carboxymethyl cellulose enables silk fibroin nanofibrous scaffold with enhanced biomimetic potential...
Post on 28-Feb-2018
226 Views
Preview:
TRANSCRIPT
-
7/25/2019 Carboxymethyl Cellulose Enables Silk Fibroin Nanofibrous Scaffold With Enhanced Biomimetic Potential for Bone Ti
1/13
Carbohydrate Polymers 151 (2016)335347
Contents lists available at ScienceDirect
Carbohydrate Polymers
j ournal homepage: www.elsevier .com/ locate /carbpol
Carboxymethyl cellulose enables silk fibroin nanofibrous scaffoldwith enhanced biomimetic potential for bone tissue engineeringapplication
B.N. Singh, N.N. Panda, R. Mund, K. Pramanik
Department of Biotechnology andMedical Engineering, National Institute of Technology, Rourkela, India
a r t i c l e i n f o
Article history:
Received 21 January 2016
Received in revised form 23May2016
Accepted 24May2016
Available online 25May2016
Keywords:
Silk fibroin
Electrospinning
Carboxymethyl cellulose
Calcium phosphate
Tissue engineered scaffold
a b s t r a c t
Novel silk fibroin (SF) and carboxymethyl cellulose (CMC) composite nanofibrous scaffold (SFC) were
developed to investigate their ability to nucleate bioactive nanosized calcium phosphate (Ca/P) by
biomineralization for bone tissue engineering application. The composite nanofibrous scaffold was pre-
pared by free liquid surface electrospinning method. The developed composite nanofibrous scaffold was
observed to control the size ofCa/P particle (100nm) as well as uniform nucleation ofCa/P over the
surface. The obtained nanofibrous scaffolds were fully characterized for their functional, structural and
mechanical property. The XRD and EDX analysis depicted the development ofapatite like crystals over
SFC scaffolds ofnanospherical in morphology and distributed uniformly throughout the surface ofscaf-
fold. Additionally, hydrophilicity as a measure ofcontact angle and water uptake capacity is higher than
pure SF scaffold representing the superior cell supporting property ofthe SF/CMC scaffold. The effect of
biomimeticCa/P onosteogenicdifferentiation ofumbilical cord bloodderivedhumanmesenchymal stem
cells (hMSCs) studied in early and late stage ofdifferentiation shows the improved osteoblastic differen-
tiation capability as compared to pure silk fibroin. The obtained result confirms the positive correlation
ofalkaline phosphatase activity, alizarin staining and expression ofrunt-related transcription factor 2,
osteocalcin and type1collagen representing thebiomimeticpropertyofthe scaffolds. Thus, thedeveloped
composite has been demonstrated to be a potential scaffold for bone tissue engineering application. 2016 Elsevier Ltd. All rights reserved.
1. Introduction
The development of an ideal scaffold for bone tissue engi-
neering application has been an extensive area of research in the
last decades. Various biopolymers have emerged through time
to meet the required specification for bone tissue regeneration.
The polymer blends and composite are more efficient than the
individual biopolymer as scaffold material (Li et al., 2014; L u
et al., 2013). Bombyx mori silk fibroin (SF), a naturally occur-
ring biopolymer, has excellent tuneable mechanical propertieswhich make it an important scaffold entity for hard as well as
soft tissue engineering applications (Meinel et al., 2005; Minoura,
Tsukada & Nagura, 1990; Omenetto & Kaplan, 2010; Santin,Motta,
Freddi & Cannas, 1999). The two major components ofBombyx
mori silk are silk fibroin, a hydrophobic structural protein con-
sisting of equimolar ratio of heavy and light chain of protein
Corresponding author.
E-mail address:mondalkp@gmail.com (K. Pramanik).
and sericin, a hydrophilic component (Ochi, Hossain, Magoshi &
Nemoto, 2002; Tanaka et al., 1999; Zhou et al., 2000). In the last
decade, apart from silk various other proteins and polysaccharides
based biopolymers such as cellulose, starch, chitosan, alginate and
their derivatives have been chosen for their potential applications
inmany areas such as pharmacy, medicine, tissue engineering and
biotechnology (Gombotz &Wee, 2012;Nguyen &West, 2002). Car-
boxymethylcellulose (CMC), a highly hydrophilic semi-synthetic
natural polymer has significant super absorbing, defoaming and
chelating abilities and finds widespread applicability in phar-maceutical industries (Ghanbarzadeh & Almasi, 2011; Wang &
Wang, 2010;Whistler,2012). Thenatural structural matrixof bone
consists of type-I collagen fibers, which is reinforced with hydrox-
yapatite like inorganic phase by biomineralization (Fratzl, Gupta,
Paschalis & Roschger, 2004). Hydroxyapatite, the main mineral
phaseof boneand skeletal systemshaveseveral favourableproper-
ties namely biocompatibility, osteoconductivity, osteoinductivity
and bioactivity (Cao & Hench, 1996; Jiang et al., 2013; Suchanek &
Yoshimura, 1998). Thus, it is significant to mimic the biomineral-
ized organic phase of natural bone. The aim of this present work is
http://dx.doi.org/10.1016/j.carbpol.2016.05.088
0144-8617/ 2016 Elsevier Ltd. All rightsreserved.
http://localhost/var/www/apps/conversion/tmp/scratch_5/dx.doi.org/10.1016/j.carbpol.2016.05.088http://www.sciencedirect.com/science/journal/01448617http://www.elsevier.com/locate/carbpolmailto:mondalkp@gmail.comhttp://localhost/var/www/apps/conversion/tmp/scratch_5/dx.doi.org/10.1016/j.carbpol.2016.05.088http://localhost/var/www/apps/conversion/tmp/scratch_5/dx.doi.org/10.1016/j.carbpol.2016.05.088mailto:mondalkp@gmail.comhttp://crossmark.crossref.org/dialog/?doi=10.1016/j.carbpol.2016.05.088&domain=pdfhttp://www.elsevier.com/locate/carbpolhttp://www.sciencedirect.com/science/journal/01448617http://localhost/var/www/apps/conversion/tmp/scratch_5/dx.doi.org/10.1016/j.carbpol.2016.05.088 -
7/25/2019 Carboxymethyl Cellulose Enables Silk Fibroin Nanofibrous Scaffold With Enhanced Biomimetic Potential for Bone Ti
2/13
336 B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347
to bring several advantageous properties of both silk fibroin (high
mechanical strength, biocompability) and carboxymethylcellulose
(hydrophilicity,chelatingcapacity) at thesame templateto develop
a biomaterial for bone tissueengineering application. We consider
the developmentofSF/CMCbasedcompositescaffolds asa promis-
ingstrategy to overcomethelimitations of thepure SF scaffolds. In
fact, there are published reports on SF/CMCbased composite films
and hydrogels being put into various biotechnology and biomedi-
cal applications (Ju et al., 2014; Kundu,Mohapatra& Kundu,2011).
