aem accepts, published online ahead of print on 21...
TRANSCRIPT
![Page 1: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/1.jpg)
1
2
3
4
Ecological divergence of a novel group of Chloroflexus along a geothermal gradient 5
6
Revised MS# AEM02753-12R1 7
8
Michael L. Weltzer and Scott R. Miller* 9
Division of Biological Sciences, The University of Montana, Missoula, MT 59812 USA 10
11
* For correspondence. E-mail [email protected]; Tel. 406-243-5149; Fax 406-12
243-4184 13
14
Running title: Chloroflexus niche diversification 15
16
Keywords: Chloroflexus / niche differentiation / adaptation / trade-offs 17
18
19
20
21
22
23
Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02753-12 AEM Accepts, published online ahead of print on 21 December 2012
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 2: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/2.jpg)
2
Abstract 24 25 Environmental gradients are expected to promote the diversification and co-existence of 26
ecological specialists adapted to local conditions. Consistent with this view, genera of 27
phototrophic microorganisms in alkaline geothermal systems generally appear to consist 28
of anciently divergent populations which have specialized on different temperature 29
habitats. At White Creek (Lower Geyser Basin, Yellowstone NP), however, a novel, 16S 30
rRNA-defined lineage of the filamentous anoxygenic phototroph Chloroflexus (OTU 10, 31
phylum Chloroflexi) occupies a much wider thermal niche than other 16S rRNA-defined 32
groups of phototrophic bacteria. This suggests that Chloroflexus OTU 10 is either an 33
ecological generalist or, alternatively, a group of cryptic thermal specialists which have 34
recently diverged. To distinguish between these alternatives, we first isolated laboratory 35
strains of Chloroflexus OTU 10 from along the White Creek temperature gradient. These 36
strains are identical for partial gene sequences encoding the 16S rRNA and malonyl Co-37
A reductase, respectively. However, strains isolated from upstream and downstream 38
samples could be distinguished based on sequence variation at pcs, which encodes 39
propionyl-CoA synthase of the 3-hydroxypropionate pathway of carbon fixation used by 40
the genus Chloroflexus. We next demonstrated that strains have diverged in temperature 41
range for growth. Specifically, we obtained evidence for a positive correlation between 42
thermal niche breadth and temperature optimum, with strains isolated from lower 43
temperatures exhibiting greater thermal specialization than the most thermotolerant 44
strain. The study has implications for our understanding of both the process of niche 45
diversification of microorganisms and how diversity is organized in these hot spring 46
communities. 47
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 3: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/3.jpg)
3
Introduction 48
Understanding the factors that contribute to the origins and maintenance of 49
ecological variation is a central goal of the investigation of microbial diversity. Spatially 50
structured environments including physical and chemical gradients are predicted both to 51
enhance diversification rates (1) and to maintain greater diversity through the co-52
existence of multiple ecological specialists that are locally adapted to different niches (2). 53
The process of ecological specialization entails fitness costs, or trade-offs, whereby a trait 54
that is beneficial in one environment is deleterious in one or more alternative 55
environments. Most evolutionary theory assumes the existence of such trade-offs (3, 4), 56
and evidence for trade-offs is often, but not always, found during the adaptation of 57
experimentally evolved laboratory microorganisms (2, 5, 6). 58
The contribution of trade-offs to niche diversification in natural communities of 59
microorganisms is less clear, but the environmental gradients of Yellowstone National 60
Park alkaline hot springs are excellent systems for investigating this issue. In particular, 61
trade-offs in thermotolerance appear to be important for structuring diversity in 62
populations of phototrophs in these systems. For example, laboratory strains of the 63
Synechococcus A/B group of cyanobacteria isolated from different temperatures from 64
both Yellowstone and Oregon hot springs are ecological specialists with divergent 65
temperature ranges for growth (7, 8), and these genetically distinct lineages are restricted 66
in situ to different regions along hot spring thermal gradients (9, 10). Thermal niche 67
specialization has also appeared to have occurred in a group of phototrophic 68
Acidobacteria (Candidatus Chloracidobacterium thermophilum): in White Creek (Lower 69
Geyser Basin, Yellowstone NP), four different 16S rRNA-defined Chloracidobacterium 70
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 4: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/4.jpg)
4
lineages each occupy a relatively narrow (~5-15 °C) realized thermal niche in situ and 71
peak in abundance at different locations along the gradient (10). 72
These ecologically divergent phototrophic clades often exhibit substantial 73
sequence variation in the highly conserved 16S rRNA gene, suggesting that divergence of 74
these groups is ancient. For example, strains of the Synechococcus A/B group 75
characteristic of these systems can vary in 16S rRNA gene sequence by over 5% (7). 76
Given the estimated 50-100 million years required for the 16S rRNA gene to diverge by 77
