analysis of resistance in rice (oryza sativa l.) genotypes ... · summary – in this study we...
Post on 30-Jul-2019
221 Views
Preview:
TRANSCRIPT
Analysis of resistance in rice (Oryza sativa L.) genotypes LD24 and
Khao Pahk Maw to root-knot nematodes (Meloidogyne spp.) and root
lesion nematode (Pratylenchus zeae)
Radisras Nkurunziza
Student number: 01600780
Supervisor(s): Prof. Dr. Godelieve Ghyesen, MS Zobaida Lahari
A dissertation submitted to Ghent University in partial fulfilment of the requirements for the
degree of International Master of Science in Agro- and Environmental Nematology
Academic year: 2017 - 2018
Analysis of resistance in rice (Oryza sativa L.) genotypes LD24 and Khao Pahk
Maw to root-knot nematodes (Meloidogyne spp.) and root lesion nematode
(Pratylenchus zeae)
Radisras NKURUNZIZA 1,2
1, Department of Biology, Ghent University, B-9000 Ghent, Belgium
2 Department of Molecular Biotechnology, Ghent University, B-9000 Ghent, Belgium
* Corresponding author, e-mail: godelieve.gheysen@ugent.be
Summary – In this study we investigated resistance in Meloidogyne graminicola-resistant rice,
Oryza sativa genotypes LD24 and Khao Pahk Maw (KPM), and O. glaberrima genotype TOG5674
to M. javanica, M. incognita and Pratylenchus zeae alongside the model rice genotype Nipponbare.
Effects on penetration and post-infection development and reproduction were evaluated at different
time points to identify the stage at which resistance occurs. Our results indicate that genotype KPM
confers strong broad-spectrum resistance to M. javanica and P. zeae. Whereas TOG5674 showed
strong resistance to P. zeae, and moderate resistance to M. javanica, LD24 was moderately
resistant to M. javanica but susceptible to P. zeae. Resistance to M. incognita conferred by LD24,
KPM and TOG5674 could not be confirmed in this study due to the low infectivity of the nematode
population on the susceptible Nipponbare. Additionally, resistance to M. javanica and M. incognita
in LD24 and KPM was not linked to OsPAL4 gene expression profile. The decision on host status
was based on the consistency in the series of experimental results. M. javanica J2s equally
penetrated all genotypes at early time point, one day after inoculation. However, at three days after
inoculation, KPM and TOG5674 inhibited further penetration suggesting early defence responses.
Besides, genotypes LD24, KPM and TOG5674 but not Nipponbare suppressed development of M.
javanica suggesting that resistance responses in LD24 occur later than in KPM and TOG5674. All
genotypes inhibited penetration of M. incognita second-stage juveniles (J2s) but suppressed post-
infection development responses were observed in LD24, KPM and TOG5674 but not Nipponbare.
Penetration of P. zeae was non-significantly inhibited among genotypes, however, suppressed
reproduction was observed in KPM and TOG5674. LD24 and Nipponbare supported substantial P.
zeae reproduction demonstrating their susceptibility. In conclusion, it was evident that KPM
showed strong resistance to M. javanica and P. zeae indicating its potential for use in breeding
programs to introduce broad-spectrum resistance in high yielding and commercial O. sativa
cultivars.
Key words – Broad-spectrum resistance, Development, Meloidogyne graminicola, Penetration,
Phenylalanine ammonia lyase, Reproductive factor.
Rice (Oryza sativa) is an important cereal crop world-wide particularly in tropical and subtropical
regions where it plays nutritional and food security roles (Calpe, 2006; Seck et al., 2012). The
crop is grown in diverse agroecosystems such as lowland, upland and deep-water (Bridge et al.,
2005; Bouman et al., 2007; Conen et al., 2010). Although most of the rice has been produced from
irrigated and/or flooded lowland, due to the problem of water scarcity cultivation has shifted to
rain-fed lowland and upland rice production systems (Prasad, 2011). Rice (O. sativa) is highly
susceptible to plant parasitic nematodes. Root-knot nematodes (Meloidogyne spp.) and root lesion
nematodes (Pratylenchus spp.) cause substantial damage in non-flooded (dry) lowland and upland
rice systems (Bridge et al., 2005). Among the root-knot nematodes, M. graminicola, M. incognita
and M. javanica are important parasites of rice (Babatola, 1980; Diomandé, 1984; Bridge et al.,
2005; Kyndt et al., 2014). While M. graminicola is important both in flooded/irrigated and upland
systems, M. incognita and M. javanica are important in non-flooded lowland and upland systems
(Bridge et al., 2005; Kyndt et al., 2014). The root lesion nematode, Pratylenchus zeae also causes
substantial damage to rice in upland production systems (Fortuner & Merny, 1979; Babatola,
1984; Prot & Rahman, 1994; Bridge et al., 2005; Pili et al., 2016). Furthermore these nematodes
have a wide distribution and broad host range (Bridge et al., 2005). Consequently, inoculum levels
in the upland soil still remain high under rotation with other crops. Besides, reports on continuous
rice production under dry lowland or upland conditions have indicated yield decline due to
nematode infection (George et al., 2002; Peng et al., 2006; Kreye et al., 2009).
Under suitable conditions, Meloidogyne spp. infective second stage juveniles (J2) hatch from eggs
and orient towards the host root, and then penetrate the root just behind the tips by mechanical
wounding using their stylet and enzymatic dissolution of the root surfaces (Jones et al., 2013). The
J2s move intercellularly towards the root apex and make a U-turn into the central cylinder where
they select parenchyma cells and release secretions to induce feeding sites (Kyndt et al., 2014).
Each feeding site consists five to eight metabolically active and multinucleated cells, also called
giant cells enclosed in a gall (root-knot) (Cabasan et al., 2012; Nguyễn et al., 2014). These cells
function as specialized sinks to supply nutrients to the J2. After brief feeding, the J2 swell and
successively moult three times to reach the reproductive adult stage. The J3 and J4 stages lack a
functional stylet and do not feed. Males are only formed under unfavourable conditions; they are
non-feeding, vermiform and leave the root. The females start feeding and extract nutrients from
the giant cells for the rest of their life (Gheysen & Mitchum, 2011; Jones et al., 2013; Kyndt et al.,
2013). During feeding, the adult females enlarge and become pear-shaped, and lay eggs to start a
new reproductive cycle. Eggs are laid in clusters usually enclosed in a gelatinous matrix on the
surface of the root (M. incognita and M. javanica) or inside the gall (M. graminicola) (Karssen et
al., 2013). According to Bridge et al. (2005), the biology and life cycle of M. incognita and M.
javanica on rice are similar to those described on other hosts. Indeed M. incognita and M.
javanica showed the same optimal life cycles at temperatures between 27 oC and 30 oC (Trudgill,
1995).
In contrast to the sedentary behaviour of Meloidogyne spp., Pratylenchus zeae is a migratory root
endoparasite with hit and run feeding behaviour on cortical cells (Duncan et al., 2006). Like
Meloidogyne spp., P. zeae undergoes a typical lifecycle of six life stages such as egg, four juvenile
stages and adult stage (Castillo & Vovlas, 2007). After embryogenesis, the J1 develops inside the
egg, within which it moults to J2. Under suitable conditions, J2s hatch from eggs and locate the
host plant and penetrate at any site of the root (Kyndt et al., 2014). After penetration into the host
root, J2s start feeding on cortical cells and successively moult into J3, J4 and adult stages (Duncan
et al., 2006; Castillo & Vovlas, 2007). The J2, J3, J4 and adult all are migratory and can infect the
host root (Castillo & Vovlas, 2007). P. zeae feeds by puncturing the root cells and sucking the cell
contents resulting in a series of dead cells, which culminates into visible necrotic lesions. The
extent of tissue damage depends on the duration of feeding. Cell death occurs during migration
and prolonged feeding, but cell recovery may occur following brief feeding (Duncan et al., 2006).
The lifecycle of P. zeae takes about three weeks (21 days) at 30 oC (Olowe & Corbett, 1976). On
susceptible hosts, P. zeae causes retarded growth, reduced root size and lateral roots, reduced
number of tillers and panicles (Plowright et al., 1990).
