actualitatea 961

16
ACTUALITATEA n Săptămânal pentru oameni inteligenţi n n www.ziarulactualitatea.ro n n Nr. 961 n Anul 20 n n 5 - 11 Februarie 2016 n 2 lei n SC WITEXT SA angajează 51 de persoane în specialitatea confecţioneri încălţăminte după cum urmează: l 1 brigadier (maistru confecţii încălţăminte); l 1 lansator l 1 CTC-ist l 2 persoane cusut strobel; l 20 cusători; l 22 montat manual (montat, căptuşit, răsfrânt, îndoit) l 3 croitori piele l 1 mecanic întreţinere Se solicită: l vechime minim 2 ani în domeniu l seriozitate l dorinţă de muncă Se oferă: l salariu atractiv l prime de producţie l tichete de masă l cazare în caz de nevoie Cererile se depun la secretariat S.C. Witext S.A. Lugoj, str. N. Titulescu, nr. 78. Informaţii la telefon 0256/351634. Administrator: Ing. Ioan Ambruş Pag. 8 Lugojul are, în acest an, un buget de 185.029.000 de lei (circa 41 de milioane de euro), care a fost aprobat de către cei 18 consilieri lugojeni prezenţi la şedinţă care a fost condusă de consilierul local Alin Tech (a absentat consilierul Diana Szucs). Bugetul din acest an a crescut cu aproape 22 de milioane de lei faţă de cel precedent, fiind cel mai mare din isto- ria Lugojului. Deşi au solicitat mai multe explicaţii privind alocarea sumelor şi a lucrărilor de investiţii, consilierii lugojeni au fost, în final, foarte mulţumiţi de bugetul propus de primarul Francisc Boldea. n După o şedinţă maraton, bugetul municipiului Lugoj pe anul 2016 a fost aprobat Pag. 2 „Bătrâneţea nu este decât un jurnal al întregii vieţi”, spu- nea odată cineva. Jurnalul vieţii lugojeanului Robert Gheor- ghe Stempel a ajuns la fila 100 şi conţine multe întâmplări. Începutul anului 2016 a găsit Primăria oraşului Făget cu un excedent bugetar de 1.126.455,65 lei. „Suntem mulţumiţi că am reuşit să încheiem anul 2015 nu doar fără nici o dato- rie, ci şi cu un fond de rulment de peste 1.000.000 lei, bani cu care vom reuşi să efectuăm lucrări de interes imediat pentru cetăţenii oraşului nostru”, spune primarul Marcel Avram. n Consilierii locali făgeţeni au votat în unanimitate proiectul de buget pe anul 2016 propus de primarul Marcel Avram n Robert Gheorghe Stempel, un om bogat în ani, şi-a trecut în contul personal 100 de file n Robert Papp a câştigat al 10-lea titlu consecutiv de campion naţional la lupte greco-romane Pag. 7 Pag. 4 Pag. 5 Pag. 10 Percheziţii la romii din Lugoj Iulian boţ, zis Viscol, şi fostul şef al Poliţiei Timiş au fost arestaţi pentru 30 de de zile

Upload: nicolae-silade

Post on 25-Jul-2016

304 views

Category:

Documents


13 download

DESCRIPTION

săptămânal pentru oameni inteligenţi

TRANSCRIPT

Page 1: Actualitatea 961

ACTUALITATEAn Săptămânal pentru oameni inteligenţi n n www.ziarulactualitatea.ro n

n Nr. 961 n Anul 20 n n 5 - 11 Februarie 2016 n 2 lei n

SC WITEXT SA angajează 51 de persoane în

specialitatea confecţioneri încălţămintedupă cum urmează:

l 1 brigadier (maistru confecţii încălţăminte); l 1 lansator l 1 CTC-ist l 2 persoane cusut strobel;l 20 cusători; l 22 montat manual (montat, căptuşit, răsfrânt, îndoit)l 3 croitori piele l 1 mecanic întreţinere

Se solicită:l vechime minim 2 ani în domeniul seriozitatel dorinţă de muncă

Se oferă:l salariu atractiv l prime de producţie l tichete de masă l cazare în caz de nevoie

Cererile se depun la secretariat S.C. Witext S.A. Lugoj, str. N. Titulescu, nr. 78. Informaţii la telefon 0256/351634.

Administrator: Ing. Ioan Ambruş

Pag.8

Lugojul are, în acest an, un buget de 185.029.000 de lei (circa 41 de milioane de euro), care a fost aprobat de către cei 18 consilieri lugojeni prezenţi la şedinţă care a fost condusă de consilierul local Alin Tech (a absentat consilierul Diana Szucs). Bugetul din acest an a crescut cu aproape 22 de milioane de lei faţă de cel precedent, fiind cel mai mare din isto-ria Lugojului. Deşi au solicitat mai multe explicaţii privind alocarea sumelor şi a lucrărilor de investiţii, consilierii lugojeni au fost, în final, foarte mulţumiţi de bugetul propus de primarul Francisc Boldea.

n După o şedinţă maraton, bugetul municipiului Lugoj pe anul 2016 a fost aprobat

Pag.2

„Bătrâneţea nu este decât un jurnal al întregii vieţi”, spu-nea odată cineva. Jurnalul vieţii lugojeanului Robert Gheor-ghe Stempel a ajuns la fila 100 şi conţine multe întâmplări.