The present research has however, focused on the processing of
the composite material into nanofibers through free liquid surface
electrospinning techniquewithanaimofcreatinga close juxtaposi-
tion between bone and the scaffold for enhanced osteointegration.
Electrospun nanofibrous scaffold closely resembles the nanofi-
brous structure of natural extracellular matrix (ECM) and thus,
promotes better cell attachment and proliferation (Ma & Zhang,
1999). SF and CMC havenegligible inflammatory reactionsand are
biocompatible(Miyamoto, Takahashi, Ito, Inagaki & Noishiki, 1989;
Santin,Motta, Freddi &Cannas,1999).Moreover, thechelating abil-
ity of CMC can coordinate bonding between COO and Ca2+, and
elicit the homogeneous Ca/P crystal nucleation which is a vital
osteogenic property that an ideal scaffold should demonstrate for
bone regeneration. This paper not only presents a comprehensive
understanding of themorphological and physicochemical charac-teristics of the SF/CMC nanofibrous scaffold, but also accounts a
thorough investigation of their biological performance for bone
regenerationthrough the useof seededhumanmesenchymal stem
cells (hMSCs) that are derived from the human umbilical cord
blood. In this study, the novelty and the superiority of the SF/CMC
nanofibrous scaffold over other polymeric/composite scaffoldshas
been explored to enhance osteogenic differentiation of the cells.
The osteogenic response of MSCs to biomimetic SF/CMC com-
posite nanofibrous scaffolds was assessed by expression analysis
of osteogenic genes (RUNX2 transcription factor, Osteocalcin and
type1 collagen), alkaline phosphatase activity, and calcium depo-
sition.
2. Materials and methods
2.1. Materials
Bombyx mori silk cocoons were purchased from Central Tasar
Research and Training Institute (Jharkhand, India). Lithium bro-
mide(LiBr),sodiumcarbonate (Na2CO3) andformicacid(98%)were
procured from Merck, India. Dulbeccos Modified Eagle Medium
(DMEM), Phosphate-buffered saline (PBS), Fetal bovine serum
(FBS), Trypsin (0.25%), Alexa-Fluor 488 conjugated phalloidin,
Live/Dead staining kit, Antibiotic-Antimycotic solution, anti-
RUNX2 antibody, anti-osteocalcin antibody and FITC-conjugated
secondary antibodies, TRIzol, High-capacity cDNA Reverse Tran-
scription Kit and SYBER Green RT-PCR kit were purchased
from Invitrogen, USA. The dialysis cassette was obtained from
Thermo fisher, USA. Bovine serum albumin (BSA), SIGMAFASTTM
p-nitrophenylphosphate (pNPP) tablets, paraformaldehyde, Triton
X-100, 46-Diamidino-2-phenyindole (DAPI), Dimethyl Sulfoxide
(DMSO), MTT assay kit, Alizarin red S (ARS) solution, CMC as
sodium salt (molecular weight 700kDa and degree of substitu-
tion 0.650.85) ammoniumhydroxide, cetylpyridinium chloride
(CPC) were obtained from Sigma.
2.2. Preparation of regenerated silk fibroin
Silk fibroin (SF) was extracted from Bombxy mori silk cocoon
and the regenerated aqueous SF solution was prepared follow-
ing the previously established protocol (Rockwood, Preda, Ycel,
Wang, Lovett& Kaplan, 2011; Sah& Pramanik, 2010). Briefly Bom-
byx mori silk cocoons were chopped and degummed in 0.02M
aqueous Na2CO3 for 20min at 100C, followed by washing in
distilledwatertoremovesericinandotherimpurities.Afterdegum-
ming, silk fibers were dried at 37C for overnight. Degummed silk
fibers were then dissolved in 9.3M LiBr aqueous solution at 45C
for 2hr to 3hr resulted in a 10wt% solution. The obtained solution
was then dialyzed against deionizedwater for 23days to remove
LiBrions. Theobtainedsolutionswerethencentrifugedat5000 rpm
to removeun-dissolved impurities andaggregates. Finally SF solu-
tions were freeze dried and used for further study.
2.3. Generation of SF/CMC nanofibers
Nanofibers ofSF/CMCblendswerefabricated by theelectrospin-
ning method. Four different compositions of SF/CMC (100/0, 99/1,
98/2 and 97/3 (w/w)) blend solutions (10wt%) were prepared by
dissolvingappropriate amountofSFandCMCpowder in98%formic
acid with stirring tomakewell dispersedhomogenous solutions. A
10wt% pure SF solution was used as control. The electrospinning
of the solutions was done by using a free liquid surface electro-
spinningmachine(NS Lab200,ELMARCO), at 4.25 kVcm1 voltage,
40% relative humidity of electrospinning chamber and 12rpm ofwire based spinning electrode at 202 C. Multiple Taylor cones
were developed over the spinning electrode in response to the
potential difference created between spinning and collector elec-
trode separated apart at 16cm. The different composite scaffolds
are designatedasSF, SFC1A, SFC2B and SFC3C for 100/0, 99/1, 98/2
and97/3 (w/w)compositionsrespectively.Thegelatin nanofibrous
scaffold fabricated by electrospinning of 10wt% solution of gelatin
under similar electrospinning conditionswasused as control.
2.4. Post treatment of electrospun scaffolds
The electrospun SF and SFC nanofibrous scaffolds were then
cross-linked with 3wt% EDC-NHS [2:1 (w/w)] in ethanol: water
(95:5v/v)] solution and were further treated with 0.1M CaCl2solution overnight at 40 C. The cross-linked scaffoldswere rinsed
thoroughly with deionizedwater to remove ions like chlorine and
residual cross-linking reagent, and dried under vacuum at room
temperature for 24h. The different composite scaffolds treated
with CaCl2 were designated as SF1, SFC1 and SFC2 corresponding
to SF, SF/CMC (99:1w/w) and SF/CMC (98:2w/w) respectively.
2.5. In vitro mineralization
The in vitro mineralization of the scaffold was performed by
incubating11 cm2 sizesof scaffoldsin 20ml simulatedbodyfluid
(SBF)preparedfollowing theearlier reportedmethod(Kokubo,Kim
& Kawashita, 2003) for 7days. The pH of the fluids was adjusted
to 7.4 at 36.5 C. After 7days, the scaffolds were taken out, gentlyrinsed in distilledwater and dried at room temperature for further
analysis.
