cell reports supplemental information ferritin … reports supplemental information...
Post on 13-May-2018
226 Views
Preview:
TRANSCRIPT
Cell Reports
Supplemental Information
Ferritin-Mediated Iron Sequestration Stabilizes
Hypoxia-Inducible Factor-1 upon LPS Activation
in the Presence of Ample Oxygen
Isabel Siegert, Johannes Schödel, Manfred Nairz, Valentin Schatz, Katja Dettmer,
Christopher Dick, Joanna Kalucka, Kristin Franke, Martin Ehrenschwender, Gunnar
Schley, Angelika Beneke, Jörg Sutter, Matthias Moll, Claus Hellerbrand, Ben Wielockx,
Dörthe M. Katschinski, Roland Lang, Bruno Galy, Matthias W. Hentze, Peppi Koivunen,
Peter J. Oefner, Christian Bogdan, Günter Weiss, Carsten Willam, and Jonathan
Jantsch
Supplemental Experimental Procedures Reagents and Inhibitors α-ketoglutaric acid disodium salt dehydrate (αKG), actinomycin D (ActD), dimethylfumarate
(DMF), ferric chloride (Fe(III)Cl3), LPS (E.coli O111:B4), malonate, MG132, N-acetylcysteine
(NAC), 8-hydroxyquinoline were purchased from Sigma-Aldrich. Ferric ammonium citrate
was obtained from Fluka. Ferrous chloride tetrahydrate (Fe(II)Cl2) and BAY11-7085 were
purchased from Merck. Desferrioxamine (DFO) was from Novartis. Completely
phosphorothioate-modified type B CpG ODN 1668 (TCC ATG ACG TTC CTG ATG CT) was
purchased from Thermo Scientific (Schwerte, Germany). Polyinosinic:polycytidylic acid
(poly(I:C)) was obtained from Amersham Biosciences. The calcein-AM was purchased from
Invitrogen. 2-(1-chloro-4-hydroxyisoquinoline-3-carboxamido) acetate (ICA) was synthesized
as previously described (Schley et al., 2012). THP-1 monocytic cell line was obtained from
ATCC.
Antibodies For Western blot analysis, primary rabbit antibodies against the following mouse targets were
used: Actin (A2066, Sigma Aldrich), SLC40a1 (FPN1; NBP1-21502, Novus), FTH1
(ab75973, Abcam), HIF1α (10006421; Cayman), hydroxy-HIF1α P402 (07-1585; Millipore;
(Tian et al., 2011)), hydroxy-HIF1α P564 (3434, Cell Signaling (Tian et al., 2011)), HSP90
(sc-7947, Santa Cruz), NOS2 (ADI-KAS-NO001-F; Enzo life sciences), PHD1 (NB 100-310;
Novus), PHD2 (NB100-2219; Novus), PHD3 (NB100-303; Novus), VHL (sc-5575; Santa
Cruz), Tubulin-α Ab-2 (clone DM1A; MS-581, Dunn Labortechnik). Polyclonal swine anti-
rabbit IgG/ HRP (P0399; Dako) was used as secondary reagent. For flow cytometry
fluorochrome-labelled CD11c (N418, eBiosciences), I-A/I-E MHC-II (2G9, BD Biosciences),
CD80 (clone 16-10A1, BD Biosciences) and CD86 (clone GL1, BD Biosciences) and the
respective isotype controls were used.
Generation of dendritic cells and cell culture experiments As described previously (Lutz et al., 1999), bone marrow-derived dendritic cells (DC) were
generated from C57BL/6 mice (Charles River Breeding Laboratories), ROSA26ODD-Luc
(ODD-Luc) mice (The Jackson Laboratory), Nos2-/- mice (Wiese et al., 2012), Cybb−/−Nos2−/−
(Wiese et al., 2012), Lcn2-/- mice (Warszawska et al., 2013) (Flo et al., 2004). For generation
of Phd2-deficient and Phd2/3-double-deficient DC, the LysM Cre-deleter strain (Clausen et
al., 1999) was crossed with Phd2fl/fl mice (Singh et al., 2013) and in addition with Phd3fl/fl
mice (Takeda et al., 2006), respectively. For generation of Irp1/2-double-deficient DC, DC
were generated from LysMCre Irp1/2fl/fl mice (Nairz et al., 2015).