1% (11), this suggests that the clade began to diverge more than 100 million years ago. 78
In White Creek, for which the distribution of taxa along its thermal gradient has 79
been extensively investigated (10), members of the genus Chloroflexus (phylum 80
Chloroflexi) represent an apparent exception to this pattern of ancient specialization. 81
This metabolically versatile group of anoxygenic phototrophs can account for as much as 82
50% of environmental sequences retrieved from these communities (10). At White 83
Creek, lineages of Chloroflexus distinguished by unique sequence tags for the V3 region 84
of the 16S rRNA gene were present in high abundance across a much broader range of 85
temperatures than was observed for other phototrophic groups (10); in particular, one 86
lineage (Chloroflexus OTU 10) was the most abundant Chloroflexi sequence tag in the 87
full dataset (9.0% of the total sequences recovered) and was a major community member 88
(~5-25% of the sequences recovered) over a region of the White Creek gradient spanning 89
39-64 °C. Its broad distribution raises the question of whether it represents a single 90
generalist or, rather, a group of recently diverged, cryptic specialists that are 91
indistinguishable by sequencing of the V3 region of the 16S rRNA gene. 92
Here, we combined phylogenetic analyses of 16S rRNA, malonyl Co-A reductase 93
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 5: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/5.jpg)
5
and propionyl-CoA synthase gene sequence data with physiological approaches to 94
address whether cultivated strains of Chloroflexus OTU 10 isolated from samples 95
collected along the White Creek gradient have genetically and phenotypically diverged. 96
These are the first cultured members of this group of Chloroflexi, which is genetically 97
distinct from the previously cultured members of the genus, including laboratory model 98
strains C. aurantiacus J-10-fl (12) and C. aggregans strain DSM9486 (13). Together, the 99
results reveal extensive ecological variation in thermotolerance among closely-related 100
White Creek population members of this novel group of Chloroflexi. 101
102
Materials and Methods 103
Laboratory strain isolation. Microbial mat samples were collected from White Creek 104
(WC) sites WC3 (Universal Transverse Mercator (UTM) Coordinates: 516002E 105
4931137N, approximate temperature 47°), WC5 (UTM 516362E 4930907N, approximate 106
temperature 54°) and WC7 (516471E 4930848N, approximate temperature 61° C) in 107
May/July 2009 and May 2010. Environmental samples were spread on plates of medium 108
D (14) with additions of 0.00082g/L anhydrous sodium acetate, 0.0027g/L sodium 109
succinate dibasic hexahydrate, 0.0011g/L sodium butyrate, 1.87 μg/L sodium lactate, and 110
0.00053g/L ammonium chloride at pH 8.2. Phytagel (0.7% wt/vol) was used as the 111
gelling agent, as this has been a successful strategy for improving the cultivation of novel 112
microorganisms from soil (15). Spread plates of the samples collected from WC3 were 113
incubated at 50° C, and spread plates of samples collected from White Creek sites 5 and 7 114
were incubated at 55° C. Plates were examined under a dissecting microscope several 115
times per week. After one to two weeks of incubation, isolated colonies with filamentous 116
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 6: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/6.jpg)
6
Chloroflexus morphology were transferred to fresh plates. These Chloroflexi are capable 117
of gliding motility and will glide away from non-motile cells with which they are in co-118
culture (16). Forceps were subsequently used to transfer the “leading edge” of the culture 119
to a fresh plate, and this process was repeated until an axenic culture was obtained. A 120
culture was considered axenic if no growth was observed on nutrient agar indicator 121
plates, no contaminating cells were observed by light microscopy and no sequence 122
heterogeneity was observed for directly sequenced 16S rRNA gene fragments amplified 123
with universal primers by PCR (see below). Strains were maintained in liquid D medium 124
(pH 8.2) with additions of 0.8 g/L glycylglycine, 2.0 g/L yeast extract and 0.2 g/L 125
ammonium chloride. All cultures were maintained under constant irradiance of 150 μmol 126
photons m-2 s-1 of tungsten radiation. 127
128
DNA isolation, amplification and sequence analysis 129
Genomic DNA was isolated from each strain by the method of Pitcher et al. (17). 130
A fragment of the 16S rRNA gene was amplified for each strain using primers 23f 131
and 1492r (18) under the following cycling conditions: 1 minute initial denaturing at 94 132
°C followed by 40 cycles of 1 minute at 94°C , 1 minute at 54° C, 1.5 minutes at 72° C, 133
and a final extension of 10 minutes at 72° C. Amplified products were directly sequenced 134
with primer 23f at the University of Washington High-Throughput Genomics Unit, 135
Seattle, WA. 136
Chloroflexi 16S rRNA gene sequences from the metagenomes of White Creek, 137
Chocolate Pots, Fairy Spring and Bath Lake Vista Annex were obtained from the DOE-138
JGI Yellowstone Metagenome Project (available at http://img.jgi.doe.gov/cgi-139
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 7: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/7.jpg)
7
bin/m/main.cgi; Klatt et al., in preparation). 16S rRNA gene sequence data for C. 140
aurantiacus strain J-10-fl, Chloroflexus sp. 396-1 and C. aggregans strains DSM 9486 141