2.6. Morphological characterization
Characterization of the developedscaffoldwasdone beforeand
after the in-vitro mineralization. To scaffolds with 0.50.5cm2
sizes of scaffolds were coated with gold, and observed under
fieldemissionscanningelectronmicroscope (FESEM)(NOVANANO
SEM, USA) formorphological assessment. The average fiber diam-
eters were measured from ten different FESEM images of5000
magnificationusing Image J software.EnergydispersiveX-rayanal-
ysis (EDX)was used to ensuremineral deposition on the scaffolds.
-
7/25/2019 Carboxymethyl Cellulose Enables Silk Fibroin Nanofibrous Scaffold With Enhanced Biomimetic Potential for Bone Ti
3/13
B.N. Singh et al./ Carbohydrate Polymers 151 (2016) 335347 337
2.7. Physicochemical characterizations
The nature of interactions among the functional groups of the
prepared SFC composite scaffolds and their interaction with Ca/P
were determined using Fourier transforms infrared (FTIR) spec-
troscopic analysis (FTIR, Shimadzu AIM-8800, Japan) operated in
the transmittance mode in 4000400cm1 region. The structural
features of the scaffolds were assessed by X-ray diffraction (XRD)
study (Rigaku Ultima-IV, Japan) and the data was collected in a
2 range of 1070 with 5 per min scanning rate. The topogra-phy of the scaffoldwasanalysedby atomic forcemicroscope (AFM,
NTEGRE (NTMDT)) operated in semi-contact mode. The contact
angle of thenanofibrous scaffolds (11 cm2) was measured using
K100MK3 tensiometer (Kruss GmbH, Hamburg, Germany) operat-
ing at 6mm/min detection speed and 3mm/minmeasuring speed.
Threespecimenswereusedfor singlesetofscaffoldandtheaverage
result was reported. The water uptake capacity was measured by
immersing small pieces (22 cm2) of pre-weighed dried nanofi-
brous scaffolds in PBS at room temperature. After particular time
interval specimenwas removed andthenweighed.By dividing the
difference in weight before and after the swelling by the origi-
nal specimen weight, we obtained the equilibrium water uptake
percentage of the scaffolds.
2.8. Mechanical characterization
Universaltestingmachine (Instron3369,Bioplus,USA)wasused
to determine the tensile strength of the SFC nanofibrous scaffolds
both in dry and wet conditions. The scaffolds were cut into small
rectangular shapes (3050.050.01mm3) andloaded between
the clamps of thetensile tester. Tensile testingwasperformedwith
acrossheadspeedof5mm/min.Formeasurementinwetcondition,
the samples loadedbetween theclamps were immersed in bioplus
bath filled with 3 l SBF maintained at 371 C. The value reported
is theaverage ofmeasurement takenwith three specimens.
2.9. In vitro evaluation of the SFC nanofibrous scaffolds by cell
culture
2.9.1. hMSCs seeding and culture
The umbilical cord blood derived hMSCs were cultured in our
laboratory in completemedia (DMEMsupplementedwith 10% FBS
and 1% antibiotic solution) (Bissoyi, Pramanik, Panda & Sarangi,
2014). The cells weremaintained at 37C in 5% CO2incubator and
the culture medium was refreshed every 2days till the cell den-
sityreached 8090% confluence. Diskshaped scaffold specimensof
6mmin diameterwere sterilized in75%ethanol overnight and then
extensively rinsedwith PBS. The scaffoldswere then incubated for
overnight in complete medium in 24-well plate and hMSCs (105
cells/cm2) were seeded on the scaffolds after 24h of incubation.
Thecell seededscaffoldswere incubatedat 37C for 46h toallow
cell adhesion. After the cell attachment, the cell seeded nanofi-brous scaffolds were cultured for two weeks in osteogenic media
(complete media,which additionally supplementedwith 5mM-glycerol phosphate, 50mg/ml ascorbic acid-2-phosphateand1nM
dexamethasone) at 37 C in humidified atmosphere containing 5%
CO2.
2.9.2. hMSCs morphology, attachment, viability, metabolic
activities and distribution
The qualitative and quantitative assessment of morphology,
attachment, viability and proliferation of hMSCs seeded on each
of the prepared nanofibrous scaffolds were monitored during
714days of culture under FESEM and confocal microscope. For
FESEM study, the cultured cell-seeded scaffolds were fixed with
2.5% glutaraldehyde for 20min and dehydrated consecutively for
5min using gradient ethanol concentrations (30%, 50%, 70%, 90%
and 100% (v/v) in water). After drying at room temperature,
the scaffolds were coated with gold and observed under FESEM
(Biswas, Pramanik & Jonnalagadda, 2014). Morphological and cel-
lular attachment assessment was done by confocal microscopy.
The seeded scaffolds were first fixed with 4% paraformaldehyde
for 30min and incubated in 3% BSA for another 30min. The fixed
specimens were then permeabilized using 0.1% Triton X-100 for
5min and again incubatedwith Alexa-Fluor 488 conjugated phal-
loidin at room temperature for 15min in dark condition. After
rinsing with PBS and stainingwithDAPI for 15min, the specimens
weremounted over the glass slides and the images were taken by
Leica TCS SP5 X Super continuum Confocal Microscope (Bissoyi,
Pramanik, Panda & Sarangi, 2014).
Cell viability and distribution of viable cells in the scaffolds
werealsoevaluatedby thesameconfocalmicroscopic analysis.The
seeded scaffoldswere incubated in two molecular probes, namely
calcein AM and EthD-1 staining solution, simultaneously in dark
for 30min and then observed under the microscope to determine
the presence and distribution of live (green) and dead (red) cells
throughout the scaffolds. The quantitative estimation of cell via-
bility on cell seeded scaffolds (104 cells/cm2) was done by MTT
assay on3rd, 7th and 14thday of culture using a standardprotocol
(Ghasemi-Mobarakeh et al., 2008). After 3, 7, and 14days the cul-ture medium(complete media)was removed, rinsed in 100l PBSand100l of MTTsolution (0.5mg/ml)wasadded toeachwell (96wells plate) and incubated for 4h at 37C in 5% CO2. After incuba-
tion, MTT solution was replaced with 100l of DMSO and finallytheabsorbancewasmeasuredat490nmusingUVvisspectropho-
tometer (Double beamspectrophotometer 2203, Systronics).