At day 7-8 of bone marrow culture the DC were harvested, yielding a population of around
75% CD11c+ immature DC. Before stimulation or treatment the DC were allowed to settle
down in conventional polystyrene plates for at least one hour. Experiments took place in a
regular humidified incubator under normoxic conditions (37°C, 5% CO2, 21% O2) or under
hypoxic conditions (37°C, 5% CO2, 0.5% O2) using an adjustable hypoxic humified
workbench suitable for cell culture experiments (invivo300; Ruskinn Technology). Bone
marrow-derived macrophages were cultured in Teflon bags as described earlier (Siegert et
al, 2014).
RNA isolation, reverse transcription, real-time PCR and relative quantification Total RNA was extracted from cultured cells as described earlier (Jantsch et al., 2011) using
Trifast® (Peqlab) according to manufacturer’s instructions. 1-2 µg total RNA was reverse
transcribed using the High Capacity cDNA Archive kit (Applied Biosystems). Analysis was
performed by quantitative real-time PCR (qRT-PCR) with an ABI Prism 7900 sequence
detector (Applied Biosystems) using Taqman Universal Mastermix and Assays-on-Demand
(Applied Biosystems) as described earlier (Jantsch et al., 2011). For analysis of Fth1 mRNA
levels, contaminating DNA was removed prior to reverse transcription with the DNA-free kit
(Ambion) according to the instructions of the manufacturer. The following assays were used:
murine hypoxanthine guanine phosphoribosyl transferase 1 (Hprt1, Mm00446968_m1), 18S
ribosomal RNA (18S, Mm03928990_g1), hypoxia inducible factor 1α subunit (Hif1a,
Mm01283760_m1), lipocalin 2 (Lcn2, Mm01324470_m1), ferritin heavy chain (Fth1,
Mm00850707_g1), solute carrier family 40 (iron-regulated transporter) member 1 (Slc40a1
(ferroportin 1, Fpn1), Mm00489837_m1), Slc11a1 (Nramp1, Mm00443045_m1), type 2 nitric
oxide synthase (Nos2, Mm00440485_m1), Tnfip3 (A20, Mm00437121_m1),
phosphoglycerate kinase 1 (Pgk1, Mm01225301_m1), solute carrier family 2 (facilitated
glucose transporter) member 1 (Slc2a1 (Glut1), Mm01192270_m1). CD36 mRNA expression
was analyzed applying LightCycler technology (Roche) and QuantiTect Primer Assays
(Qiagen, Hilden, Germany) according to the manufacturers' instructions. Data were analyzed
using the ΔΔCT method. The normalized ratio of target mRNA to the internal control mRNA
Hprt1 or 18S was set to 1.
Nitrite production and immunoblotting At indicated time-points supernatants were collected and nitrite accumulation in the
supernatant as an indicator of NO production was determined by the Griess reaction using
sodium nitrite as a standard. Immunoblotting was performed as described earlier (Jantsch et
al., 2011). Briefly, DC were lysed using a PE-lysis buffer (6.65 M urea, 10% glycerol, 1%
SDS, Tris [tris(hydroxymethyl)aminomethane] HCl, pH 6.8, 5 mM DTT) supplemented with a
protease inhibitor cocktail (Roche Diagnostics). Lysates were diluted with SDS-PAGE
sample buffer and separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel
electrophoresis. Proteins were transferred onto polyvinylidene difluoride membrane
(Millipore) and detected by specific antibodies. The bound antibodies were visualized by ECL
technology and detected by the Chemo Star Imager (INTAS Science Imaging Instruments),
ChemiDoc™ XRS+ System und Image Lab Software (Bio-Rad) or by exposure of X-ray films
suitable for ECL detection.
RNA interference (RNAi) in dendritic cells Non-silencing siRNA (ns-siRNA) oligonucleotides siRNA (1027281) and siRNA-duplexes
directed against Hif1a (L-040638-00-010; outside of the ODD domain: J-040638-07/J-
040638-08), Fth1 (L-046965-01-0005), Fpn1 (L-041126-01-0005) were purchased from
Qiagen and Dharmacon via Thermo Scientific, respectively. RNA interference was performed
as described earlier (Jantsch et al., 2008; Siegert et al., 2014). Electroporation conditions
were set to 400 V, 150 µF and 100 Ω.