and MD-66 were obtained from the NCBI database. These sequences were aligned with 142
16S rRNA gene sequences from White Creek strains using ClustalW (19). Ambiguous 143
base calls were excluded from the analysis. Roseiflexus sequences from the Yellowstone 144
Metagenome Project were also included in the alignment as an outgroup. 145
Maximum likelihood trees were generated by RaxML version 7.0.3 (20) 146
according to a GTR + G + I model of sequence evolution selected by Modeltest version 147
3.7 (21). Starting trees were generated randomly and 100 bootstrap replicates were 148
performed using the rapid bootstrapping algorithm. MrBayes version 3.1.2 (22) was used 149
to generate phylogenies by Bayesian inference. As with the likelihood analysis, the GTR 150
+ G + I model was used. Two replicates were run simultaneously for 10,000,000 151
generations until convergence was attained, as assessed by an average standard deviation 152
of split frequencies below 0.01. To attain convergence between individual analyses, 153
chain-swapping was improved by adjusting the heating parameter from the program 154
default of 0.2 to 0.025. The chains were sampled every 100 generations and the first 20% 155
of sampled trees were discarded as burn-in. 156
Partial sequences of the malonyl-CoA reductase (mcr) and propionyl-157
CoA synthase (pcs) genes were amplified with primers designed using sequences 158
recovered from White Creek and “Bath Lake Vista Annex” by the Yellowstone 159
Metagenome Project. mcr was amplified using forward primer 160
5'CATCTTTCCCGGCCCGATTG3' and reverse primer 161
5'CACAGGCAAATTCTAACCCTTC3'. pcs was amplified from each strain using 162
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 8: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/8.jpg)
8
forward primer 5'AGAAGCGTAYACCGATCARG3' and reverse primer 163
5'CACCRACCACAATACAATTACC3'. Both sets of primers were designed from the 164
Yellowstone National Park metagenome sequences. Both gene fragments were amplified 165
under the following cycling conditions: 1 minute initial denaturing at 94 °C followed by 166
40 cycles of 1 minute at 94°C , 1 minute at 54° C, 2 minutes at 72° C, and a final 167
extension of 10 minutes at 72° C. Genes were sequenced using the forward primers at 168
either the University of Washington High-Throughput Genomics Unit or the Murdock 169
Sequencing Facility, The University of Montana, Missoula, MT. Sequences of both 170
genes were aligned with CLUSTALW (19). A sequence of each gene from the “Bath 171
Lake Vista Annex” metagenome (Klatt et al., in preparation) was also included in the 172
alignments. Identical sequence haplotypes were identified with DnaSP (23). A minimum 173
spanning tree was inferred in Arlequin (24) and manually adjusted to produce a 174
genealogical network for which the distance between any two sequences was identical to 175
the number of observed nucleotide differences between them. 176
New sequences generated in this study were deposited in GenBank under 177
accession numbers KC154234-KC154266. 178
179
Determination of strain growth temperature ranges 180
For growth rate experiments to assay temperature performance, strains were 181
grown in liquid D medium (pH 8.2) with additions of 0.8g/L glycylglycine, 2.0 g/L yeast 182
extract, 0.2 g/L ammonium chloride. Test tubes were inoculated with enough stationary 183
phase culture (generally 2mL) to obtain a starting OD660 of 0.01 to 0.02. Optical 184
densities (OD) of 2 mL sub-samples were determined by spectrophotometry at 660 nm 185
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 9: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/9.jpg)
9
every 24 hours until the cultures reached stationary phase (3-5 days). Growth rates were 186
measured at 41 °C, 45 °C, 50 °C, 55 °C, 58 °C, 60 °C, 65 °C, and 67 °C (67 °C for strain 187
WC7-3 only) at an irradiance of 150 μmol photons m-2 s-1 of tungsten radiation. 188
Triplicates of each strain were performed for each temperature treatment. The generation 189
time during exponential growth was estimated by log 2/b, where b is the slope of the 190
logarithmically-transformed optical density of a culture at 660 nm regressed on time. 191
192
Results 193
Laboratory strain isolation. Environmental samples were collected from White Creek 194
sites WC3, WC5 and WC7 between May 2009 and May 2010. These sites are oriented 195
along the upstream-downstream axis of the channel, with average temperatures of 196
approximately 47 °C, 54 °C and 61 °C, respectively (10, 25). We obtained eleven axenic 197
Chloroflexus strains from these samples by isolation of colonies from spread plates 198
followed by subsequent plate transfers (Table 1). All strains grew on phytagel plates 199
containing 1% strength medium D supplemented with ammonium and organic acids, but 200
only six were capable of growth in liquid medium. Light microscopy was used to 201
confirm that strains had characteristic Chloroflexus morphology, and absorption spectra 202
likewise indicated the presence of bacteriochlorophyll c (not shown). 203
204
Phylogenetic analyses. All strains were identical to each other for an alignment of 680 205
nucleotides of the 16S rRNA gene as well as identical to the Chloroflexus OTU 10 206
sequence tag previously recovered from White Creek and Rabbit Creek (10). 207
Phylogenies were reconstructed to determine the evolutionary relationships of these 208
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 10: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/10.jpg)
