bactrocera dorsalis (diptera: tephritidae) mazarin akami · 1 1 host fruit as a suitable bacteria...
Post on 20-Oct-2020
5 Views
Preview:
TRANSCRIPT
-
1
Host fruit as a suitable bacteria growth substrate that promotes larval development 1
of Bactrocera dorsalis (Diptera: Tephritidae) 2
Mazarin Akami1,2,3
, Xueming Ren1, Yaohui Wang
1, Abdelaziz Mansour
1,4, Shuai Cao
1, 3
Xuewei Qi1, Albert Ngakou
3 and Chang-Ying Niu
1* 4
Authors’ Affiliations 5
1Department of Plant Protection, College of Plant Science & Technology, Huazhong 6
Agricultural University, Wuhan 430070, China 7
2Department of Plant Protection, Institute of Vegetables and Flowers, Chinese Academy 8
of Agricultural Sciences, Beijing, China, 9
3Department of Biological Sciences, Faculty of Science, University of Ngaoundere, P.O 10
Box 454 Ngaoundere, Cameroon 11
4Department of Economic Entomology and Pesticides, Faculty of Agriculture, Cairo 12
University, 12613 Giza, Egypt 13
14
15
16
17
*Authors for correspondence: CYN, niuchangying88@163.com 18
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
2
Abstract 19
The ability of a host plant to act as a substrate or media for larval development may 20
depend on how good it is at offering suitable nutrients for bacterial growth. In this study, 21
we hypothesized that the suitability of a fruit type for fruit fly larval development is 22
positively correlated with the ability of that fruit to act as a substrate/media for fruit fly 23
symbiotic bacterial growth. We allowed a single female fruit fly to lay eggs on five 24
different host fruits, then we monitored the larval development parameters across five 25
generations and analyzed the bacterial community structure of larvae developing in 2 of 26
these hosts (apple and banana) at the first and fifth generations. Results indicate that the 27
larval length and dry weight did not vary significantly across experimental generations, 28
but were greatly affected by fruit types and larval stages. The larval development time 29
was extended considerably in apple and tomato but shortened in banana and mango. 30
There was a significant shift in bacterial community structure and composition across 31
fruits and generations. The bacterial community of larvae within the same fruit (apple and 32
banana) clustered and was similar to the parental female (with the predominance of 33
Proteobacteria), but there was a shift at the fifth generation (dominance of Firmicutes). 34
Banana offered a suitable better development and growth to larvae and bacteria, 35
respectively, compared to apple in which reduced larval development and bacterial 36
growth were recorded. Although additional experiments are needed to adequately show 37
that the differences in microbiome seen in fruit fly larval guts are the actual driver of 38
different developmental outcomes of larvae on the different fruits, at the very least, our 39
study has provided intriguing data suggesting interaction between the diets and gut 40
microbial communities on insect development. 41
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
3
Key words: Bactrocera dorsalis, Host use, Foraging choice, Gut microbiome, Larval 42
development. 43
Importance and Significance of the study 44
Tephritid fruit flies entertain complex interactions with gut bacteria. These bacteria are 45
known to provide nutritional benefits to their hosts, by supplementing missing nutrients 46
from the host diets and regulating energy balance. Foraging for food is a risky exercise 47
for the insect which is exposed to ecological adversities, including predators. Therefore, 48
making beneficial choice among available food substrates is a question of survival for the 49
flies and bacteria as well. Our study demonstrates interactions between the host fly and 50
its intestinal bacteria in sustaining the larval development while foraging optimally on 51
different fruit types. These findings add a novel step into our understanding of the 52
interactions between the gut microbial communities and B. dorsalis and provide avenues 53
for developing control strategies to limit the devastative incidence of the fly. 54
55
Introduction 56
Gut bacteria and fruit flies are thought to have a close evolutionary and biological 57
relationships with a wide degree of interdependence [1-3]. This interaction shapes the 58
host fitness and the abundance of gut microbiota [2], and is modulated by the availability 59
and nutritional quality of host fruits. Different fruit differ in their suitability for fruit fly 60
larvae. If fruit fly larvae gain many of their primary nutritional needs from bacterial 61
break-down products, then maybe the quality of fruit for fruit fly larvae depends on how 62
good the host is for bacterial growth and survival, with the fruit’s value to fruit fly larvae 63
being of secondary importance. 64
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
4
Some tropical fruits such as banana and apple have been shown to contain a good 65
amount of pectin intensively used as food additive [4-6]. Pectin from fruit has been 66
reported to be involved in defense mechanisms against external aggressions and plant 67
pathogens [7]. In addition, fruits are generally low in protein content. The larvae of the 68
oriental fruit fly Bactrocera dorsalis require a large amount of sugar and nitrogen content 69
diet for their growth [8]. In order to develop in nutritionally poor fruits, gut bacteria may 70
come into play in supplying missing sugar metabolites and marginal amino acid residues 71
from the various fruit types to sustain the larval development [9,10]. 72
The ability of gut bacteria to modify the diet composition [11] and host 73
transcriptome [12] allows aphids to survive on plants with poor nutrient values [13], 74
allows the higher termites Nasutitermes takasagoensis to digest cellulose from wood 75
[14], Bombyx mori to degrade pectin from mulberry leaves [15] and Anoplophora 76
glabripennis to feed on multiple hosts by disrupting the expression levels of numerous 77