Development and reproduction of these nematodes depends on host status. Susceptible hosts
support the highest level of development and reproduction while resistant hosts inhibit
development and reproduction (Trudgill, 1991). Plants deploy a complex network of constitutive
and inducible defence barriers to invading pathogens. Constitutive defences comprise many
preformed barriers including rigid cell walls and phytoanticipins which protect the plant from
pathogen penetration (Freeman & Beattie, 2008) thus conferring pre-infection resistance. In post-
infection resistance, plants are able to recognise and react to pathogens by activating a range of
defence responses (Gheysen & Jones, 2013) which are expressed and conditioned in a variety of
mechanisms (Starr et al., 2013). Inducible plant defence consists of two layers triggered by
microbial recognition (Jones & Dangl, 2006). The first layer triggered by pathogen associated
molecular patterns (PAMPs) is termed as PAMP-triggered immunity (PTI) and confers broad-
spectrum resistance (Chen & Ronald, 2011). The second layer, effector-triggered immunity (ETI)
is mediated by products of resistance genes which confer specific resistance (Cook, 1998).
Interactions between ETI and PTI result in production of secondary metabolites which play a role
in defence against plant-parasitic nematodes (Fujimoto et al., 2015; Ji et al., 2015; Kumari et al.,
2016). The phenylpropanoid pathway is an important secondary metabolic pathway in plants.
Phenylpropanoid metabolism produces constitutive and inducible compounds that function as
structural barrier (lignin), protectants (phytoanticipin and phytoalexins), toxins (coumarins) and
signalling (salicylic acid) molecules in plant defence against a spectrum of invaders (Weisshaar &
Jenkins, 1998; Vogt, 2010). Phenylpropanoid biosynthesis is controlled by phenylalanine
ammonia lyase (PAL), the first enzyme in the pathway that is encoded by multigene families in
plants (Reichert et al., 2009). In rice, the PAL genes are activated by an array of rice pathogens
during inducible plant immunity (Gupta et al., 2011; Li et al., 2013).
Options to control Meloidogyne spp. and Pratylenchus zeae in rice are limited due to drawbacks
associated with most chemical, biological, physical and cultural practices (Seid et al., 2015). Thus
host’s innate immunity provides the most feasible, eco-friendly and cheap method to control plant-
parasitic nematodes in rice. Lack of resistance to plant-parasitic nematodes in Asian rice (O.
sativa) has limited its genetic improvement (Diomandé, 1984; Plowright et al., 1999; Soriano et
al., 1999; Cabasan et al., 2015). Resistance was initially only found in African rice (O.
glaberrima). Efforts to improve nematode resistance through interspecific breeding between O.
sativa and O. glaberrima are usually hindered by challenges of sterility among F1 progenies
(Ghesquière et al., 1997). However, little success has resulted into fertile progenies by back
crossing with O. sativa parents (Jones et al., 1997; Cabasan et al., 2018). Some of these progenies
have demonstrated partial resistance to M. graminicola (Cabasan et al., 2018). Recent studies have
discovered resistant O. sativa cultivars, for instance LD24 and Khao Pahk Maw (Dimkpa et al.,
2015), Abhishek (Mhatre et al., 2017) and Zhonghua 11 (Thi Phan et al., 2017) with strong
resistance to the root-knot nematode M. graminicola. These findings provide a great potential for
improving nematode resistance in high yielding and commercial O. sativa cultivars. Cultivars
LD24 and Khao Pahk Maw have been crossed with an Italian rice cultivar (O. sativa cv. Vialone
nano) resulting in a progeny segregating for the resistance to M. graminicola (Lahari et al., in
preparation). However, understanding the underlying resistance mechanism in these cultivars is
necessary for successful and durable rice breeding programs. Additionally, investigating resistance
to other root-knot nematodes and root-lesion nematodes would provide insights on the broadness
of the resistance conferred by these rice genotypes.
Therefore the aim of this study was to investigate penetration and development or reproduction of
other root-knot nematodes such as M. javanica and M. incognita, and root-lesion nematode P.
zeae on genotypes LD24 and Khao Pahk Maw. Comparisons were made with a M. graminicola
resistant reference genotype TOG5674 (O. glaberrima) (Cabasan et al., 2012) and the susceptible
genotype Nipponbare (O. sativa) (Nguyễn et al., 2014).
Materials and methods
Rice genotypes and growth conditions
Four rice genotypes were used in this study. The genotypes LD 24 (O. sativa ssp. indica), KPM
(O. sativa ssp. aus), TOG5674 (O. glaberrima) are resistant to M. graminicola (Cabasan et al.,
2012; Dimkpa et al., 2015) while Nipponbare (O. sativa ssp. temperate japonica) is susceptible.
The seeds were germinated in petri dishes having moist tissue paper at 300C for 4 days. Then each
seedling was transplanted into a PVC tube containing sand and absorbent polymer (Reversat et al.,
1999). The plants were grown at 28 oC, 12/12 hours day/night regime at 70-75 % relative
humidity. Plants were fertilized with Hoagland’s nutrient solution by applying 10 ml per plant for
three times per week.
Nematode cultures
Two root-knot nematodes species (Meloidogyne incognita and Meloidogyne javanica) and one
root-lesion nematode (Pratylenchus zeae) were used in this study. The root-knot nematode
cultures were obtained from INRA, France. The cultures were separately multiplied and
maintained on susceptible tomato cv. Moneymaker in plastic pots containing soil. The P. zeae
culture was established from the population obtained from a rice field in Tanzania. The pure P.
zeae culture was obtained by inoculation of a single gravid female nematode on a carrot disc
(Kagoda et al., 2010) and then subcultured, multiplied and maintained on carrot discs in petri
dishes at 27 oC.
Infection experiments
For Meloidogyne spp., tomato roots infected with either M. incognita or M. javanica were
removed from pots and carefully washed with tap water. Egg masses from both species were
picked and placed onto 200 µm sieves separately. Additionally, the infected roots with galls were
cut into very small pieces and placed onto the 200 µm sieve having moist tissue paper. Both the
egg masses and cut roots were incubated for 72 hours at room temperature. The nematodes were
extracted using modified Baermann’s method (Coyne, 2007). Each 14-day old rice plant was
inoculated with approximately 200 J2s. Likewise for P. zeae, inoculum was collected from
cultures by washing nematodes from the carrot discs. The mixed vermiform stages were counted
and each 14-day old rice plant was inoculated with approximately 300 nematodes.
Penetration and development assays
The penetration and development or reproduction of both root-knot nematode species (M. javanica
and M. incognita), and root-lesion nematode (P. zeae) on rice genotypes Nipponbare, LD24, KPM
and TOG5674 were monitored by analysing the infected plants at different time points. For
penetration studies, infected root samples were collected at early time points, 1 and 3 days after
inoculation (DAI). Whereas to study nematode development or reproduction, samples were
collected at a later time point, 24 DAI. During sample collection at each time point, plants were
carefully removed from PVC tubes and root systems were gently washed with tap water. To
increase visibility of nematodes inside the roots, the infected root samples were stained in boiling
acid fuchsin solution for 3 minutes. The samples were later de-stained in acid glycerol (1 ml conc.
HCl : 1000 ml glycerol) for at least 14 days. Nematodes inside the roots were observed and
counted using a microscope (Leica Microsystems, Germany). For penetration assay, the number of
galls and the number of J2s per plant were counted at 1 and 3 DAI for both M. javanica and M.
incognita while for P. zeae total number of nematodes (J2, J3, J4 and adults) per plant were
counted. For development assay, the number of galls, juveniles (J3/J4), young females (without
egg masses) and egg-laying females were counted per plant for both root-knot nematode species at
24 DAI. Likewise, to assess reproduction of P. zeae, the total number of nematodes per plant was
counted and the reproductive factor was calculated from RF=Pf/Pi (Pf = final population, Pi =
initial population) (Pili et al., 2016).
Sample preparation for gene expression analysis
Gene expression analysis was conducted on the samples with root knot nematode infection (M.
javanica and M. incognita) on Nipponbare, LD24 and KPM genotypes. Four-day old seedlings
were transplanted in PVC tubes, each containing two seedlings. At fourteen days after
transplanting, each plant was inoculated with approximately 200 J2s of either nematode species.