2.9.3. Osteogenic differentiation
Theosteogenic differentiationactivityof hMSCs (104 cells/cm2)
seededon the SFCnanofibrous scaffoldsandcultured inosteogenic
media were quantitatively estimated bymeasuring alkaline phos-
phatase (ALP)secretion by the culturedhMSCsusingpNPP solution
as the reaction substrate for ALP. 50l of Lysis solution (0.5%
TritonX-100) and subsequently, 200l of 1mg/ml p-NPP solutionwere added to each well and incubated for 1.5h at 37 C. The
absorbance was later measured at 405nm after 7, 14 and 21days
using UVvis spectrophotometer (Double beam spectrophotome-
ter 2203, Systronics).
The cell-seeded scaffolds were cultured in osteogenic media
andanalysed qualitatively andquantitatively for theexpression of
RUNX2 transcription factor and osteocalcin differentiation mark-
ers by immunocytochemistry. The scaffolds were fixed with 4%
paraformaldehyde for 15min and rinsed well in PBS, followed by
permeabilizationwith0.5%TritonX-100 for5minat room temper-
ature. The permeabilized scaffolds were rinsed with 1X PBS and
incubated for 30min at RT in 3% BSA solution. After blocking the
non-specific sites, each specimen was separately incubated with
anti-RUNX2 antibody and anti-osteocalcin for 1h at RT followedby thoroughwashing.FITC-conjugated secondaryantibody(1:200)
was then added to it and incubated for 30min. Counter staining
with DAPI was performed for 510min after washing in 1X PBS
and imagewas taken by confocalmicroscopy.
Moreover, the RUNX2 transcription factor, osteocalcin and
type1 collagen (Col1) gene expressions of the hMSCs (105
cells/cm2) seeded on the SF and SFC nanofibrous scaffolds were
quantitatively evaluated in real time quantitative polymerase
chain reaction (RT-PCR). After two weeks of culture in osteogenic
medium, cell-scaffold construct was immersed in TRIzol and
homogenised by vortexing to isolate RNA. These isolated RNAs
were converted to cDNA using High-capacity cDNA Reverse Tran-
scriptionKit according to themanufacturers instructions. A SYBER
Green RT-PCR kit was used for quantitative estimation of gene
-
7/25/2019 Carboxymethyl Cellulose Enables Silk Fibroin Nanofibrous Scaffold With Enhanced Biomimetic Potential for Bone Ti
4/13
338 B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347
Table 1
Primer sequencesused for quantitative RT-PCR gene expression analysis.
genes 53 primers
Runx2 Forward GTCTCACTGCCTCCCTTCTG
Reverse CACACATCTCCTCCCTTCTG
Osteocalcin Forward GTGACGAGTTGGCTGACC
Reverse TGGAGAGGAGCAGAACTGG
Type 1collagen Forward GACCTCTCTCCTCTGAAACC
Reverse AACTGCTTTGTGCTTTGGG
B-actin Forward TTCCAGTCCTTCCTGReverse GCCCGACTCGTCATACTC
expression. The2ct relative quantification methodwas used for
the estimation of gene expression. Therelativeexpressions of each
gene were normalized against Ct value of thehouse-keeping gene.
The selected primer sequence for the gene of interest and house-
keeping gene are shown in Table 1.
2.9.4. Biomineralization of hMSCs seeded on SFC nanofibrous
scaffolds and calcium quantification
Theformationofmineralizednoduleson thecell-seedednanofi-
brous scaffolds cultured in osteogenic media were analysed and
confirmed by FESEM analysis and alizarin red assay. FESEM and
EDX analysis were performed following the protocol as describedin 2.5.2. Alizarin red S stain (ARS) solution was prepared by dis-
solving 0.5g ARS in 25ml MiliQ water and pH of the solutionwas
adjusted to 4.1-4.3 by adding 10% NH4OH. The cell-seeded scaf-
folds werefirst fixedwith2.5%glutaraldehyde for 2h and 1mlARS
solution was then added to each well. The specimens were then
incubatedat 37 Cfor1handlaterwashedinMiliQwatertoremove
excess dye adsorbed on the scaffold surface. Biomineralization of
hMSCs on the SFC nanofibrous scaffolds were qualitatively eval-
uated by examining the intensity of the red colour developed on
the scaffold surface by using inverted phase contrast microscope
(Axiovert 40 CFL) at 20X magnification. The degree of biomin-
eralization was estimated through calcium quantification which
involved the aspiration of ARS stain by specimen incubation with
500l of cetylpyridinium chloride (CPC) for 1h and recording theabsorbance at 550 nm(Gregory, Gunn, Peister & Prockop, 2004)
using UVvis spectrophotometer (Double beam spectrophotome-
ter 2203, Systronics).
2.10. Statistical analysis
The experiments were done in triplicate, and data were pre-
sented as meanSD. Statistical significance was determined by
single way ANOVA. p Value less than 0.05was considered as sig-
nificant.
3. Results and discussion
3.1. In vitro mineralization of SFC nanofibers
3.1.1. Rheological and microstructural analysis
The rheological behaviour of pure SF andvarious SF/CMCblend
solutionswas studied by viscometer measurement. Fig. 1C shows
that the pure SF solution exhibits shear thickening behaviour at
lower shear rate followed by shear thinning behaviour at higher
shear rate. The SF/CMC (99/1w/w) blend solution also exhibited
similar trend as SF solution whereas SF/CMC (98/2w/w) solution
showedfaster shear thickeningat lower shear rateandslowershear
thinningbehaviour at highershear rate. Thus, SF andSF/CMC(99/1
and 98/2w/w) solutions show similar behaviour of shear thick-
ening and shear thinning as of natural silk dope (Holland, Terry,
Porter & Vollrath, 2006). The polymeric chains of SF/CMC solution
was organised either parallel or entangled due to suppression of
repulsive forcesbetween thenegative charges of polymeric chains
at low pH of formic acid (Lu et al., 2011; Zhang et al., 2012; Zhu,
Zhang, Shao & Hu, 2008). This resulted in increased viscosity and
shearthickeningbehaviour at lowershear rateofSF/CMCsolutions.
Whereas, as the concentration of CMC increased (>2wt%) shear
thickening started early with lower shear rate followed by early
shear thinning after reaching maximum shear viscosities. Thus
SF/CMC solutions with increased CMCcontent (>2wt%), exhibited
higher shear thinning behaviour at lower shear rate due to the
strong interaction between SF and CMC, which leads to increasing
thesolutioninertiaandhinders theelectrospinning (Zhou,Chu,Wu
&Wu,2011).