10
strains to cultured representatives of the genus and to Chloroflexus sequences recovered 209
from Yellowstone hot spring metagenomes (Klatt et al., in preparation; 210
http://img.jgi.doe.gov/cgi-bin/m/main.cgi). Bayesian inference and maximum likelihood 211
produced similar results (Fig. 1). The White Creek strains were most similar (99.5-100% 212
sequence identity) to sequences that are widespread in other Yellowstone hot springs, 213
particularly “Bath Lake Vista Annex” (Mammoth Hot Springs), yet are distinct from 214
previously cultured Chloroflexus strains (Fig. 1). For example, sequence identity was 215
~96% to Chloroflexus sp. 396-1 and ~94% to C. aurantiacus strain J-10-fl, respectively. 216
To determine if the White Creek strains could be distinguished genetically, 217
fragments of the malonyl-CoA reductase (mcr) and propionyl-CoA synthase (pcs) genes 218
of the 3-hydroxypropionate carbon fixation pathway were sequenced. All White Creek 219
strain sequences were identical for a partial sequence (761 nucleotides) of the mcr gene, 220
and differed by less than 1% (1/151 nucleotides in the region of overlap) from a sequence 221
recovered in the “Bath Lake Vista Annex” metagenome. The mcr sequence exhibited 222
75.6% sequence identity to the sequence of C. aurantiacus strain J-10-fl. White Creek 223
strains could be distinguished by a partial (657 nucleotides) pcs gene sequence, however. 224
Three different pcs alleles were observed among the eleven White Creek strains. Each 225
was distinct from the allele detected in the “Bath Lake Vista Annex” metagenome (Fig. 226
2A), and average sequence identity with the sequence of C. aurantiacus strain J-10-fl was 227
approximately 80%. All WC3 and WC5 strains shared the same allele, two of the three 228
WC7 strains (WC7-1, WC7-2) had a second allele and strain WC7-3 had a unique 229
sequence (Fig. 2A). 230
Gene sequences sampled from populations often violate the assumptions of 231
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 11: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/11.jpg)
11
traditional phylogenetics that bifurcating descendants are related by an extinct ancestor 232
and that there has been no recombination between sequences (26). Therefore, to infer the 233
relationships among the pcs alleles, a minimum-spanning genealogical network which 234
relaxes these assumptions was reconstructed for the White Creek and Bath Lake Vista 235
alleles (Fig. 2B). This network is characterized by a central loop, which indicates that the 236
evolutionary history of pcs has been impacted by either recombination or recurrent 237
mutation. Since all nucleotide sites in the pcs alignment consisted of at most only two 238
variants, the data conform to the infinite sites mutation model (i.e., there has been a 239
maximum of one mutation at each nucleotide position) and thereby strongly implicate 240
recombination rather than multiple mutations at the same nucleotide position. 241
Specifically, the WC7-3 allele appears to be a recombinant of the other two White Creek 242
alleles: comparison of the variable nucleotide positions in the pcs sequence clearly show 243
alternating tracts of sequence identity between WC7-3 and WC7-1 and the WC3/WC5 244
alleles, respectively (Fig. 2A). This suggests recent or on-going gene flow among 245
Chloroflexus lineages along the White Creek gradient. 246
247
Variation in cardinal growth temperatures. To test for ecological diversification 248
among strains, growth rates for the six strains capable of growth in liquid medium were 249
determined at seven different temperatures, ranging from 41 to 67 °C. Strains isolated 250
from different sites along the White Creek thermal gradient exhibited considerable 251
variation in the temperature dependence of growth (Fig. 3). Strains WC3-3 and WC5-1 252
exhibited similar thermal reaction norms for growth rate, with an optimum at or below 50 253
°C and no measurable growth at 58 °C (Fig. 3A, B). Strains WC3-1, WC3-4 and WC5-4, 254
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 12: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/12.jpg)
12
by contrast, exhibited optimal growth at either 55 or 58 °C but did not grow at 60 °C 255
(Fig. 3A, B). WC7-3 was the most thermotolerant strain, with maximal growth rate at 60 256
°C and growth at 65 °C (Fig. 3C). It also exhibited the broadest temperature range 257
permissive for growth. In fact, there was statistical evidence of borderline significance 258
for general positive correlations both between a strain’s optimal temperature and its 259
temperature range breadth (r = 0.82, P = 0.04; that is, the more thermotolerant a strain is, 260
the broader its thermal niche) and between maximal growth rate and temperature breadth 261
(r = 0.78; P = 0.06). WC7-3 exhibited the highest maximal growth rate in the data set 262
(2.1 doublings per day at 60 °C). This observation reflected a more general trend for 263
optimal temperature to be positively associated with maximal growth rate, though the 264
estimated Pearson correlation coefficient was not significant (r = 0.53, P = 0.28). Our 265
observation that, at lower temperatures, WC7-3 grew at rates comparable to other strains 266
further suggests that the extension of its thermal niche to a higher maximum cardinal 267
temperature came without a cost in performance at lower temperatures. 268
269
Discussion 270
Recent divergence of White Creek Chloroflexus. Like other phototrophs from alkaline 271
