biogeography and taxonomy of the indo-pacific reef cave dwelling coralline demosponge astrosclera...

in : K Moosa et al. (ed.): Proceedings of the 9th International Coral Reef Symposium, Bali, October 2000. Vol 1, pp 339-346.

Phylogeography and taxonomy of the Indo-Pacific reef cavedwelling coralline demosponge Astrosclera ‘willeyana’: newdata from nuclear internal transcribed spacer sequences

Wörheide, G.1,2; Degnan, B. M.2; Hooper, J.N.A.1; Reitner, J.3

1Queensland Centre for Biodiversity, Queensland Museum, P.O. Box 3300, South Brisbane, Qld 4101, Australia.E-mail: GertW@qm.qld.gov.au2Department of Zoology and Entomology, The University of Queensland, St. Lucia, Qld 4072, Australia3Abt. Geobiologie, Göttinger Zentrum Geowissenschaften, Goldschmidtstr. 3, 33077 Göttingen, Germany

Abstract Astrosclera ‘willeyana’ is a common ‘livingfossil’ coralline demosponge, living in cryptic areas ofIndo-Pacific coral reefs with an alleged widespreaddistribution from the Red Sea to Tahiti. Spiculemorphology (geometry, size, ornamentation) – the maintaxonomic character for sponge classification – is highlyvariable between regional populations supporting thehypothesis that there may be more than one species ofAstrosclera. An initial genetic (PCR-RFLP) survey of theinternal transcribed spacer (ITS) regions of rDNA ofseveral populations by Wörheide (1998, Facies 38: 1-88)did not detect any genetic differences that would supportspecies distinction based solely on phenotypic criteria.We have now sequenced the ITS regions of 12 specimensfrom the Red Sea, the Great Barrier Reef, Fiji, andVanuatu and found small, but consistent differences insequences from allopatric populations. These consistentmorphological and genetic differences betweenpopulations are now regarded as clear evidence for thepresence of at least two distinct cryptic species in additionto Astrosclera willeyana sensu stricto, originallydescribed from the Loyalty Islands. Our Fiji/Vanuatupopulation most likely represents Astrosclera willeyanas.s., the two new cryptic species are Astrosclera sp. 1(Red Sea), Astrosclera sp. 2 (GBR, Osprey Reef). Taxawill be formally described elsewhere.

Keywords Astrosclera, Coralline sponges, Indo-Pacific,Phylogeography, Taxonomy, Cryptic species, Internaltranscribed spacer, rDNA

Introduction

Most sponges living in Recent seas have a skeletoncomposed of collagen or spongin fibres, with or withoutan inorganic component of silica or calcium carbonate(spicules). Only about 15 species of Recent sponges areknown to build solid secondary calcareous skeletons ofaragonite or calcite, in addition to, or instead of theirprimary spicular skeletons (Vacelet 1985; Willenz andPomponi 1996). The secondary basal skeleton issuperficially similar to that of scleractinian corals, andthis group of sponges is called ‘coralline sponges’ or‘sclerosponges’. They appear to be living representatives

of several groups of sponges from the late Paleozoic andMesozoic, previously grouped together under the conceptof ‘Sclerospongiae’ (Hartman and Goreau 1970), which isnow demonstrated to be clearly polyphyletic (Chombardet al. 1997; Reitner 1992; Vacelet 1985; van Soest 1984). Sponges with a secondary basal skeleton had a majorfunctional role in past reef systems, being the main reefbuilding organisms (e.g. ‘Stromatoporoids’, ‘Chaetetids’,and ‘Sphinctozoans’) during long periods of the Earth’shistory (Vacelet 1985). They were only replaced byhermatypic corals in their reef building function since thelate Jurassic (Reitner 1992), but some of thoseultraconservative taxa are still dwelling in the cryptichabitats of Recent coral reefs. Here, they still play animportant functional role for the stabilization of theinternal reef framework in shallow water, due to theirrigid calcareous basal skeleton, especially if they occur inhigh densities (e.g. Saipan, Marianna Islands, 9-16m: 672individuals m-2, 65% cover; Quinn and Kojis 1999).Studying different aspects of these ‘living fossils’, notonly can we learn about the ecology, community structureand phylogeographic relationships of ‘relict faunas’, butalso about basic metazoan biomineralisation processes(Reitner et al. 2001). Astrosclera, in particular, is regarded as a living fossil(e.g. Reitner 1992; Vacelet 1985; Wood and Reitner1986; Wörheide 1998), with the taxon Astrosclera firstoccurring in the upper Triassic of Turkey (Astroscleracuifi Wörheide 1998). Astrosclera is thought to be aliving relative of the long extinct ‘Stromatoporoidea’(Reitner 1987; Stearn and Pickett 1994; Wood 1987), anenigmatic fossil group. The poriferan nature of moststromatoporoids is now, after a long deliberation, wellestablished. An excellent review of the history oftaxonomic interpretation was given by Wood (1987: 6),showing the poriferan affinities of late Mesozoicstromatoporoids. Furthermore, it was demonstrated thatthe possession of a secondary basal skeleton is notindicative of an evolutionary relationship, and thatconcepts of ‘stromatoporoid’, ‘chaetetid’ and‘sphinctozoan’ reflect a grade of construction and not aclade. Coralline sponges grow extremely slowly (RecentAstrosclera: 230µm/a, Wörheide 1998) and are generally