Începutul anului 2016 a găsit Primăria oraşului Făget cu un excedent bugetar de 1.126.455,65 lei. „Suntem mulţumiţi că am reuşit să încheiem anul 2015 nu doar fără nici o dato-rie, ci şi cu un fond de rulment de peste 1.000.000 lei, bani cu care vom reuşi să efectuăm lucrări de interes imediat pentru cetăţenii oraşului nostru”, spune primarul Marcel Avram.

n Consilierii locali făgeţeni au votat în unanimitate proiectul de buget pe anul 2016 propus de primarul Marcel Avram

n Robert Gheorghe Stempel, un om bogat în ani, şi-a trecut în contul personal 100 de file

n Robert Papp a câştigat al 10-lea titlu consecutiv de campion

naţional la lupte greco-romane

Pag.7

Pag.4

Pag.5

Pag.10

Percheziţii la romii din Lugoj

Iulian boţ, zis Viscol, şi fostul

şef al Poliţiei Timiş au fost

arestaţi pentru 30 de de zile

Page 2: Actualitatea 961

2 HOTNEWS 5 - 11 FEBRUARIE 2016ACTUALITATEA

Spălătoria Auto AkieroLugoj, strada Ion Vidu, tel. 0768.454.236

O spălare de 25 lei include: interior-exterior, portbagaj, silicon, soluţie geamuri, soluţie cauciuc.

Informaţii şi programări la tel. 0768.454.236

spălat interior, exterior,

motor, curăţat tapiserie,

spălat covoare

by CRIVnCaricatura săptămânii Să mai şi gândim! nl „De aproape două mii de ani ni se predică să

ne iubim, iar noi ne sfâşiem.” mihai Eminescul „A iubi înseamnă să fii fericit de ceva: fără

condiţii, fără judecăţi, fără aşteptări.” barry Neil Kaufman

l „Nu ştiu unde duce drumul meu, dar merg mai bine când te ţin de mână.” Alfred de mussetl „Iubirea, ca şi lumina, nu rămâne ascunsă.”

rabindranath Tagorel „Nimeni nu va fi întrebat la ultima judecată

cât de mult a suferit, ci cât de mult a iubit.”richard Wurmbrand

l „Oamenii supravieţuiesc nu prin grija faţă de ei inşişi, ci prin iubirea celorlalţi faţă de ei.”

Lev Tolstoil „Există o singură măsură a iubirii: aceea de a

iubi fără măsură.” Sf. bernard de Clairvauxl „Dăruieşte-i persoanei pe care o iubeşti: aripi

pentru a zbura, rădăcini pentru a se întoarce şi motive pentru a rămâne.” Dalai Lama

PIZZA LA UŞA TA!Doar un telefon la 0256/357.981

şi în cel mai scurt timp cea mai bună pizza de la Domacris este la tine acasă sau la serviciu.

Vă oferim meniul zilei la comandă! Vizitează domacris.ro şi află mai multe.

Calitate şi tradiţie numai la Pizzeria Domacris din Lugoj!Str. Filaret barbu, Nr. 12.

Pizzeria

ESSIA DIMoD, STR. ZoRILoR nR. 3TEL. 0742.893.325; 0721.890.529

MoBILă LA PREţ DE PRoDUCăToR

Cele mai mici preţuri din oraş

Vineri, 29 ianuarie 2016, în Sala Capitol a Filar-monicii Banatul din Timişoara, PNL Timiş şi-a pre-zentat candidaţii la primăriile din judeţ, la Consiliul Local Timişoara şi Consiliul Judeţean Timiş. La în-tâlnire a participat şi copreşedintele partidului, Va-sile Blaga, dar şi Jose Manuel Barroso, fostul preşe-dinte al Comisiei Europene. Lista candidaţilor PNL la primăriile din judeţ: l Timişoara: Nicolae Robu l Lugoj: Ioan Ambruş l Buziaş: Munteanu Sorin l Făget: Avram Marcel l Balinţ: Marchevici Ma-ximilian l Bara: Lelea Ioan l Bârna: Balintoni Ni-colae l Belinţ: Laza Gheorghe Florin l Bethausen: Muntean Ioan l Boldur: Ardelean Calin l Coşteiu: Nicoli Catalin l Curtea: Iacob Dănuţ l Darova: Tili-hoi Sorin l Fârdea: Lupulescu Samuel l Găvojdia: Stoica Dănuţ Toma l Margina: Tuţac Crinel l Mă-năştiur: Lera Vasile l Nădrag: Moldovan Rozica l Ohaba Lungă: Peia Eugen l Remetea Mare: Chira Traian l Secaş: Mates Violeta l Ştiuca: Bejera Vasi-le l Tomeşti: Medelean Costel l Topolovăţu Mare: Neşcu Iosif - Ioan l Traian Vuia: Crîşciu Nicolae.

n Au fost validaţi candidaţii liberali la primăriile din judeţ

Lugojul are, în acest an, un buget de 185.029.000 de lei (circa 41 de milioane de euro), care a fost aprobat de către cei 18 consilieri lugojeni prezenţi la şedinţă care a fost condusă de consilierul local Alin Tech (a absentat consilierul Diana Szucs).

Bugetul din acest an a crescut cu aproape 22 de milioane de lei faţă de cel precedent, fiind cel mai mare din istoria Lugojului. Deşi au solicitat mai multe explicaţii privind alocarea sumelor şi a lucrărilor de investiţii, consilierii lugojeni au fost, în final, foarte mulţumiţi de bugetul propus de primarul Francisc Boldea.

Doar consilierii liberali s-au abţinut la votul subvenţiilor pentru transportul public de călători, precum şi la unele capitole de veni-turi, dorind astfel să-şi manifeste nemulţumirea faţă de modificarea coeficienţilor de impozitare, fapt ce a determinat creşterea taxelor şi impozitelor plătite de lugojeni.

Bugetul municipiului Lugoj în 2016 cuprinde 106 obiective de investiţii, pentru care a fost alocată o sumă considerabilă, de circa 89 de milioane de lei.