geothermal systems, the White Creek Chloroflexus OTU 10 lineage has genetically 272
differentiated. By contrast with 16S rRNA-divergent lineages of Synechococcus and 273
Chloracidobacterium at White Creek, however, a more recent origin of Chloroflexus 274
OTU 10 strain diversity is indicated by their 100% sequence identity over a partial 16S 275
rRNA gene fragment. Together with the unique mcr and pcs alleles that were observed in 276
the White Creek population (Fig. 2), these sequence data favor the interpretation that 277
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 13: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/13.jpg)
13
there has been a comparatively recent adaptive radiation of Chloroflexus OTU 10 along 278
the White Creek temperature gradient. Data from additional geographic locations will be 279
required to more conclusively address whether diversification of these Chloroflexus 280
occurred within White Creek itself. 281
These differences in time scales of diversification among phototrophic bacteria 282
have implications for our understanding of the history of community structure and 283
dynamics in these systems. An early idea was that a tight producer-consumer 284
relationship between 16S rRNA defined lineages of Synechococcus and Chloroflexi (27) 285
drove their ancient co-evolution along the thermal gradients of these hot springs (28). 286
Our conclusion that the divergence of the White Creek Chloroflexus OTU 10 genotypes 287
occurred much later than the diversification of the three different 16S rRNA-defined 288
Synechococcus A/B lineages with which they collectively co-occur (10) instead suggests 289
that any co-evolved ecological interactions between these groups would have to have 290
developed more recently, during or following the diversification of Chloroflexus. 291
Together with more finely resolved investigations of the genetic diversity of 292
these systems, these results also suggest that the association between these two groups is 293
more dynamic than originally proposed. For example, the identity of the Chloroflexi 294
partner(s) can vary greatly between hot springs. Our understanding of these interactions 295
comes principally from Octopus Spring and Mushroom Spring, where, over a range of 296
temperatures that is similar to White Creek, Synechococcus co-occurs primarily with 297
Roseiflexus (29) rather than with Chloroflexus OTU 10. Moreover, reports of the 298
existence within a single hot spring of multiple, recently diverged Synechococcus 299
ecotypes with identical 16S rRNAs (30, 31) further raise the possibility that both the 300
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 14: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/14.jpg)
14
genetic and the ecological diversity of Synechococcus may vary among hot spring 301
communities. A potential consequence of the recent and idiosyncratic nature of these 302
Synechococcus-Chloroflexi associations is that the outcome of their ecological 303
interactions (e.g., whether they are primarily cooperative or competitive, which 304
metabolites are exchanged) may differ among hot springs. The recently proposed model 305
of cross-feeding of glycolate and fermentation products from Synechococcus to 306
Roseiflexus for the well-characterized Octopus Spring and Mushroom Spring systems 307
(32) emphasizes positive interactions. At both White Creek and Rabbit Creek, however, 308
pyrosequencing data showed that the relative abundance of the two groups are negatively 309
correlated (10), which suggests that the ecological interactions between these two groups 310
may be primarily competitive. Although cross-feeding and competition are not 311
necessarily mutually exclusive, these latter observations argue for a better understanding 312
of metabolite exchange for Synechococcus-Chloroflexi associations in other hot spring 313
communities to investigate the generality of the cross-feeding model. 314
In several respects, Chloroflexus OTU 10 diversity more closely resembles that of 315
the cyanobacterium Fischerella (Mastigocladus) laminosus, which co-occurs with 316
Chloroflexus in White Creek mats between temperatures of 39 and ~55° C (10). White 317
Creek M. laminosus strains also exhibit 100% sequence identity at the 16S rRNA locus 318
across a broad range of temperatures but are likewise genetically variable at more rapidly 319
evolving loci. In both populations, ecologically divergent population members are 320
restricted to different locations along the thermal gradient (25). Recombination has 321
played an important role in producing genetic variation in M. laminosus (33), and future 322
studies can address whether this is also generally the case for Chloroflexus, as we have 323
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 15: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/15.jpg)
15
observed at the pcs locus. 324
325
Chloroflexus OTU 10 ecological variation and the nature of trade-offs in 326
thermotolerance. Theories of the evolution of environmental tolerance (e.g., 3) 327
commonly assume that the area under organism fitness curves (e.g., the thermal reaction 328
norms for growth rate in Fig. 3) remains constant during diversification. Implicit in this 329
assumption is a “jack-of-all-trades is a master-of-none” generalist-specialist trade-off, in 330
which an extension in niche breadth necessarily comes at the cost of a reduction in 331
maximal performance. In fact, however, it is possible for generalists to maintain high 332