in : K Moosa (ed.): Proceedings of the 9th International Coral Reef Symposium, Bali, October 2000. (in press)

restricted to zones with reduced light intensity such ascaves, cryptic habitats, and deeper water, where they donot compete with light-dependent and much fastergrowing hermatypic corals. Coralline sponges werethought to be extinct until they were rediscovered in thePacific by Lister (1900) (Astrosclera willeyana) and in theCaribbean by Hickson (1911) (Ceratoporella nicholsoni). Astrosclera is the most common coralline sponge inIndo-Pacific coral reefs (Reitner et al. 1996). In shallowwater it is restricted to cryptic and light reducedenvironments such as reef caves. In certain caves, it is themain macro-benthic organism and contributessignificantly to the internal reef framework. Astrosclera‘willeyana’ has an alleged ‘circum Indo-Pacific’distribution, found from the northern Red Sea to Tahiti(Wörheide 1998). The primary spicular skeleton ofAstrosclera – the main character currently used todifferentiate sponge taxa - consists of megascleres.Microscleres are absent. The basic spicule type is a sub-verticillate to verticillate acanthostyle of the Agelas type,with a mean length of 80 µm. Spicule morphology andsize are highly variable, depending on the geographicorigin of the population. Several authors previouslyreported variability in spicule morphology of Astrosclerafrom different geographic localities (Ayling 1982; Vacelet1967, 1977, 1981; Wörheide et al. 1997), and Vacelet(1981) discussed the possibility that there may be morethan one species throughout its alleged wide distribution.Although Ayling (1982) refuted the existence of morethan one species, based on wide collections throughouttropical Australasia, Wörheide et al. (1997) came to theopposite conclusion based on a more comprehensiveinvestigation of several geographically distinctpopulations throughout the Indo-Pacific. Examination ofthe detailed spicule morphology of 26 regional Indo-Pacific populations then revealed consistent differencesbetween populations and demonstrated that variation wasnot random but specifically linked to the geographicorigin of the specimen (Wörheide 1998). Withinpopulations spicule morphology was homogenous, andspicules were the only morphological characterdifferentiating the populations. Six "groups with similarspicule morphology" (GSSM) were differentiated basedon similarities in their spicule morphology. This provideda preliminary biogeographic model of relationships ofpopulations throughout the Indo-Pacific (Wörheide 1998).However, an additional restriction fragment length(RFLP) analysis of the two internal transcribed spacer(ITS) regions, 5.8S and small flanking regions of the 18Sand 28S regions of the ribosomal DNA (rDNA), carriedout on 20 specimens from five geographically distinctareas (representing three of the six ‘GSSM’ groups) failedto detect any differences between groups (Wörheide1998). Consequently, Wörheide (1998) concluded thatthese morphologically different populations were mostlikely geographic sub-species. These data from RFLPanalysis contradict observations by other authors thatthere is a high level of genetic differentiation betweengeographically separated sponge populations (and evensympatric populations) based on allozyme variation

(Klautau et al. 1994; Klautau et al. 1999; Solé-Cava andBoury-Esnault 1999; Solé-Cava et al. 1991a; Solé-Cavaand Thorpe 1990). A high level of genetic differentiationmight be expected given the alleged short demersal larvalstage of sponges (Lindquist et al. 1997; Maldonado andYoung 1996; Uriz et al. 1998). For a reef cave dwellingtaxon like Astrosclera, with a distribution from the RedSea to Tahiti, it seems highly unlikely that gene flow andreproductive connectivity could effectively be sustainedover such a long distance. Although we do not knowanything yet about its larval dispersal capabilities, it hasnever yet been demonstrated that there exists a pelagiclarval stage with high dispersal capabilities amongstdemosponges. Only armoured propagules (putative sexuallarvae) have been shown to stay in the water column forlonger periods (Vacelet 1999). The ITS regions of rDNA are widely used at thepopulation and species level in a variety of organisms. Itutility is due to its high level of sequence variation (e.g.corals, see review by van Oppen et al. 2001;platyhelminth, Anderson and Barker 1993; Schulenburget al. 2000; clams, Caporale et al. 1997; crayfish, Harrisand Crandall 2000; plants, Buckler and Holtsford 1996;Koch et al. 1999; Leskinen and Alstrom 1999). Theeukaryotic rDNA typically consists of a large number oftandemly repeated copies of the transcription unit,encoding the 18S, 5.8S, and 28S genes, with the two ITSregions located between these genes and an intergenicspace between transcription units. Low intragenomicvariation in sequence between rDNA units is generally thenorm, due to concerted evolution. Individual repeats ofthe tandem array evolve together in a concerted fashion;i.e. mutations spread horizontally to all members of thegene family (see e.g. Li et al. 1985), so that new variantsare homogenized and fixed. Low levels of polymorphismwithin and between individuals in a population areobserved in most organisms strongly suggesting that rapidrates of homogenization are widespread, if not universal(Hillis and Davis 1988). However, high rDNA ITSvariability within individuals are observed in a few taxa:some corals (Odorico and Miller 1997; van Oppen et al.2000) and in the nematode genus Meloidogyne (Hugall etal. 1999). In both cases the high intraindividualpolymorphism is apparently due to hybridization and/orreticulate evolution. However, if intra-individualvariability of the ITS regions is low, as it appears to bethe case in Porifera (Wörheide et al., unpublished data),the ITS regions provide a useful tool for population andspecies level studies.