Themicrostructures of SF, SFC1 and SFC2 scaffolds, both before
and after the mineralization, are presented in Fig. 1 where the
FESEM images show the irregular distribution of nanofibers in
the form of non-woven mats. The SFC3 blend failed to produce
nanofibers because the solution was highly viscous owing to the
increasedCMCcontent in it.Prior tomineralization, the nanofibers
hadsmoothersurfaces and their fiber diameterwasincreasedwith
CMC addition as shown in Fig. 1AC. Majority of nanofibers are
within 100300nm diameter range, where pure SF exhibits an
average diameter of 146.638.3nm, whereas SFC1A and SFC2B
displaying a linear increment of average diameters 183.782nm
and 227.887nm respectively. This increase in fiber diameter isfavourable for cell adhesion as it is similar to thebiomimetic archi-
tecture of human body where by the diameter of collagen fibers
of natural extracellular matrix (ECM) are in 50500nm diameter
range(Fratzl, Gupta, Paschalis &Roschger,2004). After invitromin-
eralization, thefiber surfaceswere observed tobe rough indicating
the nucleation of Ca/P crystals on the scaffold. The surface of pure
SF nanofibers and SF1 (Fig. 1B-a,b) was hardly rough suggesting
itsmarginal biomineralizingability (random andweak) in forming
Ca/P crystals. However, SFC1 and SFC2 (Fig. 1EF) demonstrated
highernucleation siteswith uniformandspherical Ca/P crystal for-
mations of sizes100nm. Fig. 1D illustrate in situ mineralization
of SF/CMC nanofibrous scaffold. Fig. 1D illustrates the in situmin-
eralization of SF/CMC nanofibrous scaffold. The mineralization of
the nanofibers can be attributed to the formation of free hydroxylgroups/carboxyl groups during the electrospinning of SFC blends
in formic acid (derivatizing solvent for CMC) contributing to the
increased number of Ca2+ ion nucleation sites on the nanofibers.
After that,PO43 ions from surroundingSBF solutionwasadsorbed
by calcium ion and that resulted in the formation of nanosized
Ca/P crystals in SBF (1X) solutions (Heinze &Heinze, 1997; Salama,
Abou-Zeid, El-Sakhawy & El-Gendy, 2015). The gradual increase
in CMC composition augments the free hydroxyl groups/carboxyl
groups content and thus SFC2 exhibits thehighest mineralization.
The biomineralization of electrospun SF/CMC based nanofibrous
scaffold shows a controlled nucleation of Ca-P crystal.Whereas in
case of scaffold coatedwithCMC,most of the Ca2+ nucleation sites
may exposed to SBF thereby uncontrolled mineralization of scaf-
fold occurs. Furthermore in electrospinning under high shear rate(in range of 104 1/s) polymeric chainsof SF and CMC get entangled
or parallelly aligned (Agarwal, Burgard,Greiner &Wendorff, 2016)
Because ofwhichCMCwaswell distributedover the surface aswell
as within the fiber this has led to the exposure of Ca2+ nucleation
sites on the scaffold surface in controlled manner. The controlled
mineralization of matrix provides superior osteogenic differenti-
ation of hMSCs in comparison to the matrix with uncontrolled
biomineralization. The scaffolds completely covered with Ca-P or
hydroxyapatite by uncontrolledmineralizationare detrimental for
hMSCs (Rungsiyanont, Dhanesuan, Swasdison & Kasugai, 2011).
In some of the study on hydroxyethyl cellulose nanofiber it has
been observed that complete electrospunmatwas covered by Ca-
P mineral within 24h of soaking period in SBF solution, which
further reduces the pore size thereby may prevents cell penetra-
-
7/25/2019 Carboxymethyl Cellulose Enables Silk Fibroin Nanofibrous Scaffold With Enhanced Biomimetic Potential for Bone Ti
5/13
B.N. Singh et al./ Carbohydrate Polymers 151 (2016) 335347 339
Fig. 1. (A) FESEM images of electrospunSF, SFC1A and SFC2B (a, c). (B) FESEM images of SF, SF1, SFC1 and SFC2 after SBF treatment for 7days(a, d). (C) Change in viscosity
ofthe SF andSF/CMC solution at differentconcentrations. (D)Illustrationof in situ mineralization of SF/CMCcomposite nanofibrous scaffold.
tion within the scaffold (Chahal, Hussain, Kumar, Yusoff & Rasad,
2015). Thus too low or too muchmineralization is not favourable
forhumanbone tissueregeneration. However pore size and poros-
ity within nanofibrous scaffold can be further improved either by
using a direct-write 60W laser at standard room condition or by
using porogenslikeNaCl,which enablesnanofibrousscaffoldswith
improved stem cells recruitment or penetration property(Ki et al.,
2008; Rodrguez, Sundberg, Gatenholm & Renneckar, 2014). Also
celluloseandbacterial cellulosearerich in carboxylategroups(salt
form of the acid) which provide higher negatively charged sur-
face and may be not suitable for cell attachment. Whereas in case
of SF/CMC nanofiber, surface of the fibers were rich in positively
charged aminegroup (-NH3+) present in SF favour the cells attach-
ment and proliferation.
3.1.2. Structural and functional property
XRDdiffractogram of the scaffolds representing their chemical
structures and phases are shown in Fig. 2A, where the diffraction
patterns show minor variation among the scaffolds. The peaks at
20.8 (2) and 24.3 (2) (Fig. 2A-a) indicate the silk II conforma-tion (Um, Kweon, Park & Hudson, 2001) contributing to superior
stabilityandmechanical properties of thenanofibers. Aweak peak
at27.6 (2) indicatesthe silk I structure(Ha,Park&Hudson, 2003;Singh, Panda& Pramanik,2016; Um,Kweon, Park &Hudson, 2001).
Moreover, the diffractogram clearly suggest the change in crys-
tallinity of the SF scaffolds with gradual addition of CMC and this
phenomenon possibly due to the interactions between the amide
groupsof SFandthehydroxyl/carboxylgroups ofCMCchains.After
7daysof SBFtreatment,X-raydiffractogram(Fig.2A-b)depictsCa/P
bone like apatite formation over the scaffolds, where SFC2 shows
prominent peak at 2 equal to 31.8, 45.52, 56.37 and 66.36 in
-
7/25/2019 Carboxymethyl Cellulose Enables Silk Fibroin Nanofibrous Scaffold With Enhanced Biomimetic Potential for Bone Ti
6/13
340 B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347
Fig. 2. (A)XRD spectrum of SF,SFC1AandSFC2B beforeSBF treatment(a). XRDspectrumof SF,SF1, SFC1 andSFC2 after incubation in SBFfor a week (b). (B)FT-IRspectrum
ofSF, SFC1A and SFC2B beforeincubationin SBF (a) and (b) after incubation in SBF for 7days. (C) AFM images of (a) SF1 and (b) SFC2 after treatment in SBF for 7days.
closeproximitywithreferencespectrumforhydroxyapatite (Sigma
Aldrich) as compared to others. Thus it has been confirmed that,
SFC2 promoteshighermineralizationas comparedto SFC1 and SF1,
whereas SF shows minimal level of mineralization. This confirms
our hypothesis that the addition of CMC canenhance themineral-
ization property, which was further investigated by FT-IR analysis
withmineralised nanofibrous scaffold.