Samples were collected at 3, 7, 14 and 21 DAI. At each time point, plants of respective genotypes
were separately removed from PVC tubes, carefully washed and the excess water was patted from
the root system using clean tissue paper. Non-infected plants were used as controls. Two
biological replicates comprising a pool of 6 root systems were considered per treatment at 3 DAI
and 4 plants at later time points. Samples were collected into RNAse free 5 ml Eppendorf tubes
and immediately frozen in liquid nitrogen and stored at -80 oC.
RNA extraction and cDNA synthesis
The frozen root samples were grinded to fine powder. The RNA was extracted using mercapto-
ethanol diluted with RLT buffer and RPE buffer following the protocol of the Qiagen RNeasy
mini kit (Qiagen, Germany). RNA concentration and purity were determined using a NanoDrop
2000 Spectrophotometer. Just before first strand cDNA synthesis, the RNA was pre-treated with
RNAse inhibitor and DNAse and treated samples were incubated at 37oC for 30 minutes and 65oC
for 10 minutes in 25mM EDTA to activate and stop reactions respectively. First strand cDNA
synthesis was performed by addition of the following to 12µl of RNA sample: 1µl of the 10µM
oligo dT primer, 1µl of 10 mM deoxyribonucleotide triphosphates (dNTP), 4 µl 5xRT buffer, 1µl
RiboSafe RNA inhibitor, 1µl Tetro Reverse Transcriptase ((200 units/µl). The reaction mixture
was then incubated for 2 hours at 45°C followed by reaction termination at 85oC for 5 minutes.
qRT-PCR
Rice phenylalanine ammonia lyase 4 (OsPAL4) expression was analysed using qRT-PCR. The
20µl reaction mixture contained 2µl cDNA, 1µl forward primer (10mM) (5’
TAACGTTTACCTGGTCACTGC 3’), 1µl reverse primer (10mM) (5’
CGTCCTGGTTGTGCTGC 3’), 10µl Hiloxpremix and 6µl sterile milli-Q water. All reactions
were performed in three technical replicates and two independent biological replicates. The
reactions were performed in Bio Rad CFX Connect Real-Time system and results were generated
by BIO-RAD CFX Manager 3.1. PCRs were performed under following conditions: 3 mins at
95oC and 39 cycles (15 secs at 95oC, 30 secs at 58oC) and 0.05 sec at 65oC. After the PCR
reaction, a melting curve was generated by gradually increasing the temperature to 95 degrees to
test the amplicon specificity. The same procedure was done for OsEXP, the reference gene
(forward primer: 5’ TGTGAGCAGCTTCTCGTTTG, reverse primer:
TGTTGTTGCCTGTGAGATCG).
Data analysis
The data was entered, processed in Microsoft excel and was later exported into statistical
analytical systems (SAS). Prior to analysis of variance, data was subjected to “proc univariate
normal plot” and “proc glm” procedures to test for normality and homogeneity of variance
respectively. The data set that did not fulfil the assumptions of normality and homogeneity of
variance were subjected to log(X+1) transformation. The data were then subjected to a one-way
analysis of variance (ANOVA). To determine differential responses among genotypes to
nematode infection, means were compared and separated using Fisher’s least significance
difference (LSD) at 0.05 significance level (P ≤ 0.05). The qRT-PCR data was analysed using the
REST 2009 software (Pfaffl et al., 2002). This software uses a permutation analysis to compare
the relative expression between a sample and a control group and to determine the statistical
significance of the results.
Results
Analysis of penetration of M. javanica in rice genotypes
Penetration of M. javanica in LD24, KPM, TOG5674 and Nipponbare was investigated at 1 and 3
days after inoculation (DAI). M. javanica penetrated all genotypes and induced galls. At 1 DAI,
there were no galls observed on LD24 and KPM. However, few galls were observed on some
plants of Nipponbare and TOG5674 (Figure 1). At 3 DAI, galls of various sizes and shapes were
observed on the roots tips of all genotypes. At this time point, gall formation was significantly
(P=0.01) different among genotypes. Nipponbare had significantly (P<0.05) higher number of
galls than other genotypes such as LD24, KPM and TOG5674 (Figure 1). The galls were more
swollen and rounded in Nipponbare compared to other genotypes (Figure 3).
To get insight on the number of M. javanica J2s penetrating the roots, the stained roots were split
longitudinally and J2s were counted. At both time points (1 and 3 DAI), J2s were found inside the
roots of all genotypes. The J2 numbers increased from 1 DAI to 3 DAI across genotypes. At 1
DAI, J2s were found mostly in root tips, without visible gall formation, of all genotypes. The
number of J2s was not significantly different among genotypes. However, slightly greater number
of J2s was found in genotypes Nipponbare and LD24 compared to KPM and TOG5674 (Figure 2).
At 3 DAI, the number of J2s was significantly (P=0.0125) different among the genotypes. The
number of J2s was significantly (P<0.05) higher in both Nipponbare and LD24 than in KPM and
TOG5674 (Figure 2). At 3 DAI, J2s were not only found in galls but also in root tips without
visible galls, mostly in genotypes LD24, KPM and TOG5674. At both time points, some J2s were
observed partly imbedded in roots with others in the cortex still migrating towards the root cap.
More migrating juveniles were however observed at 1 DAI. The J2s that U-turned into the central
cylinder induced galls of various phenotypes in the vascular cylinder (Figure 3). The visual
observations indicated that size of galls was not dependent on number of J2s inside the galls.
Figure 1: Number of galls induced on rice genotypes following penetration of M. javanica at 1 and 3 days
after inoculation (DAI). Rice seedlings were inoculated with approximately 200 J2s per plant. Bars
represent the means and standard error of the mean (Mean ± SEM). Different letters indicate statistically
significant (P≤0.05) differences according to Fisher’s least significant difference (LSD).
Figure 2: Penetration of M. javanica juveniles (J2s) in rice genotypes at 1 and 3 DAI. Rice
seedlings were inoculated with approximately 200 J2s per plant. Bars represent the means and
standard error of the mean (Mean ± SEM). Different letters indicate statistically significant
(P≤0.05) differences according to Fisher’s least significant difference (LSD).
Figure 3: Gall phenotypes induced on rice genotypes following M. javanica infection at 3 DAI.
Any letter followed by 1 and 2 indicate intact galls while any letter followed by 3 indicates opened
galls with J2s in respective genotypes. Pictures were captured using camera connected to the
microscope, Leica Biosystems.
Analysis of the development of M. javanica on rice genotypes
The development of M. javanica on rice genotypes was studied at 24 DAI. The number of galls
was significantly (P<0.0001) different among the genotypes (Figure 4). The number of galls was
significantly higher on Nipponbare but comparable with TOG5674. The genotype LD24 had
lower number of galls than TOG5674 but the difference was not statistically significant. KPM had
the lowest number of galls of genotypes (Figure 4). Nipponbare had enormously large galls in
which one or several nematodes were completely enclosed. In LD24, KPM and TOG5674, small
galls enclosing one to few nematodes were observed. Some nematodes were observed hanging
outside on the root surface with no gall at all (Figure 7).
Total number of nematodes per plant was calculated as the summation of all developmental stages
(J3/J4, young females and egg-laying females) observed in the roots. The number of total
nematodes was significantly (P<0.0001) higher in Nipponbare compared to other genotypes.
LD24 and TOG5674 had a comparable number of nematodes. KPM had the least number of
nematodes compared to all other genotypes (Figure 5). Interestingly, the number of nematodes
varied greatly among developmental stages (Figure 6). The number of nematodes in each stage
increased successively in Nipponbare towards egg-laying females. In Nipponbare, the majority
were egg-laying females (37.22 %) and females without egg masses (young females) (41.10 %)
and only 21.68 % were in juvenile stages (J3/J4). In LD24, greater numbers were still J3/J4 (42.73
%) and young females (35.41 %). Only 21.86 % developed into egg-laying females. In KPM, the
highest percentage was J3/J4 (48.57 %), while 36.19 % was young females and very few (15.24
%) were egg-laying females. Whereas in TOG5674, J3/J4 (55.56 %) were very high compared to
young females (32.32 %) and egg-laying females (12.12 %).