Aims of the present study

We have now sequenced the PCR products of the ITSregions of 12 of the previously investigated specimens(for which RFLPs were analysed) and report our findingshere. We provide new data from sequence analysis of theinternal transcribed spacers of rDNA to focus onreinterpreting phylogeographic and taxonomicrelationships of the living fossil Astrosclera ‘willeyana’.Furthermore, we provide evidence for cryptic speciation

in : K Moosa (ed.): Proceedings of the 9th International Coral Reef Symposium, Bali, October 2000. (in press)

in Astrosclera. A more detailed and comprehensivepresentation of molecular features of the rDNA ITSregions in Porifera will be presented elsewhere (Wörheideet al. in preparation).

Material and Methods

Sample preparations in the field, DNA extraction, and PCRamplification were performed as previously described(Wörheide 1998). PCR products from the Wörheide (1998)study were stored at -20ºC; these were sequenced three yearslater. These ~850bp PCR products were assessed on a 1.5%agarose gel (Sambrook et al. 1989) and were found to have hadnegligible degradation. DNA from these PCR amplificationswere then precipitated with ammonium acetate and ethanol asper Sambrook et al. (1989) and DNA redissolved in 18µl sterilewater. Twelve specimens of Astrosclera willeyana were sequenced:three from Dahab in the Gulf of Aqaba (Red Sea), two fromLizard Island (northern Great Barrier Reef), one from OspreyReef (Coral Sea), two from the Astrolabe Reef (Fiji), one fromWaya Island (Yasawa Group, Fiji), and three from EspirituSanto (Vanuatu). Sequences of three different haplotypes weredeposited in GenBank (http://www.ncbi.nlm.nih.gov/;Accession numbers: AF338348 [Red Sea], AF340017[Fiji/Vanuatu], AF340018 [Great Barrier Reef]). Samplenumbers in the alignment and figures correspond those inWörheide (1998). Cycle sequencing was performed using the ABI Big-DyeReady Reaction kit following the manufacturersrecommendations on a Perkin-Elmer 9700. Primer RA2(GTCCCTGCCCTTTGTACACA) and ITS2.2(CCTGGTTAGTTTCTTTTCCTCCGC) were used to sequenceboth DNA strands. Sequences were assembled using theprogram “Sequencher 3.0” (Gene Codes Corporation) andaligned with “BioEdit” (Hall 1999) using the ClustalWalgorithm with default options. The rDNA and spacerboundaries were determined by comparison with poriferansequences available in GenBank. Sequences were then importedinto Paup*4.0 (Swofford 1998) for phylogenetic analyses. Phylogenetic analyses were performed on the entire sequencebecause of the low number of informative sites in both ITS1 andITS2. To increase the number of informative sites, twoprominent indel events (see below), otherwise excluded fromcladistic analysis, have been recoded as separate(absent/present) characters (Simmons and Ochoterena 2000),replacing the longer indel sequences. A cladistic analysis usingmaximum parsimony (MP) as optimality criterion wasimplemented using the heuristic search method in PAUP*4.0(Swofford 1998) with the following parameters: all charactersunordered and of equal weight, starting tree via stepwiseaddition, simple sequence addition with reference taxon 1 andTBR branch swapping. Trees were then rooted using themidpoint rooting option. A second phylogenetic analysis withdistances (minimum evolution, mean character differences) asoptimality criterion and neighbor joining as algorithm wasperformed.

Results

Internal transcribed spacer PCR product sequences were811 – 825 bp in length, included the 3’ end of the 18SrRNA gene (141 bp), ITS1 (301-315 bp), the 5.8S rRNAgene (157 bp), ITS2 (175 bp), and the 5’ end of the 28SrRNA gene (37 bp).