genes involved in digestion and detoxification [12]. Insects are exposed to several 78
ecological adversities (predators and abiotic factors) and the gut bacterial isolates were 79
conjected to help B. dorsalis to making beneficial compromises between the feeding 80
time, nutrient ingestion and fitness [16,17]. These ecological compromises (nutritional 81
tradeoffs) result in differences in B. dorsalis gut microbiome, whose community structure 82
and diversity vary or shift from one fruit to the other in response to the nutritional 83
adaptation, not only for the host but also for the gut microbiotas. In this event, B. dorsalis 84
may rely on its gut-associated bacteria for fitness and survival, which in turn may shape 85
the foraging of the host according to their nutritional requirements [16,17]. 86
In this study, we evaluated the extent of the interactions between the diets and the 87
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
5
microbial communities on larval development. We predicted that the suitability of a fruit 88
type for fruit fly larval development is positively correlated with the ability of that fruit to 89
act as a substrate/media for fruit fly symbiotic bacterial growth. The method consisted of 90
allowing a single female fly to lay eggs on five different fruit types for 24h and 91
monitoring the larval population dynamics across five generations. At each generation, 92
the larval development parameters (length, weight and development time) were evaluated 93
within and between fruit types. We thus presumed that larval development parameters 94
would be highly enhanced in fruits, thus offering optimal nutrients for development [18]. 95
Data generated from this study allowed us to conject that the gut microbiome can shift its 96
population in response to nutritional adaptations of fly larvae. 97
Materials and methods 98
Insect rearing and maintenance 99
All experiments were conducted in a controlled environment (25±1.5°C, 65±10% 100
RH and 16:8 light: dark cycle). Newly emerged lab-reared flies were fed artificial full 101
diet consisting of Tryptone (25 g/L), Yeast extract (90 g/L), Sucrose (120 g/L), Agar 102
powder (7.5 g/L), Methyl-p-hydroxybenzoate (4 g/L), Cholesterol (2.3 g/L), Choline 103
chloride (1.8 g/L), Ascorbic acid (5.5 g/L) in 1 L of distilled water . 104
Host fruits preparation 105
Ripe fruits (mango, banana, apple, citrus, and tomato) were bought from a local 106
supermarket (Wuhan, China) and surface sterilized by soaking them in 2% sodium 107
hypochlorite for 20 minutes and rinsed with deionized distilled water. The sterilized fruits 108
were air dried under a laminar flow hood to avoid airborne contamination. Five of each 109
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
6
type of fruit were needed for the bioassays (therefore the total number of fruit were 5 x 5 110
= 25), and five replicates were used for each fruit type (125 fruits in total). 111
Bioassays 112
One mating couple (11-15 day-old) was extracted from the rearing cage and 113
introduced into a new cage (15x15x15cm). The different fruits were separately added into 114
the cage in which the single female was allowed to lay eggs for 24 hours before replacing 115
the fruit with another one. The process was repeated for the five fruit types (Fig 1). 116
To determine how bacteria and fruit type affect larval development, the larval 117
developmental parameters were monitored in all fruit types following the oviposition, 118
starting from the parental female. Fruits bearing eggs were incubated individually in 1L 119
transparent plastic cups and sealed with a fine mesh (25±1.5°C, 65±10% RH and 16:8 120
light: dark cycle). Eggs and developing larvae were extracted periodically from each fruit 121
type at 3, 6 and 9 days (corresponding to the 1st, 2nd, and 3rd instar larvae). The body 122
length of the extracted larvae (to the nearest 0.03 mm), the larval dry weight and 123
developmental time were measured before the larvae were anesthetized in cold 95% 124
ethanol. All Larvae (15) were kept in 95% ethanol and were either used immediately or 125
preserved at −80°C until used for further analyses (measurement of larval length, dry 126
weight and microbiome analyses). The remaining larvae from each fruit were allowed to 127
develop till adult emergence. The adults that emerged were maintained under artificial 128
diet as described above till the flies reached sexual maturity. A single female from the 129
cohort of each fruit was allowed to lay eggs on new fruit to produce subsequent 130
generation and the process was repeated till five generations. 131
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
7
Microbial analyses 132
Genomic DNA extraction and amplicon generation 133
Total genome DNA from samples was extracted using the CTAB/SDS method 134
[19]. DNA quality was checked on 1% agarose gels using a ladder, and the purity was 135
checked as above. DNA was diluted to 1ng/µL with sterile distilled water. 136
The V1-V3 variable region of the bacterial 16S rDNA gene was amplified to construct a 137
gene library using bar-coded and broadly conserved primers for the PCR reaction: 138
27F_5′ CCTATCCCCTGTGTGCCTTGGCAGTCTCAGAGAGTTTGATCCTGGCTC139
AG-3′, and 533R_5′-140
CCATCTCATCCCTGCGTGTCTCCGACGACTNNNNNNNNTTACCGCGGCTGCT 141
GCAC -3′ [20]. This contains the A and B sequencing adaptors (454 Life Sciences) to 142
facilitate pooling, segregation, sequencing and amplification of ~536 bp region of the 143
mentioned gene (“Ns” represent the 8 nt barcode sequence for multiple samples while 144
the underlined sequences represent the A-adaptor). All PCR reactions were carried out 145
with Phusion® High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, 146
Ipswich, MA, USA) and high-fidelity polymerase (New England Biolabs). 147
The PCR conditions were as follows: initial denaturation at 94°C for 2 min, 148
followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 30 s, and 149