Pentru autoritatea executivă s-au alocat 7.366.750 de lei, pentru Serviciul Public Comunitar pentru Evidenţa Persoanelor - 373.700 de lei, pentru Serviciul Public de Desfacere Pieţe Târguri şi Oboare - 391.000 de lei, pentru Serviciul Administrare şi Întreţinere a Do-meniului Public - 1.700.000 de lei, pentru Poliţia Locală - 1.598.000 de lei, asistenţă socială - 9.327.280 de lei, pentru locuinţe, servicii şi dezvoltare publică - 33.725.930 de lei, pentru protecţia mediu-lui - 18.691.500 de lei, pentru transporturi - 22.879.270 de lei, pen-tru agricultură, silvicultură, piscicultură şi vânătoare - 884.000 lei, pentru sănătate - 1797.500 de lei, pentru cultură, recreere şi religie - 5.902.320 de lei (din care: Biblioteca Municipală, 278.440

lei; Muzeul de Istorie, Etnografie şi Artă Plastică, 349.180 lei; Şcoala Populară de Arte, 75.300 lei; Casa de Cultură a Municipi-ului, 985.000 lei; Galeria „Pro Arte”, 56.300 lei; sport, 829.000 de lei; Clubul Sportiv Municipal, 1.080.000 de lei; tineret, 74.000 lei; Cinematograful Bela Lugosi, 617.900 de lei; Centrul de Infor-mare Turistică, 44.000 de lei), iar 26.775.750 de lei au fost alocaţi învăţământului, astfel: 2.785.000 de lei pentru Centrul financiar Colegiul Naţional „Coriolan Brediceanu”; 2.801.000 de lei pen-tru Centrul financiar Colegiul Naţional „Iulia Hasdeu”; 3.134.000 de lei pentru Centrul financiar Liceul Tehnologic „Aurel Vlaicu”; 2.640.000 de lei pentru Centrul financiar Colegiul Tehnic „Val-eriu Branişte”; 1.586.000 de lei pentru Centrul financiar Şcoala Gimnazială nr. 2; 1.050.000 de lei pentru Centrul financiar Şcoala Gimnazială nr. 3; 1.365.000 de lei pentru Centrul financiar Şcoala Gimnazială nr. 4; 2.803.000 de lei pentru Centrul financiar Şcoala Gimnazială Nr. 6 „Anişoara Odeanu”; 1.498.000 de lei pentru Cen-trul financiar Şcoala Gimnazială „Eftimie Murgu”; 1.251.000 de lei pentru Centrul financiar Şcoala Gimnazială de Muzică „Filaret Barbu”; 413.000 de lei pentru Centrul financiar Şcoala Gimnazială Nr. 12 Măguri; 1.082.000 de lei pentru Centrul financiar Grădiniţa PP Nr. 2; 1.230.000 de lei pentru Centrul financiar Grădiniţa PP Nr. 4; 1.021.000 pentru Grădiniţa PP Nr. 5. S-au mai alocat fonduri pentru: iluminat public - 2.608.830 de lei; locuinţe - 7.245.800 de lei; alimentare cu apă - 9.614.500 de lei; canalizare – 16.934.000 de lei; salubritate – 997.500 de lei; reparaţii străzi – 3.367.000 de lei. La finalul şedinţei, preşedintele PNL Lugoj, Ioan Ambruş, a de-clarat că „bugetul propus de executiv este făcut strict pentru campa-nia electorală din iunie”, dar că acesta a fost aprobat de consilierii liberali „pentru binele lugojenilor”. mircea ANGHEL

După o şedinţă maraton, bugetul Lugojului pe anul 2016 a fost aprobat

E.ON Distribuţie România a investit considera-bil din 2005 până în prezent, pentru modernizarea şi extinderea a 295 km de reţele de distribuţie a gazelor naturale din judeţul Timiş, cele mai impor-tante investiţii fiind derulate la Timişoara, Moşniţa Nouă, Moşniţa Veche, Urseni, Albina, Lugoj, Giroc şi Dumbrăviţa. Pentru acest an, E.ON Distribu-ţie România are ca obiectiv modernizarea a circa 18 kilometri de conducte şi branşamente de gaze

naturale din judeţul Timiş, valoarea estimată a proiectelor de investiţii depăşind 3,6 milioane lei. Investiţii importante vor viza în acest an şi localită-ţile Lugoj şi Giarmata Vii, unde se vor moderniza în total peste 9 kilometri de reţea de gaze natura-le. La nivelul întregii companii, prezentă în 20 de judeţe, reţeaua de gaze naturale a fost moderni-zată (înlocuire conducte şi protecţie catodică) pe o lungime de aproape 6.350 de kilometri şi a fost extinsă pe o lungime de circa 1.250 de kilometri. Efortul investiţional al E.ON în cei 10 ani de pre-zenţă în România a totalizat peste 5,12 miliarde de lei (aproximativ 1,3 miliarde de euro). Creşterea si-guranţei consumatorilor depinde în egală măsură de modernizarea reţelei şi de modul în care sunt folosite diversele surse de energie. N. SILADE

n E.on România a investit 55 milioane de lei în judeţul Timiş

Page 3: Actualitatea 961

3PRIM PLAn5 - 11 FEBRUARIE 2016 ACTUALITATEA

APARATURă DE ULTIMă GEnERAţIE, analizoare complet automate, la standarde internaţionale, pentru: BIoCHIMIE, HEMAToLoGIE, IMUnoLoGIE, MICRoBIoLoGIE, PARAZIToLoGIE.

Laborator de analize medicale

recoltări analize: între orele 8 - 11, Eliberare rezultate: între orele 15 – 16.

Peste 80 de tipuri de analize, la cele mai mici

preţuri din oraş.

Pentru majoritatea analizelor, rezultatele se obţin în aceeaşi zi.