Figure 4: Number of galls found on rice genotypes at 24 days after inoculation with M. javanica.
Rice seedlings were inoculated with approximately 200 J2s per plant. Bars represent the means
and standard error of the mean (Mean ± SEM). Different letters indicate statistically significant
(P≤0.05) differences according to Fisher’s least significant difference (LSD).
Figure 5: Total number of nematodes (M. javanica) developed on rice genotypes at 24 days after
inoculation. Total number of nematodes was calculated as the summation of developmental stages
per genotype. Rice seedlings were inoculated with approximately 200 J2s per plant. Bars represent
the means and standard error of the mean (Mean ± SEM). Different letters indicate statistically
significant (P≤0.05) differences according to Fisher’s least significant difference (LSD).
Figure 6: Variation in M. javanica developmental stages on rice genotypes at 24 days after inoculation.
Rice seedlings were inoculated with approximately 200 J2s per plant. Bars represent the means
and standard error of the mean (Mean ± SEM). Different letters on each genotype indicate
statistically significant (P≤0.05) differences according to Fisher’s least significant difference
(LSD).
Figure 7: Gall phenotypes and developmental stages found on rice genotypes following M.
javanica infection at 24 days after inoculation. Pictures were captured using a camera connected
to the microscope, Leica Biosystems.
Analysis of penetration of M. incognita in rice genotypes
Penetration of M. incognita was studied at 1 and 3 DAI. At 1 DAI, assessment of roots for galls
indicated that there were no galls on any genotype. At 3 DAI, galls were observed in few
replicates of Nipponbare, KPM and TOG5674. LD24 had no galls at both time points (Table 1).
When roots were assessed for penetration, it was observed that no juveniles (J2s) had penetrated
the rice roots of all genotypes at 1 DAI. At 3 DAI however, some J2s were found in galls and gall-
less root tips of all genotypes (Figure 8). On average, a larger number of J2s was found in KPM
followed by Nipponbare and TOG5674 while the lowest number was recorded in LD24. However,
variation among replicates for a given genotype was high, some samples had no J2s at all (Table
1).
Table 1: Number of M. incognita juveniles (J2s) penetrated and galls induced on the root
Time points Genotype Number of galls Number of juveniles (J2)
1 DAI Nippon 0 0
LD24 0 0
KPM 0 0
TOG5674 0 0
3 DAI Nippon 2.125 (0 - 5) 4 (0 - 11)
LD24 0 1.25 (0 - 7)
KPM 0.85 (0 - 2) 8.50 (0 - 19)
TOG5674 0.625 (0 - 2) 2.25 (0 - 6)
Values are means and ranges. Mean (range = Minimum-Maximum values) of number of J2s and
galls at 1 and 3 days after infection. Rice genotypes were infected with approximately 200 J2s of
M. incognita.
Figure 8: Juveniles (J2s) or galls induced on rice genotypes following infection by M. incognita at
3 days after inoculation (DAI). Pictures were captured using camera connected to the microscope,
Leica Biosystems.
Development of M. incognita in rice genotypes
At 24 DAI, genotypes were assessed for development of M. incognita. Assessment of galling
indicated very few galls on all genotypes following inoculation with M. incognita. However on
average, one gall per plant was observed in Nipponbare and LD24, while two galls per plant were
observed in KPM. There were no galls on TOG5674 (Table 2).
Evaluation of rice genotypes for developmental stages indicated few nematodes across genotypes.
All genotypes appeared immune to M. incognita infection. Despite the low infection, differences
in responses to infection were observed among genotypes. All developmental stages (J3/J4, young
females and egg-laying females) were observed in Nipponbare, LD24 and KPM unlike in
TOG5674 (Table 2). In TOG5674, the nematodes were still in juvenile (J3/J4) stages. In LD24
and KPM, some nematodes were observed in roots without visible galls. Egg-laying females
observed on rice genotypes were larger in size in Nipponbare than in other genotypes, with the
eggs protected in a thick gelatinous matrix on root surfaces (Figure 9).
Table 2: Number of galls and developmental stages of M. incognita at 24 DAI
Genotype
Number of
galls Juveniles (J3/J4)
Young
females
Egg-laying
females
Nippon 1.125 (0 - 3) 0.375 (0 - 1) 0.25 (0 - 2) 1.125 (0 - 3)
LD24 0.50 (0 - 1) 0.75 (0 - 4) 0.625 (0 - 2) 0.50 (0 - 1)
KPM 1.375 (0 - 6) 0.50 (0 - 1) 0.25 (0 - 1) 1.00 (0 - 5)
TOG5674 0 0.125 (0 - 1) 0 0
Values are means and ranges. Mean (range = Minimum-Maximum values) of number of J2s and
galls at 24 days after inoculation (DAI). Rice genotypes were infected with approximately 200 J2s
of M. incognita.
Figure 9: Gall phenotypes and development observed on rice genotypes following infection by M.
incognita at 24 days after inoculation. Pictures were captured using camera connected to the
microscope, Leica Biosystems.
Expression analysis of PAL as a possible regulator of resistance
Expression of OsPAL4 was studied in Nipponbare, LD24 and KPM. All genotypes were infected
with M. javanica and M. incognita. Non-infected plants were used as control. For individual
genotypes, pairwise analysis was performed between controls and infected plants. According to
the algorithm of Rest2009 software, upregulation is when the relative expression is above 1 (>1)
and down regulation when less than one (<1). Results showed that the relative expression of
OsPAL4 was slightly down regulated in all genotypes following nematode infection at early time
point, 3 DAI (Figure 10A). At later time points, the result showed that both M. javanica and M.
incognita consistently down regulated OsPAL4 in the susceptible genotype Nipponbare at all time
points (7, 14 and 21). On contrary, non-significant upregulation was observed at 21 DAI in M.
incognita infected plants (Figure 10). In LD24 and KPM, there was no distinct expression pattern
of OsPAL4 due to infection of either M. javanica or M. incognita at 7, 14 and 21 DAI (Figure 10).
However, in LD24 PAL4 was slightly upregulated at 7 DAI by M. javanica (Figure 10B) and very
strongly upregulated by both root-knot nematodes at 14 DAI (Fig. 10C).
Figure 10: Expression level of PAL4 at 3, 7, 14, and 21 days after inoculation (DAI) of either M.
javanica or M. incognita. CTRL = non-infected plants (Controls), Mj = M. javanica and Mi = M.
incognita. A = Relative expression of PAL4 at 3 DAI, B = Relative expression of PAL4 at 7 DAI,
C = Relative expression of PAL4 at 14 DAI, D = Relative expression of PAL4 at 21 DAI. Pairwise
comparison was performed between controls and nematode infected plants for individual
genotypes. Statistical significance is indicated by asterisks (*).
Analysis of penetration of P. zeae in rice genotypes
Penetration of P. zeae in rice roots was studied in Nipponbare, LD24, KPM and TOG5674 at 1
and 3 DAI. Nematodes were observed to penetrate the roots of all genotypes. At 1 DAI,
penetration of P. zeae was not significantly (P=0.9039) different among genotypes. Likewise, at
3DAI nematode penetration was also not significantly (P=0.4529) different among genotypes, but
relatively higher numbers of nematodes penetrated in Nipponbare and LD24 genotypes (Figure
10). Nematode penetration increased from 1DAI to 3DAI across the genotypes (Figure 11).
However, increase in nematode numbers between 1 DAI and 3 DAI was significant (P<0.05) only
in Nipponbare and LD24 (Figure 10). In samples of both time points it was observed that before
penetration, nematodes punctured root surfaces over a wide area which resulted in an extended
necrosis on the root surfaces. Across genotypes, nematodes were observed in the root cortex while
others were still penetrating, with their bodies partly hanging outside the root. Many nematodes
were observed to penetrate at the same site. After penetration, nematodes started feeding on plant
root cortical cells but necrosis was not clearly visible in all genotypes at both time points (Figure
12). At 3 DAI females had already started laying eggs in the root cortex.
Figure 11: Penetration of P. zeae in rice genotypes at 1 and 3 days after inoculation (DAI). Rice
seedlings were inoculated with approximately 300 mixed stages per plant. Bars represent the
means and standard error of the mean (Mean ± SEM). Different letters indicate statistically
significant (P≤) differences according to Fisher’s least significant difference (LSD).