extension at 72°C for 1 min and a final extension step of 10 min at 72°C. PCRs of 150
DNA-free samples were run to check potential contamination of buffers and primers 151
[21]. PCR amplicons were later subjected to electrophoresis on a 2% agarose gel, 152
stained with ethidium bromide, and the targeted fragment size (400-450bp) was 153
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
8
extracted, purified with Qiagen Gel Extraction Kit (Qiagen, Germany) and quality 154
checked before pyrosequencing. Amplicon libraries were generated using TruSeq® 155
DNA PCR-Free Sample Preparation Kit (Illumina, USA) following the manufacturer's 156
recommendations and index codes were added. Library quality was assessed on the 157
Qubit@ 2.0 Fluorometer (Thermo Scientific) and Agilent Bioanalyzer 2100 system 158
using a DNA1000 lab chip (Agilent), respectively. The library was then amplified by 159
emulsion PCR before 454 pyrosequencing was performed from the A-end on an 160
Illumina HiSeq2500 platform using a GS FLX Titanium system according to the 161
manufacturer's instructions (Roche 454 Life Sciences) and 250 bp paired-end reads 162
were generated. 163
Bioinformatics analyses 164
Paired-end reads were assigned to samples based on their unique barcode and 165
truncated by cutting off the barcode and primer sequence. Paired-end reads were 166
merged using FLASH 1.2.7 [22]. Quality filtering on the raw tags was performed under 167
specific filtering conditions to obtain the high-quality clean tags [23] using QIIME1.7.0 168
[24] quality controlled process (Edgar et al. 2011). The tags were compared with the 169
reference database using UCHIME algorithm to detect and remove chimera sequences 170
before obtaining active tags [25]. 171
Operational taxonomic units (OTUs) analyses were performed by UPARSE 172
7.0.1001 [26]. Sequences with ≥97% similarity were assigned to the same OTUs. The 173
representative sequence for each OTU was screened for further annotation, and the 174
GreenGene Database [27] was used based on the Ribosomal Database Project (RDP) 175
classifier 2.2 algorithm [28] to annotate the taxonomic information. OTUs abundance 176
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
9
information was normalized using a standard of sequence number corresponding to the 177
sample with the least sequences. The Good's coverage, the abundance-based coverage 178
estimator (ACE), the bias-corrected Chao1 richness estimator, the jackknife estimator of 179
species richness, and the Shannon-Weaver and Simpson diversity indices, were 180
calculated with the Mothur package. 181
Statistical analyses 182
All data on developmental parameters (larval length, larval dry weight and 183
development time) were tested for homogeneity of variances using Levene’s tests. The 184
crucial factors that affect the developmental parameters were checked by using the 185
regression model (SPSS) with host fruits and experimental generations as effects. The 186
one-way analysis of variance (ANOVA) was used to analyze differences in 187
developmental data and sequencing data. New Duncan’s Multiple Range Test (NDMRT) 188
test at P = 0.05 significance, was used for mean separations within and between samples. 189
The results of sequencing parameters were presented as means of the three biological 190
replicates. Statistical analyses were carried out using SPSS 20.0 software (Statsoft Inc, 191
Carey, J, USA). OriginPro 8.5.1 software was used to construct graphs. We used the 192
Analysis of similarity (ANOSIM) to determine whether the differences of B. dorsalis 193
bacterial community between treatments (P, A1, A5, B1 & B5) are significantly higher 194
than those in the group and whether the grouping is meaningful. 195
Results 196
Larval development parameters 197
Larval length 198
The larval length and dry weight were not affected by the experimental 199
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
10
generations (Regression Model, F = 146.194; df = 4; R2 = 0.857; t = 5.013; P = 0.236 and 200
F = 257.234; df = 4; R2 = 0. 798; t = 7.835; P = 0.184, respectively, but were significantly 201
affected by fruit types and larval stages (Regression Model, F = 71.217; df = 4; R2 = 202
0.958; t = 1.464; P ˂ 0.0001 and F = 71.217; df = 2; R2 = 0.958; t = 1.464; P ˂ 0.0001, 203
respectively) (Fig 2 & 3). 204
The larval growth increased significantly across stages in all the experimental 205
fruits and generations (Regression Model, F = 116.643; df = 2, 4; R2 = 0.837; t = 7.322; P 206
˂ 0.0001) and the highest larval length recorded in Banana, peach and mango in 207
comparison to apple and tomato (ANOVA, F = 70.007; df = 4; P ˂ 0.0001 and F = 208
139.185; df = 4; P ˂ 0.001, respectively) (Fig 2). Except for tomato whose larval 209
development stopped at the first instar of the fifth generation, all the host fruits allowed 210
complete larval development up to the fifth generation (Fig 2). 211
Larval weight 212
The larval growth positively correlated with larval dry weight across generations 213
in all host fruits (R2 = 0. 978; P ˂ 0.0001) (Fig 3) and the two parameters were 214
proportional to each other. Moreover, a paired analysis of larval growth and dry weight 215
revealed a significant interaction between the two parameters in selecting the suitability 216
of host fruits by B. dorsalis (F = 40.074; df = 1, 4; R2 = 0.9984; P ˂ 0.0001) (Fig 3). 217
Developmental growth time of larvae 218
The larval development (length and weight) was inversely proportional to 219
developmental duration (time from oviposition to adult emergence). The higher the larval 220
length, the shorter the development time and vice versa. The larval development time was 221
significantly extended in apple and tomato (F = 78.384; df = 1, 4; P ˂ 0.001), but was 222
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
11
shortened in banana (F = 97.154; df = 4; P ˂ 0.0001) in comparison to peach and mango 223
(Table 1). 224
Gut microbial analyses 225