Table 1 Alignment of variable sites of 12 sequences ofAstrosclera from Dahab, Red Sea (Red Sea 1-3); Lizard Island,GBR (Lizard 92, 93); Osprey Reef, Coral Sea (Osprey Reef114); the Astrolabe Reef, Fiji (FjAlabe 94, 95); Waya Island,Yasawa Group, Fiji (FjWaya 101); and Espiritu Santu, Vanuatu(Vanuatu 23, 03, 47) with site numbers on top of the firstsequence. A dot (.) corresponds to the same nucleotide as in thefirst sequence, a hyphen (-) represents a gap in the alignment.Indels are indicated by boxes, with recoded characters indicatedas 1 (indel present) and 0 (indel absent), replacing longer indelsequences in the maximum parsimony analysis.

Mean GC content of the whole sequence was 51.34%(ITS1: 50.9%; 5.8S: 52.9%; ITS2: 53.1%). The sequencealignments were highly conserved, with only 5 variable(single nucleotide) sites out of 837. No intra-individualvariation was observed. Three of the variable sites werelocated within ITS1, they all were transitions (positions158, 415, 428). The other two variable sites were locatedin the ITS2, one was a transition (site 732), the other onea transversion (site 757) (see Table 1). Overall, thetransition/transversion (ti/tv) ratio was 4. Furthermore,ITS1 was characterized by two indel events, the first onewas a (GTT)4 (microsatellite) repeat in the sequencesfrom the Red Sea (position 224-235) which was notpresent in the other sequences. The second one was asingle nucleotide repeat (T)14 in the sequences from Fijiand Vanuatu (positions 410-414), again not present in theother sequences. These two indels have been recoded as asingle present/absent character for maximum parsimonyanalysis (see Simmons and Ochoterena 2000). A lowvariation between specimens was observed, withuncorrected ‘p’ distances between 0 (samples from samelocation) and a maximum of 0.0062 (between specimensfrom the Red Sea/GBR group and the Fiji/Vanuatugroup). A single most parsimonious tree was found (Fig. 1),requiring seven evolutionary steps, with consistencyindex (CI) of 1.0. The neighbor joining tree, usingdistance as optimality criterion, yielded the same treetopology. The mid-point rooted MP tree clearly revealedtwo major clades with three haplotypes present amongstthe twelve specimens examined. One clade consisted ofall the specimens from Fiji and Vanuatu, possessing thesame single haplotype, which was characterized by fourapomorphies (character numbers from Table 1: 158, 415,428, indel at position 401-414).

in : K Moosa (ed.): Proceedings of the 9th International Coral Reef Symposium, Bali, October 2000. (in press)

Fig. 1 A phylogenetic tree of 12 Astrosclera ITS sequences.Sample numbers correspond to the ones given in Table 1.Optimality criterion was maximum parsimony, a single mostparsimonious tree was found with a consistency index of 1.0.Numbers of apomorphies are indicated on branches, thealignment with recoded indel events was used for analysis (seetext and Table 1 for details).

The second clade consisted of the specimens from theGreat Barrier Reef, the Osprey Reef and the Red Sea,with characters number 732 and 757 (Table 1) beingapomorphies. The Red Sea specimens formed a distinctsubclade with all three specimens having the samehaplotype, characterized by one apomorphy, the indel atposition 224-235 [(GTT)4 microsatellite insertion, Table1]. The specimens from the GBR and Osprey Reef alsopossessed a single haplotype that was a plesiomorph tothe Red Sea haplotype.

Discussion

Populations of the coralline demosponge Astrosclera‘willeyana’ occur throughout the Indo-Pacific from thenorthern Red Sea to Tahiti, and have been shown to eachpossess a highly variable spicule morphology – the onlyconsistent character that separates allopatric populations(Wörheide 1998). An initial genetic (RFLP) survey ofpopulations from the Red Sea, GBR, Fiji, and Vanuatu(Wörheide 1998), did not detect any genetic differencesthat would support species distinction solely based onphenotypic criteria. However, Wörheide (1998) proposeda faunistic model of dispersal pathways and supposed thatthe different populations may be in the process ofspeciation or they may represent sub-species, but for thepresent they should be regarded as a single species untiladditional data demonstrated otherwise. Our new data from analysis of the internal transcribedspacer sequences of 12 specimens investigated byWörheide (1998) now found small, but consistent,differences in sequences between allopatric populations.Although widely separated populations of Astrosclerafrom the Red Sea and Fiji (Fig. 2) only showed smallgenetic distance (0.6%, uncorrected p-distance), thesedata are consistent with reported variation in spicule

morphology (Wörheide 1998), supporting speciesdistinction under the phylogenetic species concept(Cracraft 1989, 1997). Furthermore, if regionalpopulations of Astrosclera were interbreeding, then itwould be expected that the ITS would be homogenizedwithin and between individuals between the variousgeographical sites. However, our ITS sequences show novariation within populations (due to concerted evolution),and homogenization of sequences has not happenedbetween (allopatric) sites, as evidenced by the small-but-consistent differences in our data. We regard this asevidence to support the presence of non-interbreedingpopulations of Astrosclera, the crucial criterion forspecies distinction under the biological species concept(Mayr and Ashlock 1991).