Informaţii/programări la tel: 0256/358.617, între orele 8-19

Şef laborator: Dr. Camelia BrînzeiCabinet oRL: Dr. Cev Pavel, medic primar

Cabinet Pediatrie: Dr. Cev Elena, medic primarATI: Dr. Radu Delia, medic primar

Cabinet Cardiologie: Dr. Sima Daniela, medic primar; Dr. Biro Codruţa, medic specialist

Cabinet Gastroenterologie: Dr. Cev Elena Zenovia, medic specialist, doctor în Ştiinţe Medicale

Cabinet Alergologie: Dr. Brisan-Igna Diana, medic specialistCabinet Endocrinologie: Dr. Şalapa Magdalena, medic specialistCabinet Dermato-Venerologie: Dr. Jumanca Miriam, medic specialistCabinet nutriţie şi Dietetică: Bojboi Gabriel, nutriţionist

CEnTRUL MEDICAL DR. CEVLugoj, str. Făgăraş nr. 3, tel.: 0256/358617; fax.: 0356/459271; e-mail: [email protected]

noU ! Analize gratuite non-stop, cu bilet de trimitere ! noU !

Casa de Cultură a SindicatelorLugoj, str. Nicolae bălcescu nr.1

InSTITUţIE AUToRIZATă DE CăTRE MInISTERUL MUnCII, FAMILIEI ŞI EGALITăţII DE ŞAnSEorganizează cursuri de calificare

pentru următoarele meserii:

l operator calculator l contabil l bucătar l inspector resurse umane l formator l fierar-betonist l îngrijitor persoane

vârstnice la domiciliu l comerciant - vânzător mărfuri alimentare l comerciant – vânzător mărfuri nealimentare l zidar – pietrar – tencuitor l stivuitorist l ospătar l barman l cofetar – patiser l sudor l mecanic auto l instalator instalaţii sanitare şi gaze l

măcelar l lucrător social l dulgher – tâmplar – parchetar l tâm-plar universal l brutar l lăcătuş mecanic l electrician constructor l mozaicar – faianţar l tapiţer l montator pereţi şi plafoane din ghips carton l îngrijitoare copii l inspector protecţia muncii l

confecţioner cablaje auto l lucrător în confecţii piele şi înlocuitori l lucrător în cultura plantelor l lucrător în creşterea animalelor l

Informaţii şi înscrieri: Lugoj, str. n. Bălcescu nr.1,zilnic 8 - 14, tel.: 0256/353.253.

După o şedinţă maraton, bugetul Lugojului pe anul 2016 a fost aprobat Marţi, 2 februarie 2016, în jurul orelor 18:28,

un bebeluş de doar câteva luni şi-a pierdut viaţa într-un accident de circulaţie produs în apropiere de localitatea Balinţ.

Tragedia a avut loc pe şoseaua care face legătura între autostrăzile A1 şi A6. Conform spuselor poliţiştilor, accidentul a fost produs chiar de către tatăl copilului, un cărăşan aflat la volanul unui autoturism BMW, care a pătruns pe contrasens, iar maşina condusă de acesta a intrat în coliziune cu un alt autoturism, care circula regulamentar spre Lugoj. În urma impactului deosebit de violent, copilul şoferului din Caraş-Severin, care se afla în braţele mamei, a fost rănit grav. Micuţul a fost transportat de urgenţă la spital, însă medicii nu au reuşit să-i salveze viaţa. În accident a fost rănit şi şoferul maşinii care circula regulamentar. Circulaţia pe drumul de legătură între A1 şi A6 a fost oprită mai mult de o oră. (A. P.)

un bebeluş de doar opt luni şi-a pierdut viaţa într-un accident pe drumul dintre A1 şi A6

n Un biciclist a fost lovit de un şofer neatent

Joi, 29 ianuarie 2016, un octogenar, care circula pe bicicletă, a fost rănit grav în urma unui accident rutier produs pe strada Bocşei din Lugoj. Conform spuselor poliţiştilor, biciclistul circula aproape de axul drumului, intenţionând să vireze la stânga, în momentul când a fost acroşat de un autoturism. Victima a fost transportată în stare gravă la spital. În cauză a fost întocmit un dosar penal pentru vă-tămare corporală din culpă. (A. P.)

un microbuz cu olteni s-a răsturnat în sensul giratoriu

Duminică, 31 ianuarie 2016, pasagerii unui microbuz au văzut moartea cu ochii după ce autovehiculul în care aflau s-a răsturnat în sensul giratoriu de la ieşirea din Lugoj spre Caransebeş. Şoferul microbuzului, un bărbat din Mehedinţi, care tracta o platformă pe care se afla un alt autovehicul, a pierdut controlul maşinii, care a părăsit carosabilul şi s-a răsturnat pe câmp, împreună cu platforma pe care o tracta. Din fericire, pasagerii microbuzului s-au ales doar cu o sperietură zdravănă şi răni minore. (A. P.)

un TIr încărcat cu dulciuri a rupt un gard şi s-a oprit într-un stâlp

În noaptea de joi spre vineri, 29 ianuarie 2016, un TIR încărcat cu dulciuri a intrat cu viteză într-o curbă din localitatea Coşteiu, şoferul a frânat, însă mastodontul a derapat şi, scăpat de sub control, a părăsit carosabilul, a rupt gardul unei proprietăţi şi s-a oprit într-un stâlp de electricitate. Conducătorul auto le-a declarat poliţiştilor că a încercat să evite coliziunea cu un autoturism care circula din sens opus şi care ar fi pătruns pe banda sa de mers.

În momentul în care a frânat, autotrenul a intrat în balans şi nu a mai putut fi controla, a smuls dalele de pe trotuar şi a rupt gardul unui imobil, după care s-a oprit într-un stâlp de iluminat public.

Şoferul nu a fost rănit, dar a fost nevoit să aşteptat ceva vreme până când un utilaj a sosit la faţa locului pentru a repune TIR-ul pe şosea. Poliţiştii au demarat o anchetă pentru a stabili cauzele producerii accidentului. (A. P.)