The diversity of operational taxonomic units (OTUs) 226
A total of 653,932 raw reads were generated from all samples: 38,467±6564 227
reads on average for each sample and 30,637 reads based on the minimum number of 228
trimmed sequences from each sample. The OTU composition varied and increased 229
significantly across host fruits and experimental generations compared to the parental fly. 230
Overall, 64 OTUs were detected in the original parent (P), 252 and 427 OTUs in Banana 231
at F1 and F5 generations (B1 & B5), respectively, and 421 and 1,059 in Apple at F1 and F5 232
generations (A1 & A5), respectively. The reads length average was 426±4 bp, and the 233
minimum and maximum number of sequence read per OTU were 201 bp and 503 bp, 234
respectively. Although the majority of OTUs from B5 were shared among other samples, 235
it contained the highest number of OTUs per sample. Only 27 core OTUs were detected 236
in all samples (Fig 4). 237
Bacterial richness and diversity 238
The community diversity (Shannon and Simpson) and richness (sobs, Chao, and 239
ace) evaluated at 97% similarity, showed different comparative trends in the prediction of 240
the number and diversity of OTUs from all samples. The Shannon diversity index 241
provides not only species richness (i.e., the number of species present) but how the 242
abundance of each species is distributed (the evenness of the species) among all the 243
species in the community. Here, we recorded significantly higher bacterial diversity 244
across generations in both tested fruits compared to the parental fly (P) (ANOVA, F = 4, 245
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
12
df = 11.173, P = 0.017) (Table 1). For example, the Shannon indices of banana were 246
0.22±0.26 and 2.5±0.13 at F1 and F5, respectively (t-test, P = 0.00017±0.0), while those 247
of apple were 1.17±0.23 and 2.5±0.13 at F1 and F5, respectively (t-test, P = 0.0118±0.02). 248
The comparison between fruits revealed higher bacterial community diversity in apple at 249
F1 (Shannon = 1.17±0.23) compared to banana at the same generation (Shannon = 250
0.22±0.26) (t-test, P = 0.0095) (Table 1). However, at F5, the community diversity was 251
similar in both fruits (t-test, P = 0.3782±0.38). 252
Rarefactions 253
The rarefaction is a computational analysis of species accumulation based on 254
the repeated re-sampling of all clusters. Based on the good coverage (>0.999) (Table 1), 255
almost all the 16S sequences have been annotated. Moreover, the flattening of the 256
rarefaction curves is an indication that the sampling depth was sufficient enough to detect 257
all OTUs from our samples and an additional sampling effort would only produce few 258
extra OTUs (Fig 5). 259
Bacterial community composition 260
The original bacterial community was represented by two phyla only: 261
Proteobacteria accounted for 95.67%, and Firmicutes accounted for 4.19%. The structure 262
of the vast majority of the gut bacterial community did not change at the first generation 263
(F1) of both host fruits, but there was an emergence of Bacteroidetes which was not 264
detected from the original community. At F1, Proteobacteria represented 96.04% and 265
99.08% in apple and banana, respectively, and Firmicutes represented 1.64% and
-
13
and 47.36% in apple and banana, respectively, in comparison with the to F1 and P, while 269
the populations of Firmicutes increased considerably at F5 (49.82% and 37.11% in apple 270
and banana, respectively). Also, Actinobacteria populations were detected in both fruits 271
(Fig 6). The heatmap showing the relative abundance of taxa in different samples and 272
groups on a certain taxonomic level can be found in Fig S9. 273
Twenty-one bacterial families in total were annotated from all samples, and the 274
number of families increased across generations. Enterobacteriaceae (91.75%) were the 275
most dominant families in the parental female (P), followed by Pseudomonadaceae 276
(3.81%) and Enterococcaceae (2.89%) in lesser proportions. At F1, Pseudomonadaceae 277
(67.31%) and Enterobacteriaceae (27.07%) were highly detected in apple while 278
Enterobacteriaceae (97.24%) was predominant in banana (Fig S1, Supplementary). At F5, 279
the bacterial families were more diversified in both fruits (12 and 17 in apple and banana, 280
respectively). For instance, Leuconostocacceae (22.66%), Streptococcaceae (19.38%) and 281
Acetobacteriaceae (17.64%) were detected in higher proportions in apple compared to F1, 282
while Enterobacteriaceae (27.62%), Bacillaceae (11.93%), Streptococcaceae (10.84%) 283
and Pseudomonadaceae (10.04%) were highly represented in banana compared to their 284
proportions at F1 (Fig S1, Supplementary). 285
At the genus level, Enterobacter (85.05%) was dominant in the parental female. 286
At F1, Pseudomonas (67.31%) and Enterobacter (26.68%) were highly represented in 287
apple while Morganella (96.82%) was the predominant genus in banana. However, at 288
F5, Lactococcus (19.12%), Fructobacillus (18.58%), Gluconobacter (16.99%) and 289
Morganella (22.23%) emerged abundant in apple, while Morganella (22.23%), Bacillus 290
(11.90%), Lactococcus (10.74%) and Pseudomonas (10.64%) were dominantly 291
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
14
represented in banana. Overall, in apple, Enterobacter proliferated significantly at F5 292
compared to Pseudomonas. However, in banana, Morganella was consistent across 293
generations (Fig S1, Supplementary). 294
Bacterial structure distribution 295
On the basis of Bray-Curtis distance algorithm, the gut bacterial community 296
structure varied significantly between host fruits and across generations in all samples 297
(Bray-Curtis distance statistics, A = 0.009014; P = 0.0012 & A = 0.000852; P = 0.01) (Fig 298
7. However, the clustering of different samples into groups indicates that the bacterial 299
communities within groups are highly similar (ANOSIM: R = 0.4259; P = 0.019) (Fig 7). 300
Discussion 301