relative fitness across a wide range of temperatures (that is, a “jack-of-all-temperatures” 333
can be “master of all"; 34), and, in some cases, no correlation or even a positive 334
correlation between maximal performance and thermal niche breadth has been reported 335
(35-37). This was the case for our study, for which we observed both a “master of all” 336
phenotype for strain WC7-3 and a general positive correlation of borderline statistical 337
significance between maximal performance and temperature breadth. Whether such a 338
“master-of-all” distribution is actually realized in situ remains to be investigated and will 339
require greater sampling of Chloroflexus OTU 10 diversity than was achieved in the 340
present study. 341
In addition, the significant positive correlation between optimal temperature and 342
niche breadth is in accord with the related observation that “hotter is broader” for some 343
microorganisms, including G4 phage (37, 38) and E. coli propagated in a variable thermal 344
environment (39). As for the relationship discussed above between maximal 345
performance and the breadth of the thermal niche, this result is at odds with a presumed 346
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 16: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/16.jpg)
16
generalist-specialist tradeoff, and its mechanistic basis remains unclear. 347
Finally, our study also bears on the "hotter is better" hypothesis (40), which has 348
been proposed to explain why organisms with relatively high optimal temperatures 349
generally have relatively high maximal performance. The hypothesis is based on the 350
thermodynamic argument that reaction rates are higher at increased temperatures, thereby 351
enhancing performance measures including growth rate. A majority of case studies 352
representing diverse taxa, including phages, bacteria, plants and animals, supports the 353
hypothesis (41, 42). Although the correlation between optimal temperature and maximal 354
growth rate was not significant for the Chloroflexus OTU 10 data, the sign of the 355
estimated correlation was in the expected direction under this hypothesis. Interestingly, 356
thermophilic Synechococcus lineages from these alkaline geothermal systems appear to 357
be an exception: contrary to the predictions of the hotter is better hypothesis, 358
Synechococcus A/B strains adapted to the highest temperatures had the lowest maximal 359
performance (7,42). Because the most thermotolerant members of this group define the 360
upper temperature limit for photosynthetic metabolism, it raises the possibility that 361
“hotter is better” is less likely to apply to taxa approaching a fundamental evolutionary 362
constraint. 363
364
Concluding remarks. Our discovery of different degrees of ecological specialization 365
among strains raises challenging questions for future investigation regarding the factors 366
which shape the distribution and maintainence of Chloroflexus OTU 10 diversity at 367
White Creek. For example, do generalists like strain WC7-3 co-exist with less 368
thermotolerant genotypes at downstream sites? The comparable or greater fitness of 369
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 17: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/17.jpg)
17
WC7-3 at lower temperatures compared with more specialized strains suggests this 370
possibility (Fig. 3). If, however, more thermotolerant generalist lineages prove to be 371
restricted to more upstream regions of White Creek, then what is responsible for this 372
population structure? At the more downstream WC3 and WC5 sites, the predominant 373
cyanobacterium in the community is M. laminosus, whereas it is Synechococcus at WC7 374
(10). Downstream and upstream sites are also distinguished by differences in microbial 375
mat fabric: sites WC3 and WC5 are streamer mats, whereas WC7 is a laminated mat 376
more typical of these environments. Ultimately, consideration of the contribution of 377
ecological interactions with other community members or other physical and chemical 378
aspects of the environment may be required to understand the realized niches of different 379
members of the Chloroflexus OTU 10 population at White Creek. 380
381
Acknowledgments 382
This research was supported by National Science Foundation award number EF-0801999. 383
We thank Darla Carvey for her technical support and Jim Gannon and Winsor Lowe for 384
comments on earlier versions of the manuscript. We thank David Ward and an 385
anonymous reviewer for their insightful comments and suggestions. We gratefully 386
acknowledge the support of the National Park Service (study number YELL-05482). 387
388
389
References 390
1. Doebeli M, Dieckmann U. 2003. Speciation along environmental gradients. Nature 391
421:259-264. 392
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 18: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/18.jpg)
18
2. Kassen R, Rainey PB. 2004. The ecology and genetics of microbial diversity. 393
Annu. Rev. Microbiol. 58:207-231. 394
3. Lynch M, Gabriel W. 1987. Environmental tolerance. Am. Nat. 129:283-303. 395
4. Huey RH, Kingsolver JG. 1993. Evolution of resistance to high temperature in 396
ectotherms. Am. Nat. 142:S21-S46. 397
5. Elena SF, Lenski RE. 2003. Evolution experiments with microorganisms: the 398
dynamics and genetic bases of adaptation. Nature Rev. Genet. 4:457-469. 399
6. Bennett AF, Lenski RE. 2007. An experimental test of evolutionary trade-offs 400