O şoferiţă neatentă a provocat un accident grav la Găvojdia

Sâmbătă, 30 ianuarie 2016, în jurul orei 9:11, încă un accident de circulaţie cu urmări grave a avut loc pe DN 6, în apropierea localităţii Găvojdia. Accidentul s-a produs din cauza unei şoferiţe neatente. Maşina condusă de aceasta, un Volkswagen Golf, a intrat de pe un drum lăturalnic pe drumul naţional care leagă Lugojul de Caransebeş, fiind izbită în plin de un Logan, care circula regulamentar. În urma impactului, ambele autoturisme au fost avariate, iar şoferiţa şi o altă femeie, pasageră în cealaltă maşină, au ajuns la spital cu multiple

traumatisme. În cauză a fost deschis un dosar penal pentru vătămare corporală din culpă. (A. P.)

un tâlhar dat în urmărirenaţională a fost reţinut de poliţiştii lugojeni

Poliţiştii lugojeni au depistat un bărbat de 23 de ani dat în urmărire naţională, care a fost condamnat la închisoare pentru comiterea infracţiunii de tâlhărie. Pe numele bărbatului, Judecătoria Lugoj a emis, la data de 11 decembrie 2015, un mandat de executare a pedepsei închisorii, prin care acesta este condamnat la 4 ani şi 4 luni de pedeapsă privativă de libertate pentru comiterea infracţiunii de tâlhărie. Bărbatul a fost introdus în Penitenciarul Timişoara pentru executarea pedepsei. (A. P.)

n Un Mercedes a luat foc pe strada nicolae Bălcescu

Miercuri, 27 ianuarie 2016, în jurul orei 22:41, un autoturism a fost cuprins de flăcări în faţa unui centru comercial din Lugoj. Pompierii lugojeni au fost solici-taţi să intervină pentru stingerea unui incendiu care a cuprins un autoturism Mercedes în care se aflau două persoane. În timp ce se deplasa pe strada Nicolae Băl-cescu, din Lugoj, şoferul a simţit miros de ars şi a ob-servat că iese fum din compatimentul motor al maşinii. Fără să îşi piardă cumpătul, acesta a reuşit să lichideze focul, cu ajutorul extinctorului din dotare. Din câte se pare, incendiul ar fi pornit de la instalaţia care încălzeş-te apa pentru şpriţuitoarele de parbriz. (A. P.)

n Poliţiştii lugojeni au depistat trei hoţi de biciclete

Poliţiştii municipiului Lugoj au depistat trei minori, cu vârste cuprinse între 14 şi 15 ani, bănuiţi de comi-terea mai multor furturi de biciclete pe raza munici-piului. Pe numele acestora a fost întocmit dosar penal, prejudiciul fiind recuperat în totalitate de poliţişti. La data de 26 ianuarie 2016, poliţiştii lugojeni au depistat doi minori, de 14 şi 15 ani, bănuiţi de furtul unei bici-clete din casa scării unui imobil situat pe raza muni-cipiului. Extinzând cercetările, la data de 29 ianuarie 2016, poliţiştii au stabilit că, în perioada 21 - 23 ianua-rie 2016, bănuiţii, împreună cu un alt tânăr de 15 ani, ar fi pătruns într-o societate comercială şi în boxele a două imobile, iar din interior ar fi sustras patru bici-clete şi băuturi alcoolice. Prejudiciul a fost recuperat în totalitate de poliţişti, bunurile fiind restituite pă-gubiţilor. În cauză a fost întocmit dosar penal sub as-pectul săvârşirii infracţiunii de furt calificat. Poliţiştii continuă cercetările în vederea documentării întregii activităţi infracţionale a bănuiţilor. (A. P.)

Page 4: Actualitatea 961

4 SoCIAL 5 - 11 FEBRUARIE 2016ACTUALITATEA

Şcoala de şoferiAUTO NICU

Str. Nicolae bălcescu Nr. 5Tel.: 0722.376.133

Şcoala de şoferi Auto nicu organizează cursuri de conducere auto categoria B, pentru persoane

cu permis şi care nu au condus o perioadă de timp. De asemenea, organizăm consultaţii la

disciplina “Legislaţie rutieră”, teste, chestionare etc., pe calculator, asigurând reuşita la examen.

Informaţii la sediul firmei (lângă magazinul Carrefour) sau la telefon: 0722.376.133.

SC RAMILGIPS SRL Strada Crişan Nr. 40, telefon 0256/396197

l vopsele colorate l maşină de colorat Caparol l Tencuieli colorate, toate tipurile Caparol

l Sisteme ghips cartonl Adeziv gresie şi faianţăl Tencuieli mecanizate

baumit, Knaufl Instalaţii electricel Tinciuri Lasselsberger Knaufl Hidroizolaţii murexinl Termosisteme Austrotherm

Toate adevărate? şi la toate produsele?1 leu este preţ mare? 0.99 este mic?

ÎnAInTE DE A CUMPăRA: sanitare, chimicale, feronerie, PVC, fitinguri şi ţevi, vopsele, electrice, materiale curăţenie, adezivi, materiale construcţii, nisip, cuie, teracote, polistiren, plexic, non azbest, carbid etc.