Measurement of PHD activity Measurement of the PHD activity is based on the protocol provided by Juva and Prockop
(Juva and Prockop, 1966). Cell pellets of BL/6 WT BM-DC were lysed with a suitable lysis
buffer (0.1 M NaCl, 0.1 M glycine, 10 µM DTT, 0.1% Triton X-100, 0.01 M Tris, pH 7.8). The
supernatants were used in the assay to hydroxylate [3H] proline-labeled HIF1α-ODD at 37°C
for 30 min either in the presence or absence of cofactors (5 µM iron, 2 mM αKG, 2 mM
vitamin C). The enzymatic reaction was stopped by adding K2HPO4, pH 5 and the reactions
were hydrolyzed in the presence of HCl overnight at 120°C. 4-hydroxy [3H] proline was then
separated from all other amino acids. PHD activity is expressed as dpm of 4-hydroxy [3H]
proline/1 x 106 dpm of incorporated [3H] proline. The relative maximal PHD activity was
calculated as a ratio of PHD activity in samples lacking the cofactors to PHD activity in
samples supplemented with cofactors. The values obtained for untreated DC were set as
100%.
Luciferase activity In order to detect luciferase activity, DC were lysed with a suitable lysis buffer (PBS, 2mM
EDTA, 1% TritonX-100 and 10% glycerol) and processed with luciferase substrate
(Promega). Luminescence was detected with a TopCount NTX reader (Perkin-Elmer).
Determination of total intracellular iron content by atomic absorption spectroscopy
For assessment of total intracellular iron content, DC were washed 2-3 times with PBS and
lysed with 0.1 % TritonX-100 and 0.1 N HCl and high purity water (Biochrom). Atomic
absorption spectroscopy was used to quantify total cellular iron content in DC with a
Shimadzu AA-7000 atomic absorption spectrophotometer (RSD < 2%). Calibrations were
established using certified Iron AAS standards (Merck KGA). Bradford assay (DCTM Protein
Assay, BioRad) was used to determine the protein concentration of an aliquot of the
respective samples.
Gel retardation assay The gel retardation assay was performed as described before (Weiss et al., 1997). Briefly,
a 32P-labeled IRE probe was transcribed in vitro from the plasmid I-12-CAT (linearized with
XbaI) by T7 RNA polymerase and purified by gel electrophoresis. The transcript had the
sequence 5‘-
GGGCGAAUUCGAGCUCGGUACCCGGGGAUCCUGCUUAACAGUGCUUGGACGGAU
CCU-3' (the unpaired C and the IRE loop are underlined). Detergent cell extracts were
prepared, and IRE/ IRP complexes were analyzed by nondenaturing gel electrophoresis and
autoradiography.
Analysis of the labile iron pool The labile iron pool was quantified by using the property of Fe(II) to quench the fluorescence
of calcein (Epsztejn et al., 1997). After incubation cells were washed twice with PBS. 1×106
BM-DC were stained with 1 µM calcein-AM, incubated at 37°C for 15 minutes and washed
twice with PBS again. Calcein fluorescence was analyzed by flow cytometry (FACS Canto II,
BD Biosciences) prior to and after incubation with 80 µM Fe(II)Cl2/ 0.04 µM 8-
hydroxyquinoline (in DMSO) (Ma et al., 2015). The data were analyzed with FlowJo software
(Tree Star). The quenchable iron pool was calculated by subtracting the geometric mean
fluorescence of (un)stimulated cells prior and after treatment with Fe(II)Cl2/ 8-
hydroxyquinoline. The greater the quenchable iron pool the smaller is the intracellular
available Fe.
Oyxgen consumption with Oxodish® and SDR SensorDish® Reader In order to quantify oxygen levels in cell culture plates, we used precalibrated OxoDish® six
well plates (Presens). These plates are made of oxygen-impermeable polystyrene and O2
sensor spots which are located on the bottom of the wells. This setup guarantees that O2
tension underneath the cell culture layer is detected by the O2-sensors. The O2 sensor spots
contain dyes whose luminescence lifetime is dependent on the oxygen partial pressure.
Signals were generated and detected by SDR SensorDish® Reader (Presens) that is capable
of detecting luminescence lifetime. Oxygen referenced images were generated by SDR
software (Presens).
Detection of ROS by flow cytometry The detection of intracellular ROS was performed as described earlier (Wiese et al., 2012).
Briefly, DC were stained with 10 µM CM-H2DCFDA (5-(and-6)-chloromethyl-2′,7′-
dichlorodihydrofluorescein diacetate, acetyl ester; Invitrogen) for 30 minutes. Where
indicated cells were pretreated with NAC 15 min prior stimulation with 10 ng/mL LPS. After 6
h the CM-H2DCFDA-fluorescence intensity of whole cells was analyzed by flow cytometry.
