pathology, Oral Radiology, and Endodontics 93, 179–83.

Cheung WY, Bellas J (2007) Fusobacterium: elusive cause of

life-threatening septic thromboembolism. Canadian Family

Physician 53, 1451–3.

Dupraz P, Cottet S, Hamburger F, Dolci W, Felley-Bosco E,

Thorens B (2000) Dominant negative MyD88 proteins inhi-

bit interleukin-1beta/interferon-gamma-mediated induction

of nuclear factor kappa B-dependent nitrite production and

apoptosis in beta cells. Journal of Biological Chemistry 275,

37672–8.

Fardini Y, Wang X, Temoin S et al. (2011) Fusobacterium nu-

cleatum adhesin FadA binds vascular endothelial cadherin

and alters endothelial integrity. Molecular Microbiology 82,

1468–80.

Farges JC, Keller JF, Carrouel F et al. (2009) Odontoblasts in

the dental pulp immune response. Journal of Experimental

Zoology Part B, Molecular and Developmental Evolution

312B, 425–36.

Girardin SE, Boneca IG, Viala J et al. (2003) Nod2 is a gen-

eral sensor of peptidoglycan through muramyl dipeptide

(MDP) detection. Journal of Biological Chemistry 278,

8869–72.

Hahn CL, Liewehr FR (2007) Innate immune responses of

the dental pulp to caries. Journal of Endodontics 33, 643–

Han YW, Shi W, Huang GT et al. (2000) Interactions

between periodontal bacteria and human oral epithelial

cells: Fusobacterium nucleatum adheres to and invades epi-

thelial cells. Infection and Immunity 68, 3140–6.

Hirao K, Yumoto H, Takahashi K, Mukai K, Nakanishi T,

Matsuo T (2009) Roles of TLR2, TLR4, NOD2, and

NOD1 in pulp fibroblasts. Journal of Dental Research 88,

762–7.

Hornung V, Rothenfusser S, Britsch S et al. (2002) Quantita-

tive expression of toll-like receptor 1-10 mRNA in cellular

subsets of human peripheral blood mononuclear cells and

sensitivity to CpG oligodeoxynucleotides. Journal of Immu-

nology 168, 4531–7.

Huang GT, Zhang HB, Dang HN, Haake SK (2004) Differen-

tial regulation of cytokine genes in gingival epithelial cells

challenged by Fusobacterium nucleatum and Porphyromonas

gingivalis. Microbial Pathogenesis 37, 303–12.

Ikegami A, Chung P, Han YW (2009) Complementation of

the fadA mutation in Fusobacterium nucleatum demon-

strates that the surface-exposed adhesin promotes cellular

invasion and placental colonization. Infection and Immunity

77, 3075–9.

Jacinto RC, Montagner F, Signoretti FG, Almeida GC, Gomes

BP (2008) Frequency, microbial interactions, and antimi-

crobial susceptibility of Fusobacterium nucleatum and Fuso-

bacterium necrophorum isolated from primary endodontic

infections. Journal of Endodontics 34, 1451–6.

Kai A, Cooke F, Antoun N, Siddharthan C, Sule O (2008) A

rare presentation of ventriculitis and brain abscess caused

by Fusobacterium nucleatum. Journal of Medical Microbiology

57, 668–71.

Kawashima N, Stashenko P (1999) Expression of bone-

resorptive and regulatory cytokines in murine periapical

inflammation. Archives of Oral Biology 44, 55–66.

Keller JF, Carrouel F, Staquet MJ et al. (2011) Expression of

NOD2 is increased in inflamed human dental pulps and

lipoteichoic acid-stimulated odontoblast-like cells. Innate

Immunity 17, 29–34.

Kolenbrander PE, Andersen RN, Blehert DS, Egland PG, Fos-

ter JS, Palmer RJ Jr (2002) Communication among oral

bacteria. Microbiology Molecular Biology Reviews 66,

486–505.

Lee MS, Kim YJ (2007) Signaling pathways downstream of

pattern-recognition receptors and their cross talk. Annual

Review of Biochemistry 76, 447–80.

Lee YY, Chan CH, Hung SL, Chen YC, Lee YH, Yang SF

(2011) Up-regulation of nucleotide-binding oligomerization

domain 1 in inflamed human dental pulp. Journal of End-

odontics 37, 1370–5.

Matsuo T, Shirakami T, Ozaki K, Nakanishi T, Yumoto H,

Ebisu S (2003) An immunohistological study of the locali-

zation of bacteria invading root pulpal walls of teeth with

periapical lesions. Journal of Endodontics 29, 194–200.

Milward MR, Chapple IL, Wright HJ, Millard JL, Matthews

JB, Cooper PR (2007) Differential activation of NF-kappaB

and gene expression in oral epithelial cells by periodontal

pathogens. Clinical & Experimental Immunology 148,

307–24.

Nair PNR (1987) Light and electron microscopic studies of

root canal flora and periapical lesions. Journal of Endodon-

tics 13, 29–39.

Opitz B, Puschel A, Beermann W et al. (2006) Listeria mono-

cytogenes activated p38 MAPK and induced IL-8 secretion

in a nucleotide-binding oligomerization domain 1-depen-

dent manner in endothelial cells. Journal of Immunology

176, 484–90.

Roc�as IN, Siqueira JF Jr (2012) Characterization of microbi-

ota of root canal-treated teeth with posttreatment disease.

Journal of Clinical Microbiology 50, 1721–4.

Roc�as IN, Alves FR, Santos AL, Rosado AS, Siqueira JF Jr

(2010) Apical root canal microbiota as determined by

reverse-capture checkerboard analysis of cryogenically

ground root samples from teeth with apical periodontitis.

Journal of Endodontics 36, 1617–21.

Sassone LM, Fidel RA, Faveri M et al. (2008) A microbiologi-

cal profile of symptomatic teeth with primary endodontic

infections. Journal of Endodontics 34, 541–5.

Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RL Jr

(1998) Microbial complexes in subgingival plaque. Journal

of Clinical Periodontology 25, 134–44.

Zhang G, Chen R, Rudney JD (2011) Streptococcus crista-

tus modulates the Fusobacterium nucleatum-induced

epithelial interleukin-8 response through the nuclear

factor-kappa B pathway. Journal of Periodontal Research

46, 558–67.

fusobacterium nucleatum induces cytokine production through toll-like-receptor-independent mechanism

Documents

the phantom toll booth

osthole inhibits expression of genes associated with toll...

toll-like receptors: expression and involvement in multiple...

anticipating innate immunity without a toll

georgia's reversible toll lanes and neology innovation its

raw sugar toll refining – a sensible policy?

e}volutionary relationships of {f}usobacterium nucleatum...

simulation of toll collection system in surabaya gempol...

gorakhpur hospital death toll rises to 63 - today's paper

toll-brothers-inc-2013.pdf - ct.gov

an aminopeptidase nutritionally important to fusobacterium...

juvenile diabetes: examining the personal toll on

genome sequence of fusobacterium nucleatum subspecies...

302 unatex road • eunice, la 70535 • toll free

genome analysis of f. nucleatum sub spp vincentii and its...

the role of toll like receptors in pregnancy

chapter 5. toll collection facility

credit analysis of china's toll road operators

avian toll-like receptors

teenager killed in kashmir, toll reaches 69 - glimpses of