The characteristics functional groups in SF, SFC1A and SFC2Bare represented by FTIR spectra as shown in Fig. 2B-a. The ran-
domcoil conformations of pure SF correspond to the characteristic
peaks at1640cm1 (amide I),1527cm1 (amide II)and 1241 cm1
(amideIII), thepeaksshiftto 1627cm1, 1519cm1 and 1236 cm1
respectively after cross-linking with EDC/NHS (Chen, Chen & Lai,
2012). The peak at 1627cm1 and 1519cm1 inSFC2B(Fig. 2B-b)
became intensified, which indicates the ability of CMC in facilitat-
ing the conformational transition from random coils to -sheetsby formingadditional intermolecular hydrogenbondsbetween the
carboxylgroups ofCMCand amidegroupsofSF.However, the peak
intensified and narrowed at 1236cm1 in SFC2B is attributed to
the overlapping of amide III band with the acetyl ester band of
CMC (Ritcharoen, Supaphol & Pavasant, 2008). The FT-IR peak at
1060cm1 isdue to>CH O-CH2stretchingofCMC(Itagaki,Tokai&
Kondo, 1997). After in vitromineralization the scaffoldswerechar-
acterizedby FT-IRto assesstheirmineralizationability.Asobserved
in FT-IR spectra (Fig. 2B-b) the Ca/P deposition on the scaffolds is
reflected by the characteristicpeak at 1062cm1 correspondingto
the P-O asymmetric stretching mode of vibration of PO43 group
(Stan, 2009; Varma & Babu, 2005). The P-O stretching mode has
been observed at 1012cm1 and 976cm1 corresponds to majorband for phosphate group. The peaks observed at about 610 cm1
and568cm1 areduetoO-P-O bendingandstretching respectively
(Greish & Brown, 2001; Varma & Babu, 2005). The absorbed CO2corresponding to 14001450cm1 peak indicates the deposition
of carbonatedCa/P on the nanofibers. Since thecharacteristicpeak
for deposited Ca/P was observed much more prominent in SFC2
(Fig.2B-b)in comparison toother scaffoldindicatingthatCMCplays
significant role in the improvement of biomineralizationof nanofi-
brous scaffold. Most of the peaks observed with SFC2 showmore
peakbroadening incomparison toSF1withtime, thatindicatesthat
SFC2supportssuperiormineralization andintramolecular bonding
with developedCa/P (Pramanik,Mishra, Banerjee,Maiti, Bhargava
& Pramanik, 2009).
-
7/25/2019 Carboxymethyl Cellulose Enables Silk Fibroin Nanofibrous Scaffold With Enhanced Biomimetic Potential for Bone Ti
7/13
B.N. Singh et al./ Carbohydrate Polymers 151 (2016) 335347 341
Fig. 3. (A) Load vs Extension curve for SF and SFC2B scaffolds in dry and wet condition. (B) Distribution of tensile strength and tensile strength at break of SF and SFC2B
scaffold. (C) Swelling behaviour at differenttime interval observed with SF andSFC2B in PBS solution. (D)Variation of contact anglemeasured with SF andSFC2B scaffolds
representing the superior hydrophilic property of SFC2B.
The structure and surface morphology of SF1 and SFC2 scaf-
folds after biomineralization were examined by AFM analysis.We
observed enhanced Ca/P deposition and improved surface rough-
ness of SFC2 than that observed with of SF1, as revealed by the
AFM images (Fig. 2C). As indicated in Fig. 2C, SF1 showed smoothsurface with average surface roughness of 0.247mwhereas SFC2showedaverageroughnessof0.322m.Thegrowthof Ca/Pcrystalsover SFC2 improves its surface roughness and thus, it can promote
cell adhesion, proliferation and differentiation (El-Ghannamet al.,
2004).
3.2. Mechanical properties
The ultimate tensile strength (UTS) of SF and SFC2B nanofi-
brous scaffolds are depicted in Fig. 3A, wherein dry state, the
UTS was measured as 12.71.5MPa and 10.541.3MPa and
the corresponding values in wet state were 3.820.7MPa and
3.460.6MPa respectively. A minute variation in UTS observed
with both the scaffolds in wet state suggests that the addition ofCMC can improvemineralizationwithoutmuchaffectingmechan-
ical property.Even, inwetstate, the tensile strainat breakofSFC2 B
was measured to be 18.373.8%, whichwasquite higher than the
pure SF scaffold (8.363.3%). The corresponding increase in ten-
sile strainwithadditionof a small amountof CMCis118%.Thus the
2% CMC addition to SF may improve the cell retention ability and
increase the number of cell penetration inside the scaffold during
cell-seeding.
3.3. Hydrophilicity and swelling behaviour
Thecelladhesion,proliferationandtissue integrationare greatly
influencedby the hydrophilicity of thescaffolds(Altankov& Groth,
1994). Table 2 shows mean contact angle measurements of the
scaffolds, where the mean advancing contact angle (MACA) and
mean receding contact angles (MRCA) (a measure of wettability
and de-wettability) of SFC2B is lower than pure SF scaffold rep-
resenting the higher hydrophilicity of the composite scaffold. This
phenomenon is also corroborated from Fig. 3D where the reced-ing contact angles for SFC2B attained 0 after certain time period,
whereasthemeasuredvalue isaround30 forSF scaffold.Themean
contactanglehysteresisplaysanimportant rolein theintrusionand
extrusionof bodyfluids throughthe scaffolds. Thiswill furtheraug-
mentthecelladhesionpropertyofSFC2Bscaffoldsincomparisonto
pureSFastheoptimumcontact angleof thesurface forcelladhesion
is reported in the range between 55 and 75 (Groth & Altankov,
1996). The increase in hysteresis of SFC2B in comparison to pure
SF scaffold indicates an increased in surface roughness or chemical
in-homogeneityalong thecontactline.Moreover,thewateruptake
(Fig. 3C) determined for SFC2B lying in the range of 361%417%
in comparison to 180%270% for SF, also suggests higher water
uptake capacity of nutrients into the interior of the SFC2B scaf-
fold and thereby an enhanced the cell migration andproliferationare achieved in this region. Thus the addition of a small amount
of CMC improves the hydrophilic property of SF based nanofibrous
scaffolds, thus facilitates biofluid transport, cellmigration, preven-
tion from dehydration, exudates accumulation across the wound
and maintenance of microenvironment and pH (Agrawal & Ray,
2001; Zahedi, Rezaeian, Ranaei-Siadat, Jafari & Supaphol, 2010).