Gut bacteria and fruit flies share close evolutionary relationships which mutually 302
influence the physiology and ecological adaptations of both parties. In this interaction, 303
the larval stages play a dominant role in the survival of the insect whose capacity to stand 304
across multiple generations depends on host suitability for larval growth sustained by its 305
gut microbiome. If fruit fly larvae gain many of their primary nutritional needs from 306
bacterial metabolic activity, then maybe the quality of fruit for fruit fly larvae depends on 307
how good it is for bacterial growth and larval development. 308
In this study, we assessed how host suitability might shape the larval performance 309
and gut bacterial growth over time. A single female fly was allowed to lay eggs on five 310
different host fruit types and we monitored the larval population dynamics across five 311
generations and bacterial community structure at first and fifth generations. 312
Host suitability for larval development 313
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
15
The larval development parameters (length, dry weight, and development duration) 314
increased across larval stages depending on the suitability of host fruits. The highest 315
larval performance was recorded in banana, mango, and peach, while larvae that 316
developed in apple and tomato had the shortest length and dry weight, and extended the 317
development duration across generations. Within the context of adaptive abilities of the 318
fly larvae, these results suggest that the host fruit quality (capacity to offer a readily 319
available source of nutrients) is a critical factor that determines the completion of larval 320
development and its propensity over time [29]. While the adult flies require a diet 321
consisting of protein and sugar for their maintenance, larvae must feed on high sugar 322
content diet for their growth and development [8,10]. Therefore, a suitable substrate for 323
larval growth should be able to offer the necessary carbohydrates to fuel the urgent 324
nutritional requirements of larvae. Larvae under continuous development in tomato did 325
not reach the second instar of their development at the fifth generation. The abortion of 326
larvae may partly be due to the high moisture content in the tomato flesh that led to the 327
drowning of the larvae, and death. In addition, the lack of sufficient sugar metabolites, 328
and free amino acids in tomato may be another cause of the abortion of the larvae over 329
time [30]. 330
Host suitability for bacterial growth 331
The gut microbiome plays a prominent role in the nutritional adaptations of insects 332
[18]. When the fly is found in a nutritionally imbalanced environment in terms of 333
nutrients availability, the metabolic activity of gut bacteria may constitute an additional 334
source of nutrients, for their ability to provide amino acids, carbohydrates, vitamins and 335
digestive enzymes to foster and reinforce the adaptive capacity of the host fly [18]. Many 336
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
16
previous studies have reported the importance of gut microbiota in host nutrition and 337
physiology [9,10,31-33], and the microbial community divergence at different life stages 338
and geographic areas have been established [8]. However, how the gut bacterial 339
community of larvae developing on different host fruits varies across generations to 340
maintain optimal larval development is not fully understood. 341
Here, we explored the bacterial community structure and composition of larvae 342
developing in banana (suitable substrate for larval growth and development) and in apple 343
(hostile substrate), highlighted the core bacteria in each fruit and evaluated the extent of 344
their variations across generations compared to the single parental community. Very 345
similar structure of bacterial communities was observed between the parental female and 346
the offspring of the first generation (F1), which was dominated by Proteobacteria (≥95%). 347
The Proteobacterial populations decreased significantly, and Firmicutes emerged as the 348
dominant taxa at F5. This could be understood at two scales. First, the similarity of 349
bacterial community structure at F1 with the parental fly (but different at F5) could imply 350
that the community structure changes over time to allow the larvae to adapt in an 351
environment with either no food available or less suitable food for their optimal growth. 352
Secondly, although originated from the same parent, the differences observed between 353
fruits at F5 may come at the cost of the different degree of suitability of the substrate and 354
the survival emergency in the long run. Therefore, Proteobacteria and Firmicutes 355
appeared as the driving forces of this behavior due to their prevalence and persistence 356
over time [8,34]. Similarly, the stability of these same bacterial phyla (Proteobacteria and 357
Firmicutes) were shown to be responsible for maintaining optimal larval development 358
across life stages of B. minax [29]. 359
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
17
Furthermore, when compared to the parental female, huge bacterial community diversity 360
and richness was recorded across fruits (higher in apple at F1 but similar in both fruits at 361
F5) and across generations (higher at F5 in comparison to F1). This finding puts to the 362
light the plasticity of gut bacteria which can amend its population to help the host 363
circumventing challenges linked to the fruit phenology and nutrient availability. As 364
shown above, banana and apple offered different larval development facilities. While 365
banana allowed the larvae to develop optimally and grow faster (due to their high sugar 366
content and vitamins), apple extended the larval development time and reduced the 367
measured development parameters. The quality of ingested food influences the structure 368
and composition of gut microbiota in insects, some bacterial taxa are advantaged and 369