Analysis of TCA-intermediates by HPLC Cell pellets were spiked with 10 µL internal standard solution containing [U-13C] fumarate, [U-2H] succinate (both from Euriso-top) and [U-2H]α-ketoglutarate (Sigma-Aldrich) at 1mM each
in methanol. Pellets were extracted with 600 µL methanol (Sigma-Aldrich)/water (PURELAB
Plus water) (80/20, v/v) and washed twice with 200 µL methanol/water (80/20, v/v). The
combined extract was evaporated to dryness (CombiDancer) and reconstituted in 50 µL
water for HPLC-ESI-MS/MS analysis using multiple reaction monitoring (MRM) and negative
mode ionization. A 1200 SL HPLC system (Agilent) and a API 4000 QTrap mass
spectrometer (ABSciex) equipped with a TurboV electrospray ion source was used. HPLC
separation was performed employing a Phenomenex Luna 3uPFP(2) column (150 × 2 mm, 3
μm, Torrence) with 0.1% (v/v) formic acid (Sigma-Aldrich) in water as mobile phase A and
acetonitrile (LCMS grade, Sigma-Aldrich) as mobile phase B. Gradient elution with a flow
rate of 200 μL/min was performed: 100% A (6 min), 0% A at 6.01 min (2 min), 100% A at 8.
01 min (10 min). An injection volume of 10 µL was used. Quantification was performed using
calibration curves with the corresponding stable isotope labeled analog as internal standard.
Analysis of HIF1α in spleen DC C57BL/6 mice were injected i.p either with 1 mg ICA in vehicle or with the same volume of
vehicle (Tris-HCl pH8 + 5% DMSO). After 3 h, splenic single cell suspensions were
generated. To enrich for CD11c+ DC we used CD11c MicroBeads and a magnetic cell
separation technique (MACS, Milteny Biotec). Cells were fixed, permeabilized (using
eBioscience fixation/permeabilization diluent/concentrate and permeabilization buffer) and
subsequently stained for HIF1α. Intracellular HIF1α was detected with a HIF1α antibody
(MAB 1935, R&D systems) that was biotinylated with a Biotin-XX microscale protein labeling
kit according to the manufacturer’s instructions (life technologies). Bound antibodies were
labelled with streptavidin-PE-CF594 (BD Biosciences). Intracellular HIF1α accumulation was
analyzed by flow cytometry in DC.
C57BL/6 mice were injected i. p. either with 100 µL of 10 mg/mL Fe(III)-gluconate in PBS
(Ferrlecit, Sanofi Aventis) or 100 µL PBS. One hour later, the mice received either 30 µg LPS
in 300 µL PBS or 300 µL PBS for 3 h. From spleens of treated animals a single cell
suspension was generated and stained with CD11c- and MHCII-specific antibodies.
Afterwards the cells were fixed, permeabilized (using eBioscience fixation/permeabilization
diluent/concentrate and permeabilization buffer) and subsequently stained for HIF1α as
described above. All animal experiments were carried out according to protocols approved
by the Animal Welfare Committee of the local government (Regierung von Mittelfranken,
Ansbach, Germany).
Statistical analysis Results are expressed as means + SEM. If not indicated otherwise, ‘n’ represents biological
samples obtained from ‘N’ independent experiments (i.e. number of times experiment was
repeated in the laboratory)/ mice. Statistical significance was calculated with Prism v6.0
(GraphPad Software). Normality distribution was tested with the Kolmogorov-Smirnov test.
When comparing two groups with normally distributed data, unpaired two-tailed Student’s t-
tests were used for data where equal variances were assumed. Otherwise two groups of
normally distributed data were analyzed with an unpaired two-tailed t-test using the Welch
correction. For non-normally distributed datasets, Mann-Whitney test was used. When
comparing more than two groups, Kruskal-Wallis test followed by a Dunn's multiple
comparison tests was used. P-values of <0.05 were deemed statistically significant.