Table 2
Mean contact anglemeasurement of SF andSFC2B nanofibrous scaffolds.
Scaffolds MACA [] MRCA [] Hysteresis []
SF 64.2 4.2 36.9 3.8 26.6 3.0
SF/CMC2 57.4 0.3 18.5 1.8 38.9 3.2
-
7/25/2019 Carboxymethyl Cellulose Enables Silk Fibroin Nanofibrous Scaffold With Enhanced Biomimetic Potential for Bone Ti
8/13
342 B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347
Fig. 4. FESEM images of MSCs on gelatin (A), SF (B) and SFC2 (C) after 12h of culture. FESEM micrographs of cells cultured on gelatin (D), SF (E) and SFC2 (F) after 7days.
FESEM images of cells cultured on gelatin (G), SF (H) and SFC2 (I) on day 14. (J) MTT assay ofMSCs cultured on gelatin, SF and SFC2. (K) Alkaline phosphatase (ALP) activity
in MSCs on gelatin, SF and SFC2 in an osteogenic culture mediumovertime(n =3).
3.4. Adhesion, proliferation and distribution of hMSCs on SFC
scaffolds
The bioactivity of the pure SF and SFC2 composite nanofibrous
scaffoldswas evaluatedby examining cellularattachment,viability
andproliferationof hMSCsculturedon thescaffolds. Apositivecon-
trol was taken by culturing hMSCs on gelatin nanofiber. As can be
seen from theFESEMimages(Fig.4AC), thehMSCsattachedto the
scaffoldsattainedamoreor less elliptical shapeafter12h ofculture
thereby demonstrating their initial signs of spreading. The aspect
ratio for gelatin (2.230.46) and silk fibroin (2.080.04) scaf-
folds arecomparable whereas a lower aspect ratio of 1.7250.091
was shown by SFC2 scaffold. After 7days (Fig. 4DF), most cells
appeared elongated and spindle like in morphology and a strong
cell attachment to the scaffold was evident from filopodia pro-
trusions from cell surface. On 14th day (Fig. 4GI), the cells were
observedto beproliferatedandformationofamonolayerlike struc-
turewas occurred over the surface of the scaffold.
Thecell viabilitywas quantitativelyestimatedduring 14daysof
culture byMTTassay. As can be seen fromFig. 4J, that onday 3 the
optical density (OD) measured with MSCs seeded SFC2 is higher
than pure SF and gelatin (p
-
7/25/2019 Carboxymethyl Cellulose Enables Silk Fibroin Nanofibrous Scaffold With Enhanced Biomimetic Potential for Bone Ti
9/13
B.N. Singh et al./ Carbohydrate Polymers 151 (2016) 335347 343
Fig. 5. CalceinAM andEthD-1 staining ofMSCs cultured for7 days onGelatin (A), SF (E)and SFC2 (I). Green signals indicate viablecells andred signalfor dead cells.3D laser
scanning confocal imageswere observedwhile live/deadstaining(Z stacks) ofMSCs cultured for7 days (B,F andJ) on gelatin, SF andSFC2.Cell proliferation anddistribution
are visualized by confocal microscopy on Gelatin (C), SF (G) andSFC2 (K)after culture for7 days, whereas Gelatin (D), SF (H) andSFC2 (L) after culture for 14days.Nuclei of
the cells were stained with DAPI (blue)and actin filamentswith phalloidin (green) (for interpretation of thereferences to colour in this figure legend, thereader is referred
to thewebversion of this article).
ilar trendswithmore aggregated cellswith extra cellular secretory
substances and lack of cell boundaries (interconnected cells)were
noticed on day14.Thecell viabilityestimation of proliferatedcells
over nanofibrous scaffoldsshows the trendof proliferation follows
as SFC2> SF> gelatin.
Thepenetration andproliferation of hMSCswithinthe scaffolds
weredeterminedfromthe 3D-Z-stack images composedbyarrang-ing all Z-sections developed during the scanning of cell-seeded
scaffoldsunder the confocalmicroscope. The images (Fig. 5B,F and
J) indicate that cells were proliferated well over the scaffolds but
withvaryingdepthofpenetrationofhMSCs colonization. Thehigh-
estpenetrationoccurredin gelatinupto 35-40mandcomparableintensity of cell penetration up to 3035m was shown by SFC2scaffoldwhileSFshowsthe lowestpenetrationdepthof 1520m.Allthese takentogether, it hasbeen observedthatSFC2nanofibrous
scaffold has the superior cellular activity than the other scaffold
developed under study. The improved hydrophilicity, higher ten-
sile strain (in wet state) and swelling property of SFC2, along with
its higher standard deviation in fiber diameter in comparison to
pure SF, contribute to increased penetration and proliferation of
hMSCs towards the interior of the scaffold withoutmuch affecting
cell attachment andproliferation on the surface.
3.5. Osteogenic differentiation
The osteogenic differentiation of hMSCs on Gelatin, pure SF
and SFC2 composite nanofibrous scaffoldswere determined qual-itatively and quantitatively through a series of biochemical and
microscopic investigations. The characteristic marker of early
osteoblastic differentiation is attributed to the cellular secre-
tion of ALP. ALP enzymes catalyse the hydrolysis of extracellular
pyrophosphates and increase the local concentration of inorganic
phosphates which facilitate biomineralization (Allori, Sailon &
Warren, 2008). The ALP activity (Fig. 4K) for all scaffolds reached
themaximum by day 14 indicating the osteogenic differentiation
ofhMSCs. Ascompared toGelatin and SF,hMSCsshowsignificantly
higher ALP activities on SFC2 on 14thday (p< 0.05). Hence, SFC2 is
confirmed to provide a better supportive platform for osteogenic
differentiation of cells. Further validation of osteogenic differen-
tiation was carried out by estimating RUNX2 transcription factor,
osteocalcin and type1 collagen expression by the cells. The hMSCs
-
7/25/2019 Carboxymethyl Cellulose Enables Silk Fibroin Nanofibrous Scaffold With Enhanced Biomimetic Potential for Bone Ti
10/13
344 B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347
Fig. 6. Immunocytochemistry for RunX2 and osteocalcin on MSCs cultured on scaffolds. (A) Confocal images showing RunX2 expressions of MSCs on day 7 and day 14 (B)
Confocal images for osteocalcin expressions were observed in MSCs on day 7 and day 14 in the osteogenic culture medium. Integrated density evaluation for RunX2 and
osteocalcinwere shownin graphs(C) and(D) respectively. Scale bar= 25m. Alizarin Red S stainingassayfor quantitative evaluationof MSCsmineralizationon nanofibrousscaffoldsafter 14daysof culture (E).The osteoblastic differentiationof MSCson nanofibrous scaffoldswas assessedby measuringthemRNAexpression of Runx2,osteocalcin
and type1 collagen (F).
seeded on the nanofibrous scaffolds tend to aggregate and form
committedosteoprogenitor cells.Withtime, theydifferentiate into
pre-osteoblasts, early osteoblasts and mature osteoblasts. RUNX2
is thekey regulator for early osteoblastic differentiationof hMSCs.