Figure 12: Penetration of P. zeae mixed stages in rice genotypes at 1 day after inoculation (DAI).
Similar penetration behaviour was observed at 3 DAI. Pictures were captured using a camera
connected to the microscope, Leica Biosystems.
Reproduction of P. zeae on rice genotypes
Reproduction of Pratylenchus zeae on rice genotypes was studied at 24 DAI. P. zeae reproduction
significantly (P<0.0001) differed among the genotypes (Table 3). Nipponbare had the greatest
number of nematodes (range, 805-1597) compared to other genotypes. LD24 was significantly
different and intermediate (range, 409-774) between Nipponbare and KPM and TOG5674. The
average nematode numbers were not statistically different in KPM and TOG5674. Across
genotypes, P. zeae was observed both in the main roots and lateral roots. While greater numbers
were observed in the main roots of Nipponbare, higher numbers of nematodes were observed in
the lateral roots of other genotypes. Despite the differences in the number of nematodes, eggs were
observed in the necrotic tissues of all genotypes. Furthermore, a reproduction factor (RF) was
calculated based on final population (Pf) divided by the initial population (Pi). Nipponbare and
LD24 had RF greater than one (RF>1) and were thus classified as susceptible to P. zeae infection.
Likewise, genotypes KPM and TOG5674 had RF less than one (RF<1) and were thus resistant to
P. zeae infection (Table 3).
Table 3: Reproduction of P. zeae on rice genotypes 21 days after inoculation
Genotypes Number of nematodes RF Host status
Nipponbare 1157.13 ± 251.54a 3.857083 S
LD24 617.63 ± 121.50b 2.05875 S
KPM 175.00 ± 55.29c 0.583333 R
TOG5674 222.13 ± 69.03c 0.740417 R
Mean ± SEM (SEM is standard error of the mean). RF=Pf/Pi (Pf = final population, Pi = initial
population of 300 mixed stages). R and S are depicted resistant and susceptible genotypes
respectively. Means with different letters in the column are significantly (P<0.05) different
according to Fisher’s least significant difference (LSD).
Discussion
Root-knot nematodes (Meloidogyne spp.) and root-lesion nematodes (Pratylenchus spp.) are the
most important plant-parasitic nematodes infecting rice (Bridge et al., 2005). Previous studies
showed that O. sativa genotypes LD24 and KPM confer resistance to the root-knot nematode M.
graminicola (Dimkpa et al., 2015). Genotypes TOG5674 (O. glaberrima) and Nipponbare (O.
sativa) have been used in rice-M. graminicola interactions as resistant and susceptible references
respectively (Cabasan et al., 2012; Nguyễn et al., 2014). Lack of information on the mechanism of
resistance and broadness of resistance in these genotypes triggered our motivation for a further
investigation using different nematodes. In this study, we analysed resistance of rice genotypes
LD24, KPM and TOG5674 to M. javanica, M. incognita and P. zeae alongside the model
susceptible genotype Nipponbare. To gain insights on whether the resistance conferred by the rice
genotypes is pre- or post-infection, we investigated penetration at 1 and 3 days after inoculation
(DAI) and development/reproduction at 24 DAI. Analysis of penetration and development of root-
knot nematodes: M. incognita and M. javanica on rice genotypes indicated different patterns.
In our study, the genotype KPM was found highly resistant to M. javanica while LD24 and
TOG5674 were moderately resistant. M. javanica juveniles (J2s) penetrated and reproduced on all
genotypes in varying degrees. At 1 DAI, only few galls were observed on Nipponbare and
TOG5674 and none on LD24 and KPM, and the number of J2s found was not different among
genotypes. This observation is in conformity with equal penetration rate of M. graminicola J2s
between resistant and susceptible rice genotypes (Jena & Rao, 1977). Similarly, Ditylenchus
angustus a leaf parasitic nematode, equally penetrated both resistant and susceptible rice
genotypes (Khanam et al., 2018). Besides, few J2s were found in the vascular cylinder but many
were found in the cortex of gall-less roots in all genotypes suggesting that many J2s were still
migrating. The fact that M. javanica J2s penetrated all rice genotypes equally at 1 DAI suggests
that penetration is not restricted at this early time point. However, at 3 DAI, galls were clearly
visible in all genotypes but the size and number of galls were significantly higher in Nipponbare
than LD24, KPM and TOG5674. M. graminicola-induced galls on roots of susceptible genotype
were also more than in the resistant genotypes at 3 DAI Cabasan et al. (2014). In their study,
sections through galls showed hypertrophied giant cells in the susceptible but in resistant genotype
an early hypersensitive reaction was observed in cell around the J2s. After penetration, J2s migrate
to vascular cylinder and initiate formation of permanent feeding sites by releasing oesophageal
secretions (Hassan et al., 2010). Galls are formed following extensive nuclear cell division
without cytokinesis which results into multinucleate and hypertrophied giant cells in the vascular
parenchyma (Williamson & Hussey, 1996; Kyndt et al., 2013). Therefore, the observation of J2s
in gall-less roots at 1 DAI could be attributed to the early stages of nuclear cell divisions that were
not enough to cause significant increase in the size of the selected parenchyma cells surrounding
the nematode.
To gain insights on the number of J2s that penetrated at 3 DAI, the roots were dissected. The
results indicated that J2s were significantly more numerous in Nipponbare and LD24 than in KPM
and TOG5674. The lower number of J2s in KPM and TOG5674 might be attributed to early
defence responses that inhibited further nematode penetration. Similar observations were reported
by Cabasan et al. (2012) who observed differences in penetration of M. graminicola between
susceptible and resistant rice genotypes. In other studies, the observed difference in penetration of
Meloidogyne spp. between resistant and susceptible genotypes were as a result of movement out
or death of J2s in the resistant roots after initial penetration due to the failure to initiate feeding
sites in tobacco (Schneider, 1991) and soybean (Moura et al., 1993). In resistant rice roots
however, invading J2s were arrested by early hypersensitive-like reaction that was observed
around J2s in the hypodermis, cortex and appeared distorted (Cabasan et al., 2014). Therefore, the
J2s we found in galls-less roots of KPM and TOG5674 at 3 DAI could have been arrested by early
hypersensitive responses. Late penetration or early penetration with a delay or failure to initiate
feeding site are also possibilities.
To analyse in detail the effect of rice genotypes on post-infection development of M. javanica, the
assessments were done at 24 DAI. It was observed that after penetration nematodes developed to
reproductive stage or egg-laying females in all genotypes. However, strong resistance responses
were observed in genotypes LD24, KPM and TOG5674 where the numbers of total nematodes
were lower with a reduced development into the egg-laying females. Nipponbare had the highest
number of gall development compared to all other genotypes. Galls on Nipponbare were more
swollen and contained many nematodes suggesting suitable host for this nematodes. Genotypes
LD24, KPM and TOG5674 had few and small galls, each containing mostly one nematode.
Moreover, the most nematodes were found as part of their body hanging on the root surfaces
without visible galls. This unique phenotype suggests that nematodes failed to maintain feeding
cells in these genotypes, leading to collapsed cells and subsequently galls dissolution occurred.
However, this trait was more pronounced in genotype KPM signifying stronger resistance. Few
galls observed in this study of LD24, KPM and TOG5674 could be due to similar resistance
mechanism against M. graminicola infection (Dimkpa et al., 2015). Similar resistance responses
were also found among rice germplasm collected from Tanzania (Nzogela et al., In preparation).