Fig. 2 Phylogeographic relationships of studied Astrosclera.Note the close relationship of the Red Sea and GBR, withapparent deep split between the GBR and Fiji/Vanuatu.

If populations are non-interbreeding, then we mightwant to ask what causes the loss of genetic connectionbetween populations and why have they only diverged solittle genetically? We only have few answers as yet, butsome hypotheses can be made based on our limitedknowledge of poriferan larval dispersal patterns and otherdata. Firstly, it seems unlikely that gene flow caneffectively be sustained between e.g. the Red Sea andTahiti given that Astrosclera is viviparous and has a(presumably short lived) parenchymella larva (Wörheide1998) with limited dispersal capabilities. The potential forrafting of fragments (Maldonado and Uriz 1999) is highlyunlikely due to the negative buoyancy of the rigidcalcareous skeleton, so present day distributions may haveevolved slowly through geological time (i.e. the taxonAstrosclera has been present at least since the Triassic,Wörheide 1998). Secondly, coralline sponges aregenerally regarded as being morphologicallyultraconservative (Reitner and Engeser 1987; Reitner andGautret 1996), so their little apparent morphological andgenetic divergence might be attributed to very low

in : K Moosa (ed.): Proceedings of the 9th International Coral Reef Symposium, Bali, October 2000. (in press)

mutation rates, and that their ‘bauplan’ is perfectlyadapted to their environment with no pressure to change. We interpret consistent morphological and geneticdifferences between populations as evidence for thepresence of at least two distinct cryptic species in additionto Astrosclera willeyana sensu stricto, which wasdescribed by Lister (1900) from Sandal Bay, Lifu,Loyalty Islands (north of New Caledonia). Our specimensfrom Fiji and Vanuatu most likely represent Astrosclerawilleyana s.s., as they are similar in spicule morphology(without spines) to the ones from New Caledonia(Wörheide 1998). The two new species (to be formallydescribed and named elsewhere; Wörheide and Hooper, inpreparation), are Astrosclera sp. 1 (Red Sea), Astrosclerasp. 2 (GBR, Osprey Reef). Other geographically disjunctpopulations showing distinct morphological features (e.g.Tahiti, Madagascar, Indonesia/Philippines; Wörheide1998) also most likely represent genetically distinctcryptic species, although we are presently unable toconfirm this hypothesis in the absence of genetic data. Itwill be most informative to compare phylogeneticrelationships between populations from south eastern Asia(e.g. Indonesia, Philippines) and clades identified in thisstudy. These Asian populations were hypothesized to bethe most ancient and basal populations of the speciescomplex based on their plesiomorph acanthostyle spiculemorphology (Wörheide 1998: Fig. 17). Presentphylogenetic data further support the supposition ofWörheide (1998: 81) that reduction in spines on theverticillate acanthostyles is an evolutionary trend inAstrosclera. This reduction is assumed to have developedtwice independently, found in the widely separatedpopulations from the Red Sea and Fiji/Vanuatu. Bothpopulations have smoother, style-like spicules althoughhaving different spicule length between populations. Bothpopulations are (although only slightly) geneticallydistinct, and both appear to be more phylogeneticallyderived than the more basal GBR population (Fig. 1),which has acanthostyle spicules. This supposition iscorroborated by a similar finding by Hooper (1996),comparing GBR and New Caledonian populations ofClathria hirsuta with the latter having poorer megasclerespination. The apparent close relationship between Red Sea andGBR populations, with resulting deep split between GBRand Fiji/Vanuatu (Fig. 2), should, at this stage, be treatedwith caution. These data might be an artifact of the smallsample size, but certainly the GBR and Red Seapopulations share more synapomorphies than do the GBRand Fiji/Vanuatu populations. However, in Astrosclera, asin some other coral reef organisms (Acanthaster plancii,Linckia levigata [starfish], Tridacna gigas [Giant clam]),as described by Benzie (1994; 1999), these geneticrelationships seem to represent ancient gene flow regimes,most likely determined by events that were controlled bydifferent current systems during sea level low stands. This‘Ghost of dispersal past’-concept (Benzie 1999) is furthersupported by results we recently obtained for the commoncalcarean sponge Leucetta ‘chagosensis’, where weinvestigated variation in ITS sequences from several