CoMPARAţI ŞI PREţURILE noASTRE!Cargo Com Parc

La Parcul George Enescu, tel.0256.35.69.69

Artişti lugojeni în slujba ThalieiActorul, profesorul, traducătorul şi dramaturgul Iosif Vanciu (2)

„Unul din cei mai buni Caţavencu pe care i-am văzut.” (Petru Comarnescu)

După finalizarea studiilor primare şi gimnaziale în oraşul adoptiv, Iosif Vanciu ia calea Bucureştilor, unde se înscrie la medicină veterinară şi Drept, frecventând, în paralel, cursurile de actorie ale lui Constantin Nottara, al cărui student favorit devine. După o stagiune petrecută în Capitală (1919-1920) se transferă la nou înfiinţatul Teatru Naţional clujean (i-a avut colegi de scenă pe Titus Lapteş, Magda Tîlvan, Mary Cupcea, Lică Rădulescu), iar mai târziu, după pensionarea lui Neamţu-Ottonel, devine profesor la catedra de actorie a Academiei de Muzică şi Artă Dramatică, unde, alături de Lilly Bulandra şi N. Voicu, contribuie la formarea unei viitoare generaţii de actori profesionişti: N. Sassu, Rodica Daminescu, Olimpia Arghir,

Maricica Blănaru-Russu, Maria Săniuţă, Petrică Popa. A colaborat cu Opera Română din Cluj, interpretând rolurile Paşa Selim din Răpirea din Serai de Mozart (14 spectacole), Nowotny din opereta Casa cu trei fete de Schubert–Berté (3) şi Njegus din Văduva veselă de Fr. Lehár (25).

Personalitatea artistică a lui Iosif Vanciu s-a manifestat, cu aceeaşi exigenţă, pe multiple planuri: a fost, deopotrivă, autor dramatic,

traducător (din limbile germană şi engleză) şi director de scenă. A tradus, pentru întâia oară în limba română, Potopul de H. Berger, montat, în premieră, pe scena Teatrului Naţional din Cluj la sfârşitul anului 1928 (textul dramaturgului american va cunoaşte o nouă versiune în limba română, în 1944, datorată lui Mihail Sebastian – vezi Potopul. Valuri, valuri, în „Realitatea evreiască”, Bucureşti, 280-281, 2007, VI, Ediţie specială). Din repertoriul şi creaţia dramatică ale actorului lugojean reţinem: rolul Mitrici din Puterea întunericului de Lev Tolstoi (19 octombrie 1926, premieră, în regia lui Sică Alexandrescu), rolul Relling din Raţa sălbatică de H. Ibsen (6 martie 1934), Verde cu două stele, piesă în patru acte de Iosif Vanciu (14 mai 1940), Femeia nimănui de Cesare Vico Lodovici (cu o cronică semnată de George Sbârcea în „Gazeta ilustrată”, Cluj, IX, 5-6, 1940, 41-42). În stagiunea 1939-1940 s-a aflat şi în postura de director de scenă în Cuibul de viespi (scenariu după Al Kiriţescu), Hocus-Pocus (comedie în trei acte de Kurt Götz, traducere de Iosif Vanciu) şi Mansarda (spectacol regizat de Emil Bobescu).

În zilele de 15 şi 16 iulie 1922, uniţii lugojeni au trăit clipe de emoţie şi înălţare sufletească: instalarea noului episcop diecezan de Lugoj, PS dr. Alexandru Nicolescu. Corul catedral lugojean (împreună cu Reuniunea ortodoxă) s-a implicat în festivităţile primirii la gară şi în susţinerea unei serenade, urmate de o retragere cu torţe, în faţa Palatului Episcopal. În cinstea evenimentului, în 16 iulie, la Teatrul Orăşenesc s-a organizat un concert, susţinut de cele două corale surori, „Lira” (Reîntoarcerea acasă şi Brumărelul de Iacob Mureşianu) şi Reuniunea Română de Cântări şi Muzică (Pentru ce, Doamne şi Preste deal de Ion Vidu). La reuşita manifestării muzicale au contribuit Traian Grozăvescu (cu un recital de

arii din opere) şi doi actori (de obârşie lugojeană) ai Teatrului Naţional din Cluj, care au oferit un program cu recitări din lirica românească: Iosif Vanciu (Hristos a Înviat de Alexandru Vlahuţă) şi Ioan Ţenchea (versuri de Victor Vlad Delamarina). În finalul concertului, corurile reunite au interpretat Ana Lugojana şi Pui de lei de Ion Vidu, sub bagheta lui Ioan Bacău (vezi „Răsunetul”, Lugoj, I, 10, 1922).

După tragica dispariţie a lui Traian Grozăvescu (15 februarie 1927), Iosif Vanciu a semnat o adresă transmisă Primăriei lugojene, în numele actorilor Teatrului Naţional din Cluj (director: Zaharia Bârsan), în care expunea oferta instituţiei din inima Ardealului privind contribuţia la constituirea Fondului „Traian Grozăvescu”, destinat realizării bustului marelui tenor (vezi Duşan Baiski, Lugoj. Studii monografice, Editura Artpress, Timişoara, 2015, p. 39-40).

Iosif Vanciu, reprezentant de frunte al artei teatrale româneşti, apreciat pe cele mai importante scene pentru amploarea şi multitudinea preocupărilor sale dedicate scenei, dar şi pentru originalitatea artei sale interpretative, este astăzi, din păcate, un nume cvasinecunoscut. Un subiect tentant de cercetare pentru un prezumtiv biograf, care să-l aşeze la loc de cinste în galeria marilor artişti lugojeni. Constantin-T. STAN

Dragoş şi Galescu l-au înlocuit pe FărcăgeanuÎn şedinţa de joi, 28 ianuarie 2016, a Consiliului