Slow development in LD24, KPM and TOG5674 was attributed to the relatively higher number of
juveniles and lower adult females whereas in Nipponbare the development pattern was opposite,
with high number of females. Similar development trend was observed between resistant and
susceptible rice genotypes following infection with M. graminicola (Cabasan et al., 2012). The
same observation was also reported in other crops infected with M. incognita, for instance soybean
(Moura et al., 1993) and cotton (McCLURE et al., 1974). The low number of J3/J4 observed in
Nipponbare comparable to that in LD24 and TOG5674 could be due to deferential penetration or
delayed development resulting from competition among many nematodes confined in single large
galls. However, the number of J3/J4 were lower in KPM compared to Nipponbare. Additionally,
significantly few young females with a very small proportion of egg-laying females was observed
in LD24, KPM and TOG5674 compared to Nipponbare. In tomatoes, M. incognita juveniles were
found smaller in resistant genotypes than the susceptible ones (Dropkin, 1969). Diomandé (1984)
also observed higher percetage of M. incognita females in susceptible rice genotypes than in
resistant genotypes at four weeks (28 dys) after infection. Earlier studies demonstrated that M.
graminicola penetration and development were highly reduced in genotypes LD24 and KPM
(Dimkpa et al., 2015). Therefore, resistance responses towards M. javanica and M. graminicola
might be different. Several reports have reported that the suppressed nemarode development was
attributed to poorly developed and highly vacuolated giant cells in resistant genotypes, for
instance in cotton against M. incognita (McCLURE et al., 1974), in cowpea against M. incognita
(Das et al., 2008) and in coffee against M. exigua (Anthony et al., 2005). Accumulation of toxins
and hydrolases are usually associated with vacuolation of giant cells, consquently resulting into
cell degeneration (Jones, 2001). Plant hormones have also been reported to affect nematode
development in rice (Nahar et al., 2011).
To further investigate the resistance conferred by LD24, KPM and TOG5674, the genotypes were
infected with M. incognita alongside the model susceptible rice genotype Nipponbare. According
to our results, it was unexpected that Nipponbare, the model genotype for studying rice-pathogen
interactions showed low penetration of M. incognita. The low penetration was also observed in
LD24, KPM and TOG5674. The very low infection was not due to inactive nematodes because the
inoculum (J2s) were very active at the time of inoculation. Preliminary infection experiments
showed penetration and development following M. incognita inoculation. However, due to delay
to sub-culture, the culture was lost and new culture was obtained from INRA, France. It is
therefore probable that the cultures used during preliminary infection and the one used in this
study could be different populations with differences in pathogenicity. Nevertheless, some of the
few J2s that managed to penetrate developed to egg-laying females on the genotypes except
TOG5674. However, an indication of suppressed development was observed on genotypes LD24,
KPM and TOG5674. Suppressed development suggests post-infection resistance responses in
these genotypes. Previous studies demonstrated that M. incognita penetrated rice genotype
Nipponbare and galls were visible at 6 DAI (Nguyễn et al., 2014). However, information on the
number of M. incognita J2s penetrating rice roots is limited. Dutta et al. (2011) investigated
penetration and development following inoculation of approximately 200 J2s of M. incognita in
rice genotype Balilla (O. sativa) at different time points. Their result indicated the maximum
penetration of about four J2s per plant at 4 DAI and no reproduction was observed at 25 DAI.
Conversely, Diomandé (1984) studied penetration and development of M. incognita and observed
higher penetration (at 4 DAI) and reproduction (at 28 DAI) in susceptible O. sativa genotypes
compared to resistant O. glaberrima. Despite discrepancies in the information about M. incognita-
rice interactions, further investigation is necessary to make any conclusions.
Despite low infection of M. incognita, the observed resistance responses of LD24, KPM and
TOG5674 were similar to responses observed following M. javanica. To elucidate the possible
regulators of resistance to M. javanica and M. incognita, expression of phenylalanine ammonia
lyase (OsPAL4) was investigated in LD24 and KPM in reference to Nipponbare. Our result
indicated that, OsPAL4 was consistently down regulated in Nipponbare following infection of M.
javanica and M. incognita at early time points (3, 7 and 14) days after inoculation. Similarly,
down regulation of OsPAL4 was observed in LD24 and KPM at 3 days after M. javanica and M.
incognita inoculation. In contrast, the OsPAL4 gene expression in LD24 and KPM showed no
distinct pattern at 7, 14 and 21 DAI. However, at 14 DAI, the expression in LD24 was strongly
upregulated by both root-knot nematodes. Continuous suppression of OsPAL4 in Nipponbare
suggests that the gene plays a key role in plant defence and has to be kept as low as possible
throughout nematodes lifecycle. Additionally, the observed suppression at 3 DAI followed by
low-up pattern in resistant genotypes could be attributed to trigger of interacting molecules
responsible for plant defence. Furthermore, resistance in KPM could be constitutive and early as
indicated by significantly lower penetration and development than susceptible genotype
Nipponbare. In LD24 the strong upregulation observed at 14 DAI could be related to late induced
resistance as indicated by high penetration and lower development than Nipponbare. Recent
studies on rice-pathogen interactions have shown that OsPAL genes are similarly or differentially
expressed in different tissues. For example, OsPAL4, OsPAL1, OsPAL5 and OsPAL2 showed
similar expression pattern in different tissues following infection with biotrophic pathogens
(Tonnessen et al., 2015). Moreover, these OsPAL genes play different or similar roles with
probably additive effects during phenylpropanoid metabolism. For example, OsPAL1, a key gene
in salicylic acid biosynthesis was suppressed consistently in Nipponbare but highly upregulated in
resistant genotype at different time points following infection with Ditylenchus angustus (Khanam
et al., 2018) but neither upregulation nor down regulation was observed in M. graminicola
infected plants (Kyndt et al., 2012). Therefore, the observed up-low pattern in resistant genotypes
LD24 and KPM could have been due to interplay of many factors contributing to the resistance
but more experiments are required to determine actual contributors to the resistance.
To gain insight on the broadness of resistance in LD24, KPM and TOG5674, the genotypes were
tested against P. zeae with migratory lifestyle. Analysis of nematode numbers showed a non-
significant difference in invasion of P. zeae among the genotypes at 1 DAI as well as 3 DAI. This
result suggests pre-infection resistance as reported in KPM and LD24 against M. graminicola
(Dimkpa et al., 2015) not to be effective against P. zeae. Equal penetration rates between resistant
and susceptible genotypes were also observed in wheat against P. thornei (Linsell et al., 2014), in
rice against Ditylenchus angustus (Khanam et al., 2018), and in beans against P. scribneri
(Thomason et al., 1976). Analysis of reproduction indicated that Nipponbare supported a very
high reproduction of about 4-fold increase in final population in 24 days, compared to a 2-fold
increase in LD24. However, the final population decreased in KPM and TOG5674. Our study
supports the susceptibility of Nipponbare to P. zeae as was observed by Pili et al. (2016). The
genotype LD24 showed a moderate level of resistance to P. zeae with two-fold increase in initial
population. Thus, LD24 was found to be susceptible to P. zeae, while KPM and TOG5674 were
resistant. Our result is in agreement with the observation made by Nzogela et al. (in preparation)
for resistance in TOG5674 following infection with 300 mixed stages of P. zeae. Suppressed
reproduction in resistant genotypes, but no difference in penetration was also observed between
resistant and susceptible wheat genotypes (Talavera, 2001; Linsell et al., 2014), as in our study.
The fact that TOG5674 and KPM suppressed P. zeae reproduction indicates their mechanism of
resistance might be post-infection.
In conclusion, this study found that rice (O. sativa) genotype KPM has a strong and broad
resistance to root-knot nematodes (M. javanica) and root-lesion nematodes (P. zeae). LD24 and
TOG5674 are moderately resistant to M. javanica. Additionally, analysis of OsPAL4 did not
demonstrate to be linked to resistance against M. javanica and M. incognita in LD24 and KPM.
However, further studies are required especially to test the resistance under field conditions.
Variation in host responses (resistance vs susceptibility) were reported between indoor growth
chambers and outdoor raised beds (Cabasan et al., 2018). Therefore careful identification of
uniformly infested fields (hotspots) is paramount for testing stability of resistance in rice. In depth
molecular and biochemical analyses are being carried out to reveal the underlying resistance
mechanism of these genotypes against M. graminicola infection. Expression analysis of some
phenylpropanoid pathway genes in different rice genotypes upon infection by M javanica and M.
incognita should be repeated to confirm the result obtained during this study.