during temperature adaptation. Proc. Natl. Acad. Sci. USA 104:8649-8654. 401
7. Miller SR, Castenholz RW. 2000. Evolution of thermotolerance in hot spring 402
cyanobacteria of the genus Synechococcus. Appl. Environ. Microbiol. 66:4222-403
4229. 404
8. Allewalt JP, Bateson MM, Revsbech NP, Slack K, Ward DM. 2006. Effect of 405
light and temperature on growth of and photosynthesis by Synechococcus isolates 406
typical of those predominating in the Octopus Spring microbial mat community of 407
Yellowstone National Park. Appl. Environ. Microbiol. 72:544-550. 408
9. Ferris MJ, Ward DM. 1997. Seasonal distributions of dominant 16S rRNA-409
defined populations in a hot spring microbial mat examined by denaturing gradient 410
gel electrophoresis. Appl. Environ. Microbiol. 63:1375-1381. 411
10. Miller SR, Strong AL, Jones KL, Ungerer MC. 2009. Bar-coded pyrosequencing 412
reveals shared bacterial community properties along the temperature gradients of 413
two alkaline hot springs in Yellowstone National Park. Appl. Environ. Microbiol. 414
75:4565-4572. 415
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 19: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/19.jpg)
19
11. Ochman H, Wilson AC. 1987. Evolution in bacteria: Evidence for a universal 416
substitution rate in cellular genomes. J. Mol. Evol. 26:74-86. 417
12. Pierson BK, Castenholz RW. 1974. A phototrophic gliding filamentous bacterium 418
of hot springs, "Chloroflexus aurantiacus", gen. and sp. nov. Arch.Microbiol. 419
100:5-24. 420
13. Hanada S, Hiraishi A, Shimada K, Matsuura K. 1995. Isolation of Chloroflexus 421
sp. and related thermophilic photosynthetic bacteria from hot springs using an 422
improved isolation procedure. J. Gen. Appl. Microbiol. 41:119-130. 423
14. Castenholz RW. 1988. Culturing methods for cyanobacteria. Methods Enzymol. 424
167:68-93. 425
15. Janssen PH. 2008. New cultivation strategies for terrestrial microorganisms, p. 426
173-192. In Zengler K (ed), Accessing uncultivated microorganisms. ASM Press, 427
Washington, DC. 428
16. Hanada S, Pierson B. 2006. The Family Chloroflexaceae. Prokaryotes 7:815-842. 429
17. Pitcher DG, Saunders NA, Owen RJ. 1989. Rapid extraction of bacterial genomic 430
DNA with guanidium thiocyanate. Lett. Appl. Microbiol. 8:151-156. 431
18. Lane D. 1991. 16S/23S rRNA sequencing, p. 115–147. In Stackebrandt E, 432
Goodfellow M (ed), Nucleic acid techniques in bacterial systematics. John Wiley 433
and Sons, Chichester. 434
19. Thompson J, Higgins D, Gibson T. 1994. CLUSTAL W: improving the 435
sensitivity of progressive multiple sequence alignment through sequence weighting, 436
positions-specific gap penalties and weight matrix choice. Nucleic Acids Res. 437
22:4673-4680. 438
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 20: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/20.jpg)
20
20. Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic 439
analyses with thousands of taxa and mixed models. Bioinformatics 22:2688-2690. 440
21. Posada D, Crandall KA. 1998. MODELTEST: testing the model of DNA 441
substitution. Bioinformatics 14:817-818. 442
22. Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of 443
phylogenetic trees. Bioinformatics 17:754-755. 444
23. Librado P, Rozas J. 2009. DnaSP v5: A software for comprehensive analysis of 445
DNA polymorphism data. Bioinformatics 25:1451-1452. 446
24. Excoffier L, Laval G, Schneider S. 2005. Arlequin (version 3.0): An integrated 447
software package for population genetics data analysis. Evol. Bioinform. Online 448
1:47-50. 449
25. Miller SR, Williams C, Strong AL, Carvey D. 2009. Ecological specialization in 450
a spatially structured population of the thermophilic cyanobacterium Mastigocladus 451
laminosus. Appl. Environ. Microbiol. 75:729-734. 452
26. Posada D, Crandall K. 2001. Intraspecific phylogenetics: Trees grafting into 453
networks. Trends Ecol. Evol. 16:37-45. 454
27. Ward DM, Tayne TA, Anderson KL, Bateson MM. 1987. Community structure 455
and interactions among community members in hot spring cyanobacterial mats. 456
Symp. Soc. Gen. Microbiol. 41:179–210. 457
28. Ward DM, Ferris MJ, Nold SC, Bateson MM. 1998. A natural view of microbial 458
diversity within hot spring cyanobacterial mat communities. Microbiol. Mol. Biol. 459
Rev. 62:1353-1370. 460
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 21: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/21.jpg)
21
29. Nübel U, Bateson MM, Vandieken V, Wieland A, Kühl M, Ward DM. 2002. 461
Microscopic examination of distribution and phenotypic properties of 462
phylogenetically diverse Chloroflexaceae-related bacteria in hot spring microbial 463
mats. Appl. Environ. Microbiol. 68:4593-4603. 464
30. Melendrez MC, Lange RK, Cohan FM, Ward DM. 2011. Influence of molecular 465
resolution on sequence-based discovery of ecological diversity among 466
Synechococcus populations in an alkaline siliceous hot spring microbial mat. Appl. 467
Environ. Microbiol. 77:1359-1367. 468
31. Becraft ED, Cohan FM, Kühl M, Jensen SI, Ward DM. 2011. Fine-scale 469
distribution patterns of Synechococcus ecological diversity in microbial mats of 470
Mushroom Spring, Yellowstone National Park. Appl. Environ. Microbiol. 77:7689-471
7697. 472
32. Ward DM, Castenholz RW, Miller SR. 2012. Cyanobacteria in geothermal 473
habitats, p. 39-63. In Whitton BA (ed), Ecology of cyanobacteria II: Their diversity 474
in space and time. Springer, Dordrecht. 475
33. Miller SR, Castenholz RW, Pedersen D. 2007. Phylogeography of the 476