western Pacific populations (including GBR andVanuatu). We found that the GBR populations were moreclosely related to the one from Indonesia than to the onefrom Vanuatu (unpublished data). This apparentrelationship cannot be explained by present day gene flowbut must have been caused by past events. Our current discovery of cryptic speciation inAstrosclera further supports the notion of Klautau et al.(1999) that ‘cosmopolitanism’ in lower marineinvertebrates (including sponges), is most likely a resultof overconservative systematics. These alleged ‘widelydistributed species’ most likely consist of several crypticsibling species – often only recognizable by molecularmethods (e.g. Klautau et al. 1994; Solé-Cava et al. 1991a;Solé-Cava et al. 1991b). However, the present data alsoshows that RFLP’s of the ITS regions might be sensitiveenough to detect species differences in clearly separated(e.g. genetically far diverged) species of sponges (seeWörheide 1998: Pl. 22, Fig. 6) and Platyhelminthes(Anderson and Barker 1993) and to identify closelyrelated/cryptic species in insects (e.g. Beebe and Saul1995; Van Bortel et al. 2000), but PCR-RFLP of rDNAITS is not sensitive enough to detect subtle differences ingenetically less divergent species of Porifera such asAstrosclera, which can only be revealed by sequencing.

Acknowledgements GW acknowledges financial support forhis postdoctoral studies from the German Academic ExchangeService (DAAD), the Australian Biological Resources Study(ABRS), the Queensland Museum, and AstraZeneca R&DGriffith University (Brisbane) and would like to thank allmembers of the Molecular Zoology Lab. (UQ) for their support.We also acknowledge funding from the DeutscheForschungsgemeinschaft (DFG) (Re665/8 & 12). The GreatBarrier Reef Marine Park Authority (GBRMPA) is gratefullyacknowledged for permitting the field work on the GBR. Wealso thank Janie Wulff and anonymous reviewers for theircomments, which benefited the manuscript.

References

Anderson GR, Barker SC (1993) Species differentiation in theDidymozoidae (Digenea): restriction fragment lengthdifferences in internal transcribed spacer and 5.8S ribosomalDNA. Int J Parasitol 23:133-136

Ayling AL (1982) A redescription of Astrosclera willeyanaLister, 1900 (Ceratoporellida, Demospongiae), a new recordfrom the Great Barrier Reef. Mem Nat Mus Victoria 43:99-103

Beebe NW, Saul A (1995) Discrimination of all members of theAnopheles punctulatus complex by polymerase chainreaction-restriction fragment length polymorphism analysis.Am J Trop Med Hyg 53:478-481

Benzie JAH (1994) Patterns of gene flow in the Great BarrierReef and Coral Sea. In: Beaumont AR (ed) Genetics andevolution of aquatic organisms. Chapman & Hall, London, p67-79

Benzie JAH (1999) Genetic structure of coral reef organisms:ghosts of dispersal past. Am Zool 39:131-145

Buckler ESI, Holtsford TP (1996) Zea systematics: RibosomalITS evidence. Mol Biol Evol 13:612-622

in : K Moosa (ed.): Proceedings of the 9th International Coral Reef Symposium, Bali, October 2000. (in press)

Caporale DA, Beal BF, Roxby R, Van Beneden RJ (1997)Population structure of Mya arenaria along the NewEngland coastline. Mol Mar Biol Biotechnol 6:33-39

Chombard C, Boury-Esnault N, Tillier A, Vacelet J (1997)Polyphyly of "Sclerosponges" (Porifera, Demospongiae)supported by 28S ribosomal sequences. Biol Bull 193:359-367

Cracraft J (1989) Speciation and its ontology: The empiricalconsequences of alternative species concepts forunderstanding patterns and processes of differentiation. In:Otte D, Endler JA (eds) Speciation and its consequences.Sinaur, Sunderland, MA, p 28-59

Cracraft J (1997) Species concepts in systematics andconservation biology - an ornithological viewpoint. In:Claridge MF, Dawah HA, Wilson MR (eds) Species. Theunits of biodiversity. Chapman & Hall, London, p 325-339

Hall TA (1999) BioEdit: a user-friendly biological sequencealignment editor and analysis program for Windows95/98/NT. Nucl Acids Symp Ser 41:95-98

Harris DJ, Crandall KA (2000) Intragenomic variation withinITS1 and ITS2 of freshwater crayfishes (Decapoda:Cambaridae): implications for phylogenetic andmicrosatellite studies. Mol Biol Evol 17:284-291

Hartman WD, Goreau TF (1970) Jamaican coralline sponges:their morphology, ecology, and fossil relatives. In: Fry WG(ed) The Biolgy of Porifera. Zoological Society of LondonSymposia, Academic Press, London, p 205-243