Acknowlwedgement
The author wishes to thank the Flemish Interuniversity Council (VLIR-UOS) for providing the
scholarship. To my supervisor Mst. Zobaida Lahari, thanks for guiding me all through the research
period. A word of sincere gratitude is extended to my promoter Prof. Godelieve Gheysen, thank
you for allowing me do my thesis research under your supervision. To all members of the applied
molecular biotechnology research groups, thank you for all the support and guidance through my
thesis period. Willem Desmedt and Yasinta Nzogela are highly acknowledged for providing the
Meloidogyne incognita and Pratylenchus zeae cultures respectively. Lander Bauters and Jonas De
Kesel are highly acknowledged for their assistance in molecular work. I am grateful to Inge
Dehennin and Prof. Wim Bert for the great administrative work that has made the program a
success. Finally to all professors, thank you all for sharing with us your expertise in the fields of
nematology, pathology and biotechnology.
References
Anthony, F., Topart, P., Martinez, A., Silva, M. & Nicole, M. (2005). Hypersensitive‐like reaction
conferred by the Mex‐1 resistance gene against Meloidogyne exigua in coffee. Plant
Pathology 54, 476-482.
Babatola, J. (1980). Reactions of some rice cultivars to the root-knot nematode, Meloidogyne
incognita. Nematropica 10, 5-9.
Babatola, J. (1984). Rice nematode problems in Nigeria: their occurrence, distribution and
pathogenesis. International Journal of Pest Management 30, 256-265.
Bouman, B., Humphreys, E., Tuong, T. & Barker, R. (2007). Rice and water. Advances in
agronomy 92, 187-237.
Bridge, J., Plowright, R. A. & Peng, D. (2005). Nematode parasites of rice. Plant parasitic
nematodes in subtropical and tropical agriculture 87.
Cabasan, M., Fernandez, L. & De Waele, D. (2015). Host response of Oryza glaberrima and O.
sativa rice genotypes to the rice root-knot nematode Meloidogyne graminicola in a
hydroponic system under growth chamber. Archives of Phytopathology and Plant
Protection 48, 740-750.
Cabasan, M. T. N., Kumar, A., Bellafiore, S. & De Waele, D. (2014). Histopathology of the rice
root-knot nematode, Meloidogyne graminicola, on Oryza sativa and O. glaberrima.
Nematology 16, 73-81.
Cabasan, M. T. N., Kumar, A. & De Waele, D. (2012). Comparison of migration, penetration,
development and reproduction of Meloidogyne graminicola on susceptible and resistant
rice genotypes. Nematology 14, 405-415.
Cabasan, M. T. N., Kumar, A. & De Waele, D. (2018). Evaluation of resistance and tolerance of
rice genotypes from crosses of Oryza glaberrima and O. sativa to the rice root-knot
nematode, Meloidogyne graminicola. Tropical Plant Pathology 43, 230-241.
Calpe, C. (2006). Rice international commodity profile. Rome: Food and Agricultural
Organization of the United Nations.
Castillo, P. & Vovlas, N. (2007). Biology and ecology of Pratylenchus. Pratylenchus (Nematoda:
Pratylenchidae): diagnosis, biology, pathogenicity and management 6, 305-310.
Chen, X. & Ronald, P. C. (2011). Innate immunity in rice. Trends in Plant Science 16, 451-459.
Conen, F., Smith, K. A. & Yagi, K. (2010). Rice cultivation. Methane and climate change, 1st
edn. Earthscan, Washington, DC, 115-135.
Cook, R. J. (1998). The molecular mechanisms responsible for resistance in plant–pathogen
interactions of the gene-for-gene type function more broadly than previously imagined.
Proceedings of the National Academy of Sciences 95, 9711-9712.
Coyne, D. (2007). Practical plant nematology: a field and laboratory guide. IITA, pp.
Das, S., Demason, D. A., Ehlers, J. D., Close, T. J. & Roberts, P. A. (2008). Histological
characterization of root-knot nematode resistance in cowpea and its relation to reactive
oxygen species modulation. Journal of experimental botany 59, 1305-1313.
Dimkpa, S. O., Lahari, Z., Shrestha, R., Douglas, A., Gheysen, G. & Price, A. H. (2015). A
genome-wide association study of a global rice panel reveals resistance in Oryza sativa to
root-knot nematodes. Journal of experimental botany 67, 1191-1200.
Diomandé, M. (1984). Response of upland rice cultivars to Meloidogyne species. Revue
Nématologie 7, 57-63.
Dropkin, V. (1969). Necrotic reaction of tomatoes and other hosts resistant to Meloidogyne:
reversal by temperature. Phytopathology.
Duncan, L., Moens, M. & Perry, R. (2006). Migratory endoparasitic nematodes. Plant
nematology, 123-152.
Fortuner, R. & Merny, G. (1979). Root-parasitic nematodes of rice. Revue de Nematologie. 2, 79-
102.
Freeman, B. C. & Beattie, G. A. (2008). An overview of plant defenses against pathogens and
herbivores. The Plant Health Instructor.
Fujimoto, T., Mizukubo, T., Abe, H. & Seo, S. (2015). Sclareol induces plant resistance to root-
knot nematode partially through ethylene-dependent enhancement of lignin accumulation.
Molecular Plant-Microbe Interactions 28, 398-407.
George, T., Magbanua, R., Garrity, D. P., Tubana, B. S. & Quiton, J. (2002). Rapid yield loss of
rice cropped successively in aerobic soil. Agronomy Journal 94, 981-989.
Ghesquière, A., Séquier, J., Second, G. & Lorieux, M. (1997). First steps towards a rational use of
African rice, Oryza glaberrima, in rice breeding through a ‘contig line’concept. Euphytica
96, 31-39.
Gheysen, G. & Jones, J. T. (2013). Molecular Aspects of Plant-Nematode Interacctions. Plant
Nematology, 2nd edn (eds, Perry, R.N. and Moens, M), Wallingford, UK, CAB
International, , 274-298.
Gheysen, G. & Mitchum, M. G. (2011). How nematodes manipulate plant development pathways
for infection. Current opinion in plant biology 14, 415-421.
Gupta, S. K., Rai, A. K., Kanwar, S. S., Chand, D., Singh, N. K. & Sharma, T. R. (2011). The
single functional blast resistance gene Pi54 activates a complex defence mechanism in rice.
Journal of experimental botany 63, 757-772.
Hassan, S., Behm, C. A. & Mathesius, U. (2010). Effectors of plant parasitic nematodes that re-
program root cell development. Functional Plant Biology 37, 933-942.
Jena, R. N. & Rao, Y. S. (1977). Nature of resistance in rice (Oryza sativa L) to the root-knot
nematode (Meloidogyne graminicola Golden and birchheld). II. Mechanisms of resistance.
Proceedings of the Indian Academy of Sciences-Section B. Springer.
Ji, H., Kyndt, T., He, W., Vanholme, B. & Gheysen, G. (2015). β-Aminobutyric acid–induced
resistance against root-knot nematodes in rice is based on increased basal defense.
Molecular Plant-Microbe Interactions 28, 519-533.
Jones, A. M. (2001). Programmed cell death in development and defense. Plant physiology 125,
94-97.
Jones, J. D. & Dangl, J. L. (2006). The plant immune system. Nature 444, 323-329.
Jones, J. T., Haegeman, A., Danchin, E. G., Gaur, H. S., Helder, J., Jones, M. G., Kikuchi, T.,
Manzanilla‐López, R., Palomares‐Rius, J. E. & Wesemael, W. M. (2013). Top 10 plant‐
parasitic nematodes in molecular plant pathology. Molecular Plant Pathology 14, 946-961.
Jones, M. P., Dingkuhn, M., Aluko, G. K. & Semon, M. (1997). Interspecific Oryza sativa L. x O.
glaberrima Steud. progenies in upland rice improvement. Euphytica 94, 237-246.
Kagoda, F., Coyne, D., Mbiru, E., Derera, J. & Tongoona, P. (2010). Monoxenic culture of
Pratylenchus zeae on carrot discs. Nematologia Mediterranea 38.
Karssen, G., Wesemael, W. & Moens, M. (2013). Root-knot nematodes. Plant nematology. CABI,
pp. 73-108.
Khanam, S., Bauters, L., Singh, R. R., Verbeek, R., Haeck, A., Sultan, S. M., Demeestere, K.,
Kyndt, T. & Gheysen, G. (2018). Mechanisms of resistance in the rice cultivar
Manikpukha to the rice stem nematode Ditylenchus angustus. Molecular Plant Pathology
19, 1391-1402.