Local Lugoj, Ivan Dragoş (PNL) şi Cristian Galescu (PSD) l-au înlocuit pe Adrian Fărcăgeanu (fost PNL, fost PSD). Primul i-a preluat mandatul de consilier local, cel de-al doilea l-a înlocuit în funcţia de viceprimar. Ivan Dragoş are 36 de ani, a terminat Facultatea de Mecanică din Timişoara şi a mai fost consilier local, în două mandate, între 2004-2008, 2008-2012, din partea PD şi PDL. Cristian Galescu are 34 de ani, este economist, cu masterat în management financiar şi conduce organizaţia de tineret a PSD Lugoj, fiind reales pe această funcţie în luna mai 2015. Dacă validarea mandatului de consilier local în Consiliul Local al Municipiului Lugoj a lui Ivan Dragoş s-a făcut cu unanimitate

de voturi, în cazul alegerii viceprimarului municipiului Lugoj, cele două propuneri, Alin Tech, din partea PNL, şi Cristian Galescu, din partea PSD, au fost votate diferit de către consilierii locali. Câştig de cauză a avut Galescu (11 voturi, din cele 18 valide, unul fiind anulat), care a devenit astfel, cu doar patru luni înainte de alegerile locale, noul viceprimar al oraşului. Chiar dacă votul a fost secret, după nişte replici indecente între consilierii Nicu Bădina (PSD) şi Albin Gaidoş (PNL), social-democratul a ţinut să replice că nu consilierii PSD au trădat, ci unul de la PNL (o referire, probabil, la votul anulat). Pe site-ul Primăriei Lugoj însă, locul viceprimarului este încă vacant. Nicolae SILADE

Luni, 1 februarie 2016, procurorii DNA au des-cins, împreună cu ofiţerii DGA şi trupele speciale ale Jandarmeriei, la două locaţii din Lugoj, situa-te pe străzile Timişoarei (lângă fosta Filatură de Mătase Naturală) şi Caransebeşului (vizavi de benzinăria Mol). Cele două imobile aparţin fami-liei lui Iulian Boţ, zis Viscol, liderul unui clan de romi şi nepotul bulibaşei. Nu mai puţin de şapte maşini cu mascaţi au fost trimise la Lugoj, patru pe strada Timişoarei, iar trei pe strada Caransebe-şului. Acţiunea procurorilor DNA şi a poliţistilor de la DGA s-a desfăşurat în 13 locaţii din judeţul

n Iulian Boţ, zis Viscol, şi fostul şef al Poliţiei Timiş au fost arestaţi pentru 30 de de zile

Timiş, două la sediile unor instituţii publice, re-stul la domiciliile unor persoane fizice. Cei vizaţi de ancheta desfăşurată la sediul Poliţiei Timiş au fost comisarul şef Dumitru Pavel, şeful Serviciului de Investigare a Criminalitatii Economice, şi co-misarul şef Sorin Munteanu, fostul şef al Poliţiei Timiş. Anchetatorii DNA au cercetat modul în care s-a făcut ancheta în mai multe dosare eco-nomice, pe baza unor probe din care reiese că s-a dat şpagă pentru rezolvarea dosarelor. În dosarul în cauză, figurează şi avocatul Marin Bâlc, cerce-tat în libertate sub control judiciar, fiind acuzat de constituirea unui grup infracţional organizat, tra-fic de influenţă, instigare la dare de mită şi favo-rizarea făptuitorului. Iulian Boţ, Dumitru Pavel şi Sorin Munteanu au fost prezentaţi Curţii de Apel Timişoara cu propunere de arestare preventivă pentru 30 de zile, Sorin Munteanu fiind acuzat de constituirea unui grup infracţional organizat, lua-re de mită, instigare la dare de mită şi favorizarea făptuitorului, Dumitru Pavel de constituirea unui grup infracţional organizat, luare de mită, trafic de influenţă şi complicitate la luare de mită, iar

Iulian Boţ de constituirea unui grup infracţional organizat, evaziune fiscală, în formă continuată, dare de mită şi cumpărare de influenţă. În faţa instanţei, doi dintre inculpaţi, comisarul şef Du-mitru Pavel şi Iulian Boţ, şi-au recunoscut fap-tele, în vreme ce fostul şef al Poliţiei Timiş, Sorin Munteanu, şi-a folosit dreptul la tăcere. Marţi, 2 februarie 2016, Curtea de Apel Timişoara a decis arestarea pe 30 de zile a lui Sorin Munteanu şi a lui Iulian Boţ, comisarul şef Dumitru Pavel fiind plasat în arest la domiciliu. (A. P.)

Page 5: Actualitatea 961

5SoCIAL5 - 11 FEBRUARIE 2016 ACTUALITATEA

S.C. Meridian 22 SA are în desfăşurare în această perioadă acţiunea de remitere a preavizelor de debranşare pentru toţi titularii de contracte care înregistrează facturi restante către societatea noastră şi care locuiesc la blocuri.Menţionăm că după expirarea perioadei legale înscrisă în preavizul de debranşare, pentru toţi restanţierii se va trece la întocmirea şi înaintarea dosarului către instanţă. Solicităm pe această cale ca persoanele care înregistrează sume restante să achite aceste sume la caseria societăţii, deschisă zilnic după următorul program:

Luni: 8 – 16 marţi: 8 – 18 miercuri: 8 – 16 Joi: 8 – 18 Vineri: 8 – 16

Conducerea SC mErIDIAN 22 SA

AnUnţ IMPoRTAnT

Lugoj, str. Traian Grozăvescu nr. 12,

tel./fax: 0256 / 356 583www.husanu.ro

HUŞAnUMARMURă ŞI GRAnIT

n travertin/calcar/onix/compozitn placaje, pardoseli, glafuri, blaturi, mobilier, şemineuri, monumente funerare

n recondiţionări arhitecturale, monumentale, pardoseli

n gravuri foto-ceramicăn soluţii pentru întreţinerea

pietrei naturale.