Hickson SJ (1911) On Ceratopora, the type of a new family ofAlcyonaria. Proc R Soc Lond, Ser B: Biol Sci 84:195-200

Hillis DM, Davis SK (1988) Ribosomal DNA: Intraspecificpolymorphism, concerted evolution, and phylogenyreconstruction. Syst Zool 37:63-66

Hooper JNA (1996) Revision of Microcionidae (Porifera:Poecilosclerida: Demospongiae), with description ofAustralian species. Mem Qld Mus 40:1-626

Hugall A, Stanton J, Moritz C (1999) Reticulate evolution andthe origins ribosomal internal transcribed spacer diversity inapomictic Meloidogyne. Mol Biol Evol 16:157-164

Klautau M, Russo CAM, Lazoski C, Boury-Esnault N, ThorpeJP, Solé-Cava AM (1999) Does cosmopolitanism resultfrom overconservative systematics? A case study using themarine sponge Chondrilla nucula. Evolution 53:1414-1422

Klautau M, Solé-Cava AM, Borojevic R (1994) Biochemicalsystematics of sibling sympatric species of Clathrina(Porifera: Calcarea). Biochem Syst Ecol 22:367-375

Koch M, Mummenhoff K, Hurka H (1999) Molecularphylogenetics of Cochlearia (Brassicaceae) and allied generabased on nuclear ribosomal ITS DNA sequence analysiscontradict traditional concepts of their evolutionaryrelationship. Plant Syst Evol 216:207-230

Leskinen E, Alstrom RC (1999) Molecular phylogeny ofSalicaceae and closely related Flacourtiaceae: Evidencefrom 5.8 S, ITS 1 and ITS 2 of the rDNA. Plant Syst Evol215:209-227

Li W-H, Luo C-C, Wu C-I (1985) Evolution of DNA sequences.In: MacIntyre R (ed) Molecular Evolutionary Genetics.Plenum Press, New York/London, p 1-94

Lindquist N, Bolser R, Laing K (1997) Timing of larval releaseby two Caribbean demosponges. Mar Ecol Prog Ser155:309-313

Lister JJ (1900) Astrosclera willeyana, the type of a new familyof sponges. Zool Results 4:461-482

Maldonado M, Uriz MJ (1999) Sexual propagation by spongefragments. Nature 398:476

Maldonado M, Young CM (1996) Effects of physical factors onlarval behavior, settlement and recruitment of four tropicaldemosponges. Mar Ecol Prog Ser 138:169-180

Mayr E, Ashlock PD (1991) Principles of Systematic Zoology.McGraw-Hill, New York

Odorico DM, Miller DJ (1997) Variation in the ribosomalinternal transcribed spacers and 5.8S rDNA among fivespecies of Acropora (Cnidaria; Scleractinia): Patterns ofvariation consistent with reticulate evolution. Mol Biol Evol14:465-473

Quinn NJ, Kojis B (1999) Community structure of the livingfossil coralline sponge populations at the Grotto, Saipan,Northern Mariana Islands. Bull Mar Sci 65:227-234

Reitner J (1987) Euzkadiella erenoensis n.gen. n.sp. einStromatopore mit spikulären Skelett aus dem Oberapt vonEreno (Guipuzco, Nordspanien)und die systematischeStellung der Stromatoporen. Paläont Z 61:203-222

Reitner J (1992) "Coralline Spongien". Der Versuch einerphylogenetisch taxonomischen Analyse. Berliner GeowissAbh (E) 1:1-352

Reitner J, Engeser T (1987) Skeletal structures and habitates ofrecent and fossil Acanthochaetetes (subclassTetractinomorpha, Demospongia, Porifera). Coral Reefs6:151-157

Reitner J, Gautret P (1996) Skeletal Formation in the Modernbut ultraconservative Chaetetid Sponge Spirastrella(Acanthochaetetes) wellsi (Demospongiae, Porifera). Facies34:193-208

Reitner J, Wörheide G, Lange R, Schumann-Kindel G (2001)Coralline Demosponges - A geobiological portrait. BullTohoku Univ Mus 1:219-235

Reitner J, Wörheide G, Thiel V, Gautret P (1996) Reef cavesand cryptic habitats of Indo-Pacific reefs; distributionpatterns of coralline sponges and microbialites. GöttingerArb Geol Pal SB 2: 91-100

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: alaboratory manual. Cold Spring Harbor Laboratory, ColdSpring Harbor, N.Y.,

Schulenburg JHGvD, Englisch U, Wägele J-W (2000) Evolutionof ITS1 rDNA in the Digenea (Platyhelminthes:Trematoda): 3' End Sequence Conservation and ItsPhylogenetic Utility. J Mol Evol 48:2-12

Simmons MP, Ochoterena H (2000) Gaps as characters insequence-based phylogenetic analyses. Syst Biol 49:369-381

