blood, blood spatter and dna ch. 7 and 8
Post on 24-Feb-2016
116 Views
Preview:
DESCRIPTION
TRANSCRIPT
Blood, Blood spatter and DNACh. 7 and 8
Forensic blood videoBlood spatter video
Dexter- 2 3 4 5 6 *
Science of Murder- blood *
Blood typing
If blood is found at the scene of a crime, it can be tested for blood type. This may narrow down suspects
– Cheaper, easier, and faster than DNA testing , which provides individual evidence
Blood spatter
A spatter pattern can give information about the truthfulness of an account by a witness or a suspect
It also can provide information about the origin of the blood, the angle and velocity of impact and type of weapon used
Composition of Blood
Whole blood has cells and plasma (fluid with hormones, clotting factors and nutrients)
Red blood cells carry oxygen to the body’s cells and CO2 away
White blood cells fight disease and foreign invaders
Platelets aid in blood clotting
What is blood typing?
Antibodies are proteins secreted by white blood cells that attach to antigens to destroy them (defense machanism)
Antigens are foreign molecules that react to antibodies (causes agglutination or clumping) In this case, antigens are carbohydrate tags on red blood
cells that are read by your immune system If your immune system recognizes them, everything is
fine If your immune system sees them as foreign, it attacks!
A person with type A blood has A antigens on the surface of their red blood cells.
A-type individuals do not make antibodies against A antigens.
A-type individuals make antibodies against B antigens
If a person with Type A blood receives a Type B transfusion, the anti-B antibodies will bind the B antigens
Donor cells are destroyed by complement-mediated lysis
Can lead to jaundice and kidney damage DeathTherefore, they can only receive A or O blood
A person with type B blood has B antigens on the surface of their red blood cells.
B-type individuals do not make antibodies against B antigens.
B-type individuals make antibodies against A antigens
Can only receive B or O blood
A person with type AB blood has A and B antigens on the surface of their red blood cells.
AB-type individuals do not make antibodies against A or B antigens.
Can receive A, B, AB, or O blood– Called the universal recipient
A person with type O blood has no antigens on the surface of their red blood cells.
O-type make antibodies against A and B antigens
Can only receive other O blood, but can donate to all other blood types
– Known as the universal donor
Type Percent
A 39B 12AB 4O 45
What is Rh factor? Rh Factor is another antigen present on RBCs – it’s where the +/- of your blood type comes from – named after the Rhesus Monkey (where they were
first discovered) Can cause problems with transfusions – Rh negative people can’t receive positive blood (get
an antigenic reaction- destruction of cells) Also get similar reaction when Rh-negative
mother is carrying an Rh-positive fetus
If the sample clots, then the antibodies are binding, so the antigen must be present
– If Anti-A makes it clot, A is present –>A (AB) – If Anti-B makes it clot, B is present –>B (AB) – If both Anti-A and Anti-B samples clot, Both antigens
are present –> AB – If neither Anti-A or Anti-B makes it clot, neither
antigen is present –> O – If Anti-Rh makes it clot, Rh factor is present -> +
Human Blood TestingBlood Compatibility
Is that Blood
Luminol Presumptive test
● The first step in an investigation.● Seen on most CSI TV shows as the blue
glowing light test. ● Presumptive Test: Possibility that it is blood
or it is not blood. ● It uses luminol, a peroxide and a base.
Presumption Blood Testing(using the kastel-meyer video)
Kastel-Meyer Blood Test It will not prove that a sample is definitely blood, it
simply supports the idea that the sample could be blood Kastel-meyer is used because of ease of use, doesn’t
destroy DNA and is very sensitive (can detect 1 drop in 10,000 drops), positive test results in easily seen color change due to presence of hemoglobin
Uses alcohol, phenophthalein (special prep- not the kind used in acid/base testing) hydrogen peroxide.
It undergoes a oxidation-reduction reaction Look for no color change with the addition of alcohol
and phenophtalein and blue color with hydrogen peroxide
Blood Spatter (dexter explain)(blood spatter interpretation)
• Splatter is the sound a liquid makes when it comes in contact with an object
• Spatter is the pattern blood makes on an object
Blood spatter
The pattern can help to reconstruct the events surrounding a shooting, stabbing or beating
Can determine: Direction blood traveledAngle of impactPoint of origin of the blood Velocity of the blood Manner of death
Common Bloodstain Patterns
Walking Drip Pattern Wipes Swipes Transfer Stains Arterial Spurts (vertical & horizontal) Cast-off Spatter
When blood falls from a height or at a high velocity, it can overcome its natural cohesiveness and form satellite droplets
When it falls onto a less-than-smooth surface, it can form spiking patterns around the drops
Directionality
The shape of an individual drop of blood provides clues to the direction from where it originated
Shapes
www.deviantcrimes.com/bloodspatter.htmGun
Hammer
http://www.clt.uwa.edu.au/__data/page/112508/fsb05.pdf
Low Velocity - This type of spatter is usually caused by an impact to the blood source at a rate of 5 feet per second and is usually about 4 millimeters in diameter.
(victim walking) Medium Velocity - This type of spatter is usually caused by
an impact to the blood source at a rate of 5-100 feet per second. Stains caused by this type of force are usually 1-3 millimeters in diameter, but may be larger or smaller. (bat-stab)
High Velocity - This type of spatter is usually caused by an impact to the blood source in excess of 100 feet per second and is usually less than 1 millimeter in diameter, although it can be larger or smaller.
(gun)
Angle of Impact http://www.bloodspatter.com/BPATutorial.htm
Creating Reference Bloodstain Patterns
http://bloody2.com/diameter.aspx
Blood spatter video
Dexter- 2 3 4 5 6
Science of Murder- blood
DNA Fingerprinting
A more modern and popular approach, DNA fingerprinting can be very conclusive
Alec JefferysDNA evidence
DNA can be isolated from many sources:
Blood Semen Saliva Hair Skin cells Bone Teeth Tissue Urine Feces
Vomit Condoms Hat bands Bras Cigarette Butts Chewing gum Envelopes Drinking Cups Under victim’s fingernails
Running DNA Video
Death, drugs, driving and DNA: Forensic Potpourri (you tube or Research Channel)
PCR (Polymerase Chain Reaction) is used to make a small amount of DNA (like you’d find at the SOC) into a large amount for testing
Restriction enzymes are used to cut the DNA into fragments at specific sites
Gel Electrophoresis is used to separate the fragments into a pattern called a fingerprint
These fingerprints can be matched to fingerprints from DNA isolated from suspects (usually by mouth swab)
DNA STRAND:
CTGGCTAGGCTACCATGCCCGTAAATEveryone has unique DNA except twins
Restriction Enzyme
We will use TA-ase, an imaginary enyzme, to
cut our DNA Sample DNA strand CTGGCTAGGCTACCATGCCCGTAAATCTGGCTA GGCTA CCATGCCCGTA
AAT
Electrophoresis
Separates fragments by sizeLargest fragment travels least
Gel electrophoresis separates the resulting fragments by size
– the largest fragment moves the slowest through the gel so it stays up at the top
And we get a fingerprint that looks something like this:
Fingerprints can then be compared to decide which DNA is which
OJ crimes of the century (DNA)
http://www.biology.arizona.edu/human_bio/problem_sets/DNA_forensics_2/DNA_forensics.html
http://www.biologycorner.com/bio4/notes/DNA_fingerprint.php
http://www.dnai.org/index.htm
top related