References:
Clausen, B.E., Burkhardt, C., Reith, W., Renkawitz, R., and Forster, I. (1999). Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res 8, 265-277. Epsztejn, S., Kakhlon, O., Glickstein, H., Breuer, W., and Cabantchik, I. (1997). Fluorescence analysis of the labile iron pool of mammalian cells. Anal Biochem 248, 31-40. Flo, T.H., Smith, K.D., Sato, S., Rodriguez, D.J., Holmes, M.A., Strong, R.K., Akira, S., and Aderem, A. (2004). Lipocalin 2 mediates an innate immune response to bacterial infection by sequestrating iron. Nature 432, 917-921. Jantsch, J., Turza, N., Volke, M., Eckardt, K.U., Hensel, M., Steinkasserer, A., Willam, C., and Prechtel, A.T. (2008). Small interfering RNA (siRNA) delivery into murine bone marrow-derived dendritic cells by electroporation. J Immunol Methods 337, 71-77. Jantsch, J., Wiese, M., Schodel, J., Castiglione, K., Glasner, J., Kolbe, S., Mole, D., Schleicher, U., Eckardt, K.U., Hensel, M., et al. (2011). Toll-like receptor activation and hypoxia use distinct signaling pathways to stabilize hypoxia-inducible factor 1alpha (HIF1A) and result in differential HIF1A-dependent gene expression. J Leukoc Biol 90, 551-562.
Juva, K., and Prockop, D.J. (1966). Modified procedure for the assay of H-3-or C-14-labeled hydroxyproline. Anal Biochem 15, 77-83. Lutz, M.B., Kukutsch, N., Ogilvie, A.L., Rossner, S., Koch, F., Romani, N., and Schuler, G. (1999). An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J Immunol Methods 223, 77-92. Ma, Y., Abbate, V., and Hider, R.C. (2015). Iron-sensitive fluorescent probes: monitoring intracellular iron pools. Metallomics 7, 212-222. Nairz, M., Ferring-Appel, D., Casarrubea, D., Sonnweber, T., Viatte, L., Schroll, A., Haschka, D., Fang, F.C., Hentze, M.W., Weiss, G., et al. (2015). Iron Regulatory Proteins Mediate Host Resistance to Salmonella Infection. Cell Host Microbe 18, 254-261. Schley, G., Klanke, B., Schodel, J., Kroning, S., Turkoglu, G., Beyer, A., Hagos, Y., Amann, K., Burckhardt, B.C., Burzlaff, N., et al. (2012). Selective stabilization of HIF-1alpha in renal tubular cells by 2-oxoglutarate analogues. Am J Pathol 181, 1595-1606. Siegert, I., Schatz, V., Prechtel, A.T., Steinkasserer, A., Bogdan, C., and Jantsch, J. (2014). Electroporation of siRNA into mouse bone marrow-derived macrophages and dendritic cells. Methods Mol Biol 1121, 111-119. Singh, R.P., Franke, K., Kalucka, J., Mamlouk, S., Muschter, A., Gembarska, A., Grinenko, T., Willam, C., Naumann, R., Anastassiadis, K., et al. (2013). HIF prolyl hydroxylase 2 (PHD2) is a critical regulator of hematopoietic stem cell maintenance during steady-state and stress. Blood 121, 5158-5166. Takeda, K., Ho, V.C., Takeda, H., Duan, L.J., Nagy, A., and Fong, G.H. (2006). Placental but not heart defects are associated with elevated hypoxia-inducible factor alpha levels in mice lacking prolyl hydroxylase domain protein 2. Mol Cell Biol 26, 8336-8346. Tian, Y.M., Yeoh, K.K., Lee, M.K., Eriksson, T., Kessler, B.M., Kramer, H.B., Edelmann, M.J., Willam, C., Pugh, C.W., Schofield, C.J., et al. (2011). Differential sensitivity of hypoxia inducible factor hydroxylation sites to hypoxia and hydroxylase inhibitors. J Biol Chem 286, 13041-13051. Warszawska, J.M., Gawish, R., Sharif, O., Sigel, S., Doninger, B., Lakovits, K., Mesteri, I., Nairz, M., Boon, L., Spiel, A., et al. (2013). Lipocalin 2 deactivates macrophages and worsens pneumococcal pneumonia outcomes. J Clin Invest 123, 3363-3372. Weiss, G., Bogdan, C., and Hentze, M.W. (1997). Pathways for the regulation of macrophage iron metabolism by the anti-inflammatory cytokines IL-4 and IL-13. J Immunol 158, 420-425. Wiese, M., Gerlach, R.G., Popp, I., Matuszak, J., Mahapatro, M., Castiglione, K., Chakravortty, D., Willam, C., Hensel, M., Bogdan, C., et al. (2012). Hypoxia-mediated impairment of the mitochondrial respiratory chain inhibits the bactericidal activity of macrophages. Infect Immun 80, 1455-1466.
top related