Soest RWM van (1984) Deficient Merlia normani from theCuraçao reefs, with a discussion on the phylogeneticinterpretation of sclerosponges. Bijdr Dierkd 54:211-219

Solé-Cava AM, Boury-Esnault N (1999) Patterns of intra andinterspecific genetic divergence in marine sponges. MemQld Mus 44:591-602

Solé-Cava AM, Klautau M, Boury-Esnault N, Borojevic R,Thorpe JP (1991a) Genetic evidence for cryptic speciation inallopatric populations of two cosmopolitan species of thecalcareous sponge genus Clathrina. Mar Biol 111:381-386

Solé-Cava AM, Thorpe JP (1990) High levels of geneticvariation in marine sponges. In: Rutzler K (ed) Newperspectives in sponge biology. Smithsonian InstitutionPress, Washington, D.C, p 332-337

Solé-Cava AM, Thorpe JP, Manconi R (1991b) A newMediterranean species of Axinella detected by biochemicalgenetic methods. In: Reitner J, Keupp H (eds) Fossil andrecent sponges. Springer-Verlag, Berlin, Heidelberg & NewYork, p 313-321

Stearn CW, Pickett JW (1994) The stromatoporoid animalrevisited: building the skeleton. Lethaia 27:1-10

in : K Moosa (ed.): Proceedings of the 9th International Coral Reef Symposium, Bali, October 2000. (in press)

Swofford DL (1998) PAUP*. Phylogenetic Analysis UsingParsimony (*and Other Methods) Version 4. SinauerAssociates, Sunderland, Massachusetts,

Uriz MJ, Maldonado M, Turon X, Marti R (1998) How doreproductive output, larval behaviour, and recruitmentcontribute to adult spatial patterns in Mediterraneanencrusting sponges? Mar Ecol Prog Ser 167:137-148

Vacelet J (1967) Quelques éponges pharétronides et "Silico-calcaires" des grottes sous-marines obscures. Rec Trav Statmar Endoume 58:121-132

Vacelet J (1977) Éponges pharétronides actuelles etsclérosponges de Polynésie Francaise, de Madagascar et dela Réunion. Bull Mus Natl Hist Natur Paris 3rd Ser Zool444:345-368

Vacelet J (1981) Éponges hypercalcifiées (Pharétronides,Sclérosponges) des cavités des récifs coralliens de Nouvelle-Calédonie. Bull Mus Natl Hist Nat Sect A: Zool Biol et EcolAnim 3:313-351

Vacelet J (1985) Coralline sponges and the evolution ofPorifera. In: Conway Morris S, George JD, Gibson R, PlattHM (eds) The origin and relationships of lowerinvertebrates. Clarendon Press, Oxford, p 1-13

Vacelet J (1999) Planktonic armoured propagules of theexcavating sponge Alectona (Porifera: Demospongiae) arelarvae: evidence from Alectona wallichii and A.mesatlantica sp. nov. Mem Qld Mus 44:627-642

van Bortel W, Trung HD, Roelants P, Harbach RE, Backeljau T,Coosemans M (2000) Molecular identification of Anophelesminimus s.l. beyond distinguishing the members of thespecies complex. Insect Mol Biol 9:335-340

van Oppen MJH, Willis BL, Van VHWJA, Miller DJ (2000)Examination of species boundaries in the Acroporacervicornis group (Scleractinia, Cnidaria) using nuclearDNA sequence analyses. Mol Ecol 9:1363-1373

van Oppen MJH, Wörheide G, Takabayashi M (2001) Nuclearmarkers in evolutionary and population genetic studies ofscleractinian corals and sponges. Proc 9th Int Coral ReefSymp (this volume)

Willenz P, Pomponi SA (1996) A new deep sea coralline spongefrom Turks and Caicos Islands: Willardia caicosensis gen. etsp. nov. (Demospongiae: Hadromerida). Bull Inst R Sci NatBelgique Biol 66:205-218

Wood R (1987) Biology and revised systematics of some lateMesozoic stromatoporoids. Spec Papers Paleont 37:1-89

Wood RA, Reitner J (1986) Poriferan affinities of Mesozoicstromatoporoids. Palaeontology 29:469-474

Wörheide G (1998) The reef cave dwelling ultraconservativecoralline demosponge Astrosclera willeyana Lister 1900from the Indo-Pacific. Micromorphology, ultrastructure,biocalcification, isotope record, taxonomy, biogeography,phylogeny. Facies 38:1-88

Wörheide G, Gautret P, Reitner J, Böhm F, Joachimski MM,Thiel V, Michaelis W, Massault M (1997) Basal skeletalformation, role and preservation of intracrystalline organicmatrices, and isotopic record in the coralline spongeAstrosclera willeyana Lister, 1900. Bol R Soc Esp Hist Nat(Geol) 91:355-374