increase in size while others are disfavored and maintain their population at the survival 370
threshold (Douglas, 2015). The higher bacterial diversity (with the abundance of the 371
family Pseudomonadaceae and the genera Pseudomonas) in apple at F1 could be an 372
indication that, at early generation, either the apple offered all the required nutrients for 373
bacterial normal growth, or these gut bacteria possess the ability to digest potential 374
recalcitrant dietary constituents from the fruit. Previously, symbiotic bacteria of the 375
genera Burkholderia and Parabacteroides were suggested to mediate the degradation of 376
hemicellulose and the recycling nitrogen in Melolontha hippocastani [35]. At F5, 377
Enterobacteriaceae (genus Enterobacter) became the most abundant bacterial community 378
in apple, while the same family Enterobacteriaceae (genus Morganella) persisted across 379
generations in banana. This suggests to some extent the dependence of the larvae upon 380
Enterobacteriaceae for their optimal development across generations. In this fashion, the 381
larvae can directly use the available resources from the fruits, or use the byproducts of 382
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
18
bacterial metabolic activities to compensate the lack of nutrients from their diet [36]. 383
Therefore, gut bacteria and the substrate suitability are crucial to maintaining a balanced 384
food web and the survival of the host across generations. 385
Overall, the variability of the gut bacterial community structure and composition in 386
response to different host fruits observed in this study could also be driven by, but not 387
limited to, the changes in the gut transcriptome that might have induced a regulation 388
mechanisms of genes linked to nutrition, growth and detoxification. However, additional 389
experimental steps are needed to provide support for such a conjecture. Such experiments 390
might, for example, include studies where flies developed on one type of fruit for many 391
generations on a particular fruit that gave smaller larvae would continue to show poorer 392
development when transferred to a different fruit. The use of axenic fruit and flies 393
represent another way forward to untangle these interactions. At the very least, our 394
findings add another layer of understanding on the various bacterial compromises that 395
enable B. dorsalis to feed in a broad range of host fruits. This may explain (but not 396
limited to) the invasive polyphagous state of the fly. 397
Conclusion 398
In this work, we evaluated how different host fruits can act as a suitable substrate 399
for larval development and gut bacterial growth. By allowing a single female fly to lay 400
eggs on different host fruit, we monitored the bacterial population with regards to the 401
parental ones and determined the patterns of their variations across five generations. The 402
results show that the development of larvae depends on the ability of fruits to offer a 403
suitable substrate or media for gut bacterial growth. As such, banana, mango and peach 404
allowed optimal larval development across generations while apple and tomato were less 405
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
19
suitable substrate for the larval growth. Overall, the bacterial community structure and 406
composition was similar at the early stage of the exposure to the fruits (with a 407
predominance of Proteobacteria), but the variations arose over time depending on how 408
suitable the substrate was at availing nutrients for the larvae. This study adds a new stair 409
of understanding of the effects of interactions between gut bacteria and the quality of 410
substrate (fruits) on B. dorsalis development. 411
412
Data accessibility 413
The metagenomic data are pending submission to sequence reads archive (SRA) of 414
GenBank. The project references will be provided as soon as possible. 415
Funding 416
This study was funded by the National Natural Science Foundation of China 417
(31661143045), International Atomic Energy Agency (CRP No. 17153 and No. 18269), 418
Agricultural public welfare industry research supported by Ministry of Agriculture of 419
People’s Republic of China (201503137) and the Fundamental Research Funds for the 420
Central Universities (2662015PY148). 421
Competing interests 422
The authors declare that they have no competing interests. 423
Author’s contribution 424
CYN conceived and designed the study. MA conducted the experiments and wrote the 425
first draft of the manuscript. AM, XR and YW analyzed metagenomics data. XQ and SC 426
helped in statistical analyses. AN edited and revised the manuscript. All authors read and 427
approved this submission. 428
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
20
Acknowledgements 429
Authors are grateful to two anonymous reviewers for their insightful comments on the 430
early version of this manuscript. 431
References 432
1. Engel P, Moran NA (2013) The gut microbiota of insects–diversity in structure and 433
function. FEMS Microbiology Reviews 37: 699-735. doi: 10.1111/1574-434
6976.12025 435
2. Gould AL, Zhang V, Lamberti L, Jones EW, Obadia B, Korasidis N, et al. (2018) 436
Microbiome interactions shape host fitness. Proceedings of the National Academy 437
of Sciences 115: E11951-E11960. doi: 438
3. Lauzon C, E. Potter S, J. Prokopy R (2003) Degradation and detoxification of the 439
dihydrochalcone Phloridzin by Enterobacter agglomerans, a bacterium associated 440
with the apple pest, Rhagoletis pomonella (Walsh) (Diptera: Tephritidae). 953-962 441
p.10.1603/0046-225X-32.5.953 442
4. Khamsucharit P, Laohaphatanalert K, Gavinlertvatana P, Sriroth K, Sangseethong K 443
(2018) Characterization of pectin extracted from banana peels of different 444
varieties. Food Science and Biotechnology 27: 623-629. doi: 445
5. Maneerat N, Tangsuphoom N, Nitithamyong A (2017) Effect of extraction condition on 446