It binds specific DNA sequences and regulates the transcription
of various genes to orchestrate the osteogenic differentiation. The
immunocytochemistry for RUNX2 transcription factor expression
inhMSCson the three scaffolds atday7 (Fig.6A)andday14(Fig.6B)
is presented through the confocal images. As co-localization of
Runx2 and DAPI immunostainning shows that the expression of
Runx2waslocalized to thecell nuclei. From Integrated density (ID)
evaluation itwasobserved that the expression of RunX2 transcrip-
tion factor at higher level on day 7 (Fig. 6C) as compared to day
14. RUNX2 is pro-terminal marker of osteogenesis and its level of
-
7/25/2019 Carboxymethyl Cellulose Enables Silk Fibroin Nanofibrous Scaffold With Enhanced Biomimetic Potential for Bone Ti
11/13
B.N. Singh et al./ Carbohydrate Polymers 151 (2016) 335347 345
Fig. 7. Alizarin red S staining of Gelatin, SFand SFC2 culturedfor day 7 and day 14. FESEM imagesand EDX spectra ofmineral depositionof SFand SFC2 cultured for 7days.
expression onSFC2was the highest onday7 andthendecreasedby
day14as osteogenesis enhancedthereby,exhibiting theadvantageof using SFC2 composite scaffolds. The osteocalcin expression is a
late stagemarker for osteogenic cell differentiationand the confo-
cal images revealed that hMSCs demonstrate the highest level of
osteocalcin expression on SFC2 on 14th day. Moreover, the inte-
grated density quantification of osteocalcin (Fig. 6D) confirms that
the SFC2 showssignificantly (p< 0.05) higher level of expression in
comparisonto otherscaffoldsatday7 andday14.Onday14,RT-PCR
analysis shows significantly (p< 0.05) higher level of expression of
OCNandCol1onSFC2thanSF(Fig.6F),whereasadecreaseinRunx2
expression was observed on SFC2 on day 14 (Fig. 6F) with no sig-
nificant difference at this point. Since osteocalcin is an abundant
calcium binding protein and adsorbs Ca/P, SFC2 facilitates higher
degree of Ca/P nucleation sites and growth over the nanofibrous
structure and cause the activation of calcium sensing receptor sig-nallingleadingtoa higherlevelof osteocalcinexpression inhMSCs.
3.6. Biomineralization of hMSCs seeded nanofibrous scaffold
The mineralization and formation of bioactive Ca/P like nod-
ule structure throughout the surface of nanofibrous scaffold was
our prime target to provide time dependent improved osteogenic
environment for cultured hMSCs. In comperission to SF, the uni-
form distribution of Ca/P over SFC2 nanofibrous scaffold surface
may promote better cell growth and differentiation as bone tis-
sues exhibit orderly distributionof Ca/P over nanofibrous collagen
matrix(Akao, Sakatsume, Aoki, Takagi & Sasaki, 1993; Liu, Smith,
Hu & Ma, 2009). As can be seen from the FESEM images (Fig. 7B),
the degree of biomineralization on day 7 is higher on SFC2 than
on SF. Further EDX analysis further showed that hMSCs on pure SFformed a mineral phase with Ca/P ratio: 0.81.2 whereas on SFC2,
the Ca/P ratio was 1.41.5 which is similar to the mineral phase of
the bone that consists mostly of Ca and P in the ratio 1.41.7(Lai,
Shalumon& Chen,2015). Thequantificationof ECMmineralization
wasperformed throughARSwhere it bindswith calciumandforms
ARS-calcium complex in a chelation process. It can be observed
from the inverted phase contrastmicroscopic images (Fig. 7A) that
on day 7; the ARS-calcium complex (red colour) covered a greater
percentage of SFC2 than the other twoscaffolds. However, on 14th
dayof culture allscaffolds hadhigherformation of the ARS-calcium
complex than that onday7 butheretoo, the intensitywas thehigh-
est in case of SFC2. Also SFC2, on day 14 (Fig. 6E), showed greater
OD as compared to gelatin and SF (p< 0.05). This suggests that the
degree of ECM mineralization depends both on culture durationandthe scaffoldmaterial.The analysisof EDX and alizarinred assay
results demonstrate its ability to mimic the osteogenic environ-
ment and hence found substantial superiority of SFC2 nanofibrous
scaffold for bone tissue engineering application.
4. Conclusion
Thisis thefirst reportonthedevelopmentof electrospunnanofi-
brous SF/CMC composite materials with significant improvement
in physicochemical, mechanical and biological properties in com-
parison to the gelatin and pure SF nanofibrous scaffolds. SFC2 has
shown enhanced cell attachment and proliferation and strongly
assisted the differentiation of the attached hMSCs as evidenced
-
7/25/2019 Carboxymethyl Cellulose Enables Silk Fibroin Nanofibrous Scaffold With Enhanced Biomimetic Potential for Bone Ti
12/13
http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0235http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0230http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0225http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0220http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0215http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0210http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0205http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0200http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0195http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0190http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0185http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0185http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0185http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0185http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0185http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0185http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0185http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0185http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0185http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0185http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0185http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0185http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0180http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0175http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0170http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0165http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0160http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0155http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0155http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0155http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0155http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0155http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0155http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0155http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0155http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0155http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0155http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0155http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0155http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0150http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0145http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0140http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0135http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0130http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0125http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0120http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0115http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0110http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0105http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0100http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0095http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0090http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0085http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0080http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0075http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0075http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0075http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0075http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0075http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0075http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0075http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0075http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0075http://refhub.elsevier.com/S0144-8617(16)30622-1/sbref0075http://refhub.elsevier.com/S0144-8617(16)30622-1/sbre
top related