Începutul anului 2016 a găsit Primăria oraşului Făget cu un excedent bugetar de 1.126.455,65 lei, care vor fi folosiţi după cum urmează:

INVESTIŢII PE ANuL 2016 DIN FONDuL DE ruLmENT

Parcare Unicarm 15.000 leiParcare pe str. Avram Iancu 1.605 mp x 145,91= 235.000 leiParcări pe Calea Lugojului 276.455,65 leiParcare pe str. Independenţei 70.000 leiParcare turnul apă str. Piaţa Libertăţii 90.000 leiAsfalt str. Traian Vuia şi parcare în faţa Liceului 130.000 leiAsfalt str. Avram Iancu 240.000 leiParcare str. Piaţa Libertăţii 70.000 lei

TOTAL 1.126.455,65 lei

„Suntem mulţumiţi că am reuşit să încheiem anul 2015 nu doar fără nici o datorie, ci şi cu un fond de rulment de peste 1.000.000 lei, bani cu care vom reuşi să efectuăm lucrări de interes imediat pentru cetăţenii oraşului nostru”, spune primarul Marcel Avram.

INVESTIŢII DE rEALIZAT ÎN ANuL 2016 DIN FONDurI PrOPrII

Capitolul străziPavaj: str. Dionisie Păscuţiu (partea dreaptă) 45.000 leistr. Eftimie Murgu (ambele sensuri) 140.000 leistr. Ştefan cel Mare (partea dreaptă sens Cimitir) 100.000 leistr. Piaţa Libertăţii (str. C. Brediceanu - str. Stadionului) 60.000 leistr. Avram Iancu ( partea stângă sens Piaţă) 70.000 leisat Bichigi (1.500mp) 135.000 leisat Begheiu Mic (1.500 mp) 135.000 lei

Capitolul DrumuriAsfalt intravilan Băteşti 530.000 leiAsflat Băteşti până la Cimitir 215.000 leiAsfaltare intravilan Jupâneşti 185.000 leiPod Băteşti 400.000 leiPietruire drum Povergina – Bunea Mare 70.000 leiReparaţii drum Bichigi – Povergina 100.000 lei

Capitolul ParcuriParcul Copilului Centru (complexe de joacă, supraveghere video) 120.000 leiParc Partea Românească (fântână arteziană, bănci, lampioane) 170.000 lei

Capitolul reparaţiiReparaţii exterioare Biblioteca Orăşenească 60.000 leiTronson III energie electrică Colonia Mică 150.000 leiAnvelopă termică clădire clasele I-IV, geamuri termopan 130.000 lei

Capitolul AchiziţiiAchiziţionare 2 maşini tuns iarba pe combustibil 10.000 leiAchiziţionare 2 trimere 9.000 lei

TOTAL 2.834.000 lei

„Sunt mulţumit că domnii consilieri au apreciat Proiectul de Buget pe anul 2016 ca fiind unul echilibrat şi pentru că l-au votat în unanimitate”, mai spune primarul.

Consilierii locali făgeţeni au votat în unanimitate proiectul de buget pe anul 2016 propus de primarul marcel Avram

Vlad Neagoe, un medic artist şi “rezident de nota 10”, îi ajută pe copiii orfani în timpul liber

Vlad Neagoe, din Coşteiu, un medic rezident pasionat de medicină şi artă, va fi premiat în cadrul unei campanii inedi-te ce are ca scop încurajarea practicării medicinei în România şi oprirea exodu-lui doctorilor în străinătate. Campania

se numeşte “rezident de nota 10”, iar în cadrul acesteia este premiat săptă-mânal câte un medic rezident pasionat de profesia sa, care în timpul liber are activităţi demne de laudă. Vlad Neagoe va primi o diplomă, o insignă şi un stilou

inscripţionat cu numele cam-paniei “rezident de nota 10” duminică, 7 februarie, de la ora 12, în Amfiteatrul A al Spitalului Judeţean Timişoa-ra. Vlad Neagoe este medic rezident anul II în cadrul Cli-nicii de Chirurgie Vasculară. Tânărul nu este doar devotat profesiei, ci şi un împătimit al artei. Astfel, în timpul liber pictează şi organizează expozi-ţii de pictură în scop caritabil pentru copiii orfani. De ase-

menea, Vlad Neagoe, alături de un alt medic rezident care lucrează în cadrul Clinicii de Chirurgie Vasculară, Mircea Popiţiu, au pictat tablouri, le-au vândut, iar banii strânşi au fost folosiţi la moder-nizarea secţiei, care arată ca-n Occident, în acest moment. “Dacă vrei să-ţi arăţi recunoştinţa faţă de medicii rezidenţi din România, dacă vrei să opreşti exo-dul medicilor din România, dacă vrei să promovezi adevăratele valori, dacă crezi că sănătatea este pe primul loc, dacă res-pecţi profesia de medic, haideţi să ne în-tâlnim în Amfiteatrul A, la Spitalul Jude-ţean Timişoara, să îi strângem mâna, să semnăm pe diploma lui şi să îi oferim o insignă unui medic rezident pasionat de medicină şi artă - Vlad Neagoe”, trans-mit iniţiatori campaniei “Rezident de nota 10” . Anda LAuDACESCu

Firmele IT din România mai au la dispoziţie încă o lună pentru a cere fondurile europene de până la 3,24 milioane de lei din Programul Operaţional Competitivitate 2014-2020, datorită prelungirii termenului de închidere a apelului de proiecte. Ministerul Comunicaţiilor şi pentru Societatea Informaţională - Organismul Intermediar pentru Promovarea Societăţii Informaţionale a anunţat prelungirea perioadei de înregistrare a propune-

n Finanţările de 3,24 milioane lei pentru firme IT mai sunt disponibile încă o lună

rilor de proiecte pentru Programul Operaţional Competitivitate 2014 - 2020, Axa Prioritară 2, Acţiunea 2.2.1 „Sprijinirea creşterii valorii adău-gate generate de sectorul TIC şi a inovării în do-meniu prin dezvoltarea de clustere” până la data de 29 februarie 2016, ora 16:30. Termenul vechi de închidere a apelului era 1 februarie. Acest apel de proiecte, care pune la