properties of pectin from banana peels and its function as fat replacer in salad 447
cream. Journal of Food Science and Technology 54: 386-397. doi: 448
6. Virk BS, Sogi DS (2004) Extraction and characterization of pectin from apple (Malus 449
Pumila. Cv Amri) peel waste. International journal of food properties 7: 693-703. 450
doi: 451
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
21
7. Voragen AGJ, Coenen G-J, Verhoef RP, Schols HA (2009) Pectin, a versatile 452
polysaccharide present in plant cell walls. Structural Chemistry 20: 263. doi: 453
8. Zhao X, Zhang X, Chen Z, Wang Z, Lu Y, Cheng D (2018) The divergence in bacterial 454
components associated with Bactrocera dorsalis across developmental stages. 455
Frontiers in Microbiology 9. doi: 10.3389/fmicb.2018.00114 456
9. Ben-Yosef M, Pasternak Z, Jurkevitch E, Yuval B (2014) Symbiotic bacteria enable 457
olive flies (Bactrocera oleae) to exploit intractable sources of nitrogen. Journal of 458
Evolutionary Biology 27: 2695-2705. doi: 10.1111/jeb.12527 459
10. Ben-Yosef M, Pasternak Z, Jurkevitch E, Yuval B (2015) Symbiotic bacteria enable 460
olive fly larvae to overcome host defences. Royal Society Open Science 2: 461
150170. doi: 10.1098/rsos.150170 462
11. Bourtzis K, Miller TA (2003) Insect symbiosis. Boca Raton: CRC Press. 463
12. Scully ED, Geib SM, Mason CJ, Carlson JE, Tien M, Chen H-Y, et al. (2018) Host-464
plant induced changes in microbial community structure and midgut gene 465
expression in an invasive polyphage (Anoplophora glabripennis). Scientific 466
Reports 8: 9620. doi: 10.1038/s41598-018-27476-0 467
13. Douglas A (1998) Nutritional interactions in insect-microbial symbioses: aphids and 468
their symbiotic bacteria Buchnera. Annual review of entomology 43: 17-37. doi: 469
14. Tokuda G, Watanabe H, Matsumoto T, Noda H (1997) Cellulose digestion in the 470
wood-eating higher termite, Nasutitermes takasagoensis (Shiraki): distribution of 471
cellulases and properties of endo-β-1, 4-gIucanase. Zoological Science 14: 83-94. 472
doi: 10.2108/zsj.14.83 473
15. Prem Anand AA, Vennison SJ, Sankar SG, Gilwax Prabhu DI, Vasan PT, Raghuraman 474
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
22
T, et al. (2010) Isolation and characterization of bacteria from the gut of Bombyx 475
mori that degrade cellulose, xylan, pectin and starch and their impact on 476
digestion. Journal of Insect Science 10: 107. doi: 10.1673/031.010.10701 477
16. Akami M, Andongma AA, Zhengzhong C, Nan J, Khaeso K, Jurkevitch E, et al. 478
(2019) Intestinal bacteria modulate the foraging behavior of the oriental fruit fly 479
Bactrocera dorsalis (Diptera: Tephritidae). PLOS ONE 14: e0210109. doi: 480
10.1371/journal.pone.0210109 481
17. Akami M, Ren X-M, Qi X, Mansour A, Gao B, Cao S, et al. (2019) Symbiotic 482
bacteria motivate the foraging decision and promote fecundity and survival of 483
Bactrocera dorsalis (Diptera: Tephritidae). BMC Microbiology 19: 229. doi: 484
10.1186/s12866-019-1607-3 485
18. Douglas AE (2009) The microbial dimension in insect nutritional ecology. Functional 486
Ecology 23: 38-47. doi: 10.1111/j.1365-2435.2008.01442.x 487
19. William S, Feil H, Copeland A (2012) Bacterial genomic DNA isolation using CTAB. 488
Sigma 50: 6876. doi: 489
20. Andongma AA, Wan L, Dong YC, li P, Desneux N, White JA, et al. (2015) 490
Pyrosequencing reveals a shift in symbiotic bacteria populations across life stages 491
of Bactrocera dorsalis. Scientific Reports 5: 9470. doi: 10.1038/srep09470 492
21. Yun JH, Roh SW, Whon TW, Jung MJ, Kim MS, Park DS, et al. (2014) Insect gut 493
bacterial diversity determined by environmental habitat, diet, developmental 494
stage, and phylogeny of host. Applied and Environmental Microbiology 80: 5254-495
5264. doi: 10.1128/aem.01226-14 496
22. Magoč T, Salzberg SL (2011) FLASH: fast length adjustment of short reads to 497
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
23
improve genome assemblies. Bioinformatics 27: 2957-2963. doi: 498
10.1093/bioinformatics/btr507 499
23. Bokulich NA, Subramanian S, Faith JJ, Gevers D, Gordon JI, Knight R, et al. (2013) 500
Quality-filtering vastly improves diversity estimates from Illumina amplicon 501
sequencing. Nature methods 10: 57-59. doi: 10.1038/nmeth.2276 502
24. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et 503
al. (2010) QIIME allows analysis of high-throughput community sequencing data. 504
Nature methods 7: 335-336. doi: 10.1038/nmeth.f.303. 505
25. Haas BJ, Gevers D, Earl AM, Feldgarden M, Ward DV, Giannoukos G, et al. (2011) 506
Chimeric 16S rRNA sequence formation and detection in Sanger and 454-507
pyrosequenced PCR amplicons. Genome Research 21: 494-504. doi: 508
10.1101/gr.112730.110 509
26. Edgar RC (2013) UPARSE: highly accurate OTU sequences from microbial amplicon 510
reads. Nature Methods 10: 996. doi: 10.1038/nmeth.2604 511
27. DeSantis TZ, Hugenholtz P, Larsen N, Rojas M, Brodie EL, Keller K, et al. (2006) 512
Greengenes, a chimera-checked 16S rRNA gene database and workbench 513
compatible with ARB. Appl Environ Microbiol 72: 5069-5072. doi: 514
10.1128/aem.03006-05 515
28. Wang Q, Garrity GM, Tiedje JM, Cole JR (2007) Naive Bayesian classifier for rapid 516
assignment of rRNA sequences into the new bacterial taxonomy. Applied and 517
Environmental Microbiology 73: 5261-5267. doi: 10.1128/aem.00062-07 518
29. Yao Z, Ma Q, Cai Z, Raza MF, Bai S, Wang Y, et al. (2019) Similar shift patterns in 519
gut bacterial and fungal communities across the life stages of Bactrocera minax 520
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
24
larvae from two field populations. Frontiers in Microbiology 10: 2262. doi: 521
30. Bialczyk J, Lechowski Z, Dziga D, Molenda K (2005) Carbohydrate and free amino 522
acid contents in tomato plants grown in media with bicarbonate and nitrate or 523
ammonium. Acta Physiologiae Plantarum 27: 523-529. doi: 10.1007/s11738-005-524
0058-7 525
31. Andongma AA, Wan L, Dong X-p, Akami M, He J, Clarke AR, et al. (2018) The 526