thermophilic cyanobacterium Mastigocladus laminosus. Appl. Environ. Microbiol. 477
73:4751-4759. 478
34. Huey R, Herz P. 1984. Is a Jack-of-All-Temperatures a Master of None? Evolution 479
38:441-444. 480
35. Carrière Y, Boivin G. 1997. Evolution of thermal sensitivity of parasitization 481
capacity in egg parasitoids. Evolution 51:2028-2032. 482
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 22: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/22.jpg)
22
36. Palaima A, Spitze K. 2004. Is a jack-of-all-temperatures a master of none? An 483
experimental test with Daphnia pulicaria (Crustacea: Cladocera). Evol. Ecol. Res. 484
6:215-225. 485
37. Knies JL, Kingsolver JG, Burch, CL. 2009. Hotter is better and broader: Thermal 486
sensitivity of fitness in a population of bacteriophages. Am. Nat. 173:419-430. 487
38. Knies JL, Izem R, Supler KL, Kingsolver JG, Burch CL. 2006. The genetic 488
basis of thermal reaction norm evolution in lab and natural phage populations. PLoS 489
Biol. 4:e201. 490
39. Leroi AM, Lenski RE, Bennett AF. 1994. Evolutionary adaptation to temperature. 491
III. Adaptation of Escherichia coli to a temporally varying environment. Evolution 492
48:1222-1229. 493
40. Kingsolver JG, Huey RB. 2008. Size, temperature, and fitness: Three rules. Evol. 494
Ecol. Res. 10:251-268. 495
496 41. Frazier MR, Huey RB, Berrigan D. 2006. Thermodynamics constrains the 497
evolution of insect population growth rates: "Warmer is better". Am. Nat. 168:512-498
520. 499
42. Angilletta M, Huey R, Frazier M. 2010. Thermodynamic effects on organismal 500
performance: Is hotter better? Physiol. Biochem. Zool. 82:197-206. 501
502
503
504
505
506
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 23: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/23.jpg)
23
TABLE 1 Summary of Chloroflexus strains isolated with their field collection sites and dates
Strain Collection site (temperature) Collection date
WC3-1 White Creek 3 (47 °C) May 2009
WC3-2 White Creek 3 (47 °C) May2009
WC3-3 White Creek 3 (47 °C) July 2009
WC3-4 White Creek 3 (47 °C) July 2009
WC3-5 White Creek 3 (47 °C) July 2009
WC5-1 White Creek 5 (54 °C) May 2010
WC5-2 White Creek 5 (54 °C) May 2010
WC5-4 White Creek 5 (54 °C) May 2010
WC7-1 White Creek 7 (61 °C) May 2010
WC7-2 White Creek 7 (61 °C) May 2010
WC7-3 White Creek 7 (61 °C) May 2010
507
508
509
510
511
512
513
514
515
516
517
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 24: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/24.jpg)
SIAO443
WC strains
SHGT713SHHA633SHGT652
SHGT722SHGT620SHGT448SHGT639SHGT691
100/97SHGT652SHGT520
SHGT390
SHGT449
SHYC759SHGT533
SIAO533SHGT647SHGT686
SIAO400SHIH554SHIH704SHIH745SIAO433SHIH665SIAO521SIAO588SIAO410SHIH680SHIH695SIAO751SIAO411
100/100
100/100
0.1 substitutions / siteSIAO411SIAO617
SHIH616SHIH655
SHGT641SHYC509SHYC566SHYC605SHYC447Chloroflexus sp. 396-1 (AJ308498)
C. aggregans DSM9486 (AJ308499)C. aggregans MD-66 (D32255)
99/100
100/100 gg g ( )
C. aurantiacus DSM637(AJ308501)C. aurantiacus J-10-fl (CP000909)
100/100100/100
FIG 1 Chloroflexus 16S rRNA gene phylogeny including White Creek strains (bold) reconstructed by Bayesian inference and outgroup-rooted with Roseiflexus
( h ) l d i b bili i f hsequences (not shown). Values at nodes represent posterior probabilities from the Bayesian analysis followed by maximum likelihood bootstrap values for 100 bootstrap replicates. Origins of Yellowstone metagenome sequences are distinguished as follows: White Creek (green), “Bath Lake Vista Annex “(blue), Chocolate Pots (yellow) and Mushroom Spring (brown).
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 25: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/25.jpg)
TCGGGTCAGTGGTTCTTCAACTTTTGACCATCGCCCGCTT TCGGACTGACAGTTCTTCAACTTTTGACCATCGTTTATCC
Allele
WC3 / WC5WC7-3
A
CTCGACTGACAGTCCCCTCGGTCCCACGCGACGTTTATCCTCGAGTCAGCGAGCATTTCGGCCCCACGTGATATTTATCC
WC7-1 / WC7-2BLVA
B
68
1313
WC3 / WC5 WC7-3
568BLVA WC7-1 / WC7-2
FIG 2 (A) Alignment of the 40 variable nucleotide sites (among 657 aligned nucleotides) in the pcsalleles from White Creek (WC) and “Bath Lake Vista Annex” (BLVA). The WC7-3 allele has a mosaic structure, with alternating tracts of sequence identity with the WC3/WC5 (normal type) and the WC7 1/WC7 2 (boldface type) alleles respectively (B) Genealogical network of pcs allelesthe WC7-1/WC7-2 (boldface type) alleles, respectively. (B) Genealogical network of pcs alleles. Branch lengths are in units of number of nucleotide differences between a pair of nodes. The number of nucleotide differences between a pair of alleles is therefore the sum of the branch lengths separating them. Open nodes are alleles which were not observed in the sample.
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 26: AEM Accepts, published online ahead of print on 21 ...aem.asm.org/content/early/2012/12/14/AEM.02753-12.full.pdf · 36 strains of Chloroflexus OTU 10 ... 61 Park alkaline hot springs](https://reader031.vdocuments.mx/reader031/viewer/2022030410/5a9d20097f8b9a032a8b9ffe/html5/thumbnails/26.jpg)
1.5
2
2.5
3
WC3-1WC3-3WC3-4
A.
0
0.5
1
2.5
3
WC5-1B.
Do
ub
ling
s / d
ay
0.5
1
1.5
2
WC5-4
0
1.5
2
2.5
3
WC7-3C.
Temperature (°C)
0
0.5
1
40 45 50 55 60 65 70
FIG 3 Temperature dependence of exponential growth rates of Chloroflexus strains from sites (A) WC3, (B) WC5 and (C) WC7 , measured by the change in optical density at 660 nm. Error bars represent standard errors for triplicate samples.
on May 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from