Kreye, C., Bouman, B., Reversat, G., Fernandez, L., Cruz, C. V., Elazegui, F., Faronilo, J. &
Llorca, L. (2009). Biotic and abiotic causes of yield failure in tropical aerobic rice. Field
Crops Research 112, 97-106.
Kumari, C., Dutta, T. K., Banakar, P. & Rao, U. (2016). Comparing the defence-related gene
expression changes upon root-knot nematode attack in susceptible versus resistant cultivars
of rice. Scientific reports 6, 22846.
Kyndt, T., Fernandez, D. & Gheysen, G. (2014). Plant-parasitic nematode infections in rice:
molecular and cellular insights. Annual Review of Phytopathology 52, 135-153.
Kyndt, T., Nahar, K., Haegeman, A., De Vleesschauwer, D., Höfte, M. & Gheysen, G. (2012).
Comparing systemic defence‐related gene expression changes upon migratory and
sedentary nematode attack in rice. Plant biology 14, 73-82.
Kyndt, T., Vieira, P., Gheysen, G. & De Almeida-Engler, J. (2013). Nematode feeding sites:
unique organs in plant roots. Planta 238, 807-818.
Li, B., Liu, B., Shan, C., Ibrahim, M., Lou, Y., Wang, Y., Xie, G., Li, H. Y. & Sun, G. (2013).
Antibacterial activity of two chitosan solutions and their effect on rice bacterial leaf blight
and leaf streak. Pest Management Science 69, 312-320.
Linsell, K. J., Riley, I. T., Davies, K. A. & Oldach, K. H. (2014). Characterization of resistance to
Pratylenchus thornei (Nematoda) in wheat (Triticum aestivum): attraction, penetration,
motility, and reproduction. Phytopathology 104, 174-187.
Mcclure, M. A., Ellis, K. & Nigh, E. L. (1974). Resistance of cotton to the root-knot nematode,
Meloidogyne incognita. Journal of Nematology 6, 17.
Mhatre, P. H., Pankaj, A. S., Singh, A. K., Ellur, R. K. & Kumar, P. (2017). Molecular mapping of
rice root-knot nematode (Meloidogyne graminicola) resistance gene in Asian rice (Oryza
sativa L.) using STMS markers. Indian J. Genet 77, 163-165.
Moura, R., Davis, E., Luzzi, B., Boerma, H. & Hussey, R. (1993). Post-infectional development of
Meloidogyne incognita on susceptible and resistant soybean genotypes. Nematropica 23,
7-13.
Nahar, K., Kyndt, T., De Vleesschauwer, D., Höfte, M. & Gheysen, G. (2011). The jasmonate
pathway is a key player in systemically induced defense against root knot nematodes in
rice. Plant physiology 157, 305-316.
Nguyễn, P. V., Bellafiore, S., Petitot, A.-S., Haidar, R., Bak, A., Abed, A., Gantet, P., Mezzalira,
I., De Almeida Engler, J. & Fernandez, D. (2014). Meloidogyne incognita-rice (Oryza
sativa) interaction: a new model system to study plant-root-knot nematode interactions in
monocotyledons. Rice 7, 23.
Olowe, T. & Corbett, D. (1976). Aspects of the biology of Pratylenchus brachyurus and P. zeae.
Nematologica 22, 202-211.
Peng, S., Bouman, B., Visperas, R. M., Castañeda, A., Nie, L. & Park, H.-K. (2006). Comparison
between aerobic and flooded rice in the tropics: agronomic performance in an eight-season
experiment. Field Crops Research 96, 252-259.
Pfaffl, M. W., Horgan, G. W. & Dempfle, L. (2002). Relative expression software tool (REST©)
for group-wise comparison and statistical analysis of relative expression results in real-
time PCR. Nucleic acids research 30, e36-e36.
Pili, N. N., Kyndt, T., Gheysen, G., Janssen, T., Couvreur, M., Bert, W. & Mibey, R. (2016). First
report of Pratylenchus zeae on upland rice from Kwale County, Kenya. Plant Disease 100,
1022-1022.
Plowright, R. A., Coyne, D. L., Nash, P. & Jones, M. P. (1999). Resistance to the rice nematodes
Heterodera sacchari, Meloidogyne graminicola and M. incognita in Oryza glaberrima and
O. glaberrima x O. sativa interspecific hybrids. Nematology 1, 745-751.
Plowright, R. A., Matias, D., Aung, T. & Mew, T. (1990). The effect of Pratylenchus zeae on the
growth and yield of upland rice. Revue de Nematologie 13, 283-292.
Prasad, R. (2011). Aerobic rice systems. Advances in agronomy. Elsevier, pp. 207-247.
Prot, J.-C. & Rahman, M. (1994). Nematode ecology, economic importance, and management in
rice ecosystems in South and Southeast Asia. Rice pest science and management, 129-44.
Reichert, A. I., He, X.-Z. & Dixon, R. A. (2009). Phenylalanine ammonia-lyase (PAL) from
tobacco (Nicotiana tabacum): characterization of the four tobacco PAL genes and active
heterotetrameric enzymes. Biochemical Journal 424, 233-242.
Reversat, G., Boyer, J., Sannier, C. & Pando-Bahuon, A. (1999). Use of a mixture of sand and
water-absorbent synthetic polymer as substrate for the xenic culturing of plant-parasitic
nematodes in the laboratory. Nematology 1, 209-212.
Schneider, S. (1991). Penetration of susceptible and resistant tobacco cultivars by Meloidogyne
juveniles. Journal of Nematology 23, 225.
Seck, P. A., Diagne, A., Mohanty, S. & Wopereis, M. C. (2012). Crops that feed the world 7: rice.
Food Security 4, 7-24.
Seid, A., Fininsa, C., Mekete, T., Decraemer, W. & Wesemael, W. M. (2015). Tomato (Solanum
lycopersicum) and root-knot nematodes (Meloidogyne spp.)–a century-old battle.
Nematology 17, 995-1009.
Soriano, I. R., Schmit, V., Brar, D. S., Prot, J.-C. & Reversat, G. (1999). Resistance to rice root-
knot nematode Meloidogyne graminicola identified in Oryza longistaminata and O.
glaberrima. Nematology 1, 395-398.
Starr, J., Mc Donald, A. & Claudius-Cole, A. (2013). Nematode resistance in crops. Plant
nematology, 2nd edition. Wallingford, UK, CAB International, 411-436.
Talavera, M. (2001). Monitoring Pratylenchus thornei densities in SOCL and roots under resistant
(Triticum turgidum durum) and susceptible (Triticum aestivum) wheat cultivars.
Phytoparasitica 29, 29-35.
Thi Phan, N., De Waele, D., Lorieux, M., Xiong, L. & Bellafiore, S. (2017). A Hypersensitivity-
Like Response to Meloidogyne graminicola in rice (Oryza sativa L.). Phytopathology.
Thomason, I., Rich, J. & O'melia, F. C. (1976). Pathology and histopathology of Pratylenchus
scribneri infecting snap bean and lima bean. Journal of Nematology 8, 347.
Tonnessen, B. W., Manosalva, P., Lang, J. M., Baraoidan, M., Bordeos, A., Mauleon, R., Oard, J.,
Hulbert, S., Leung, H. & Leach, J. E. (2015). Rice phenylalanine ammonia-lyase gene
OsPAL4 is associated with broad spectrum disease resistance. Plant molecular biology 87,
273-286.
Trudgill, D. (1991). Resistance to and tolerance of plant parasitic nematodes in plants. Annual
Review of Phytopathology 29, 167-192.
Trudgill, D. (1995). An assessment of the relevance of thermal time relationships to nematology.
Fundamental and Applied Nematology 18, 407-417.
Vogt, T. (2010). Phenylpropanoid biosynthesis. Molecular plant 3, 2-20.
Weisshaar, B. & Jenkins, G. I. (1998). Phenylpropanoid biosynthesis and its regulation. Current
opinion in plant biology 1, 251-257.
Williamson, V. M. & Hussey, R. S. (1996). Nematode pathogenesis and resistance in plants. The
Plant Cell 8, 1735.
top related