impact of nutritional quality and gut bacteria on the fitness of Bactrocera minax 527
(Diptera: Tephritidae). Royal Society Open Science 5: 180237. doi: 528
10.1098/rsos.180237 529
32. Ben-Yosef M, Jurkevitch E, Yuval B (2008) Effect of bacteria on nutritional status 530
and reproductive success of the Mediterranean fruit fly Ceratitis capitata. 531
Physiological Entomology 33: 145-154. doi: 10.1111/j.1365-3032.2008.00617.x 532
33. Khaeso K, Andongma AA, Akami M, Souliyanonh B, Zhu J, Krutmuang P, et al. 533
(2017) Assessing the effects of gut bacteria manipulation on the development of 534
the oriental fruit fly, Bactrocera dorsalis (Diptera; Tephritidae). Symbiosis 74: 97-535
105. doi: 10.1007/s13199-017-0493-4 536
34. Aksoy E, Telleria EL, Echodu R, Wu Y, Okedi LM, Weiss BL, et al. (2014) Analysis 537
of multiple tsetse fly populations in Uganda reveals limited diversity and species-538
specific gut microbiota. Applied and Environmental Microbiology 80: 4301. doi: 539
10.1128/AEM.00079-14 540
35. Alonso-Pernas P, Bartram S, Arias-Cordero EM, Novoselov AL, Halty-deLeon L, 541
Shao Y, et al. (2017) In vivo isotopic labeling of symbiotic bacteria involved in 542
cellulose degradation and nitrogen recycling within the gut of the forest 543
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
25
cockchafer (Melolontha hippocastani). Frontiers in Microbiology 8: 1970. doi: 544
10.3389/fmicb.2017.01970 545
36. Panizzi AR, Parra JR (2012) Insect bioecology and nutrition for integrated pest 546
management: CRC press. 547
548
Figure captions 549
Figure 1 Experimental design. The highlighted ones are samples used for microbial 550
analyses. 551
Figure 2 Effect of host fruits suitability on B. dorsalis larval growth across five 552
generations. 553
Figure 3 Effect of host fruits suitability on B. dorsalis larval dry weight across five 554
generations 555
Figure 4 Venn diagram of OTU distribution of sample-specific and shared OTUs. The 556
different colored circles represent different samples or groups. The overlapped areas 557
represent common species among different samples or groups; non-overlapped areas 558
represent unique species in each sample or group. 559
Figure 5 Multiple samples rarefaction curves based on 16S rRNA genes sequencing. The 560
X-axis represents the number of randomly selected sequences; The Y-axis represents the 561
number of species (such as Sobs) or diversity indices (such as Shannon) of each sample. 562
Legends P: parental female; A1 & A5: Apple at first and fifth generations; B1 & B5: 563
Banana at first and fifth generations. 564
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
26
Figure 6 Bacterial community compositions at the phylum level as revealed by high 565
throughput sequencing. Different colored bars represent different species, and the length 566
of the column represents the proportion of the species. Legends: P: parental female; A1 & 567
A5: Apple at first and fifth generations; B1 & B5: Banana at first and fifth generations. 568
Figure 7 Principal Coordinates Analysis (PCoA) showing the variations of the gut 569
bacterial community of B. dorsalis as affected by time and host fruits. Note: The X and Y 570
axes represent two selected principal coordinate components. Legends: P: parental 571
female; A1 & A5: Apple at first and fifth generations; B1 & B5: Banana at first and fifth 572
generations. The percentage “%” indicates the contribution proportion of each principal 573
coordinate component to the sample composition variance. The scales on X-axis and Y-574
axis are relative distance with no practical significance. Different groups are marked in 575
different colors and shapes. Close samples have a similar community composition 576
structure. 577
578
Table captions 579
Table 1 Biological cycle duration of B. dorsalis (from first instar larvae to first instar 580
larvae) as affected by host fruit suitability 581
Table 2 Alpha diversity indices, showing the diversity and species richness of gut 582
symbionts of B. dorsalis as affected by host fruits and experimental generations. 583
584
585
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
27
586
587
588
589
590
591
592
593
List of tables 594
Table 1 Biological cycle duration of B. dorsalis (from first instar larvae to first instar 595
larvae) as affected by host fruit suitability 596
Host fruits Developmental duration (days)
F1 F2 F3 F4 F5
Banana 28±3c 27±1
c 28±2
c 27±3
c 27±3
c
Apple 36±4a 36±2
a 35±3
a 34±5
a 35±4
a
Peach 31±2b 30±2
b 31±2
b 29±3
b 30±2
b
Mango 30±2b 28±1
c 29±2
b 31±2
b 30±3
b
Tomato 33±3a 31±2
b 32±2
ab 30±3
b 31±2
b
Means followed by different letters in the same column and row are significantly 597
different according to ANOVA and LSD test (P < 0.05). 598
599
Table 2 Alpha diversity indices, showing the diversity and species richness of gut 600
symbionts of B. dorsalis as affected by host fruits and experimental generations. 601
Samples Sobs* Shannon Simpson ACE Chao1 Coverage
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
28
P 69e 1.2236
b 0.4126
b 262 133
d 0.99
A1 188±29c 1.17±0.23
b 0.51±0.01
b 204±21 202±25
c 0.99±0
A5 500±119a 2.86±0.63
a 0.24±0.07
c 525±127 534±128
a 0.99±0
B1 108±96d 0.22±0.26
c 0.94±0.08
a 182±70 150±93
d 0.99±0
B5 203±40b 2.5±0.13
a 0.18±0.05
c 210±40 210±38
b 0.99±0
P: parental female; A1 & A5: Apple at first and fifth generations; B1 & B5: Banana at 602
first and fifth generations. Different letters within columns are statistically different after 603
Student’s t-test at P < 0.05; (*): average number of species observed in each sample 604
(alpha diversity). 605
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
-
.CC-BY-NC 4.0 International licenseunder anot certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available
The copyright holder for this preprint (which wasthis version posted November 7, 2019. ; https://doi.org/10.1101/834119doi: bioRxiv preprint
https://doi.org/10.1101/834119http://creativecommons.org/licenses/by-nc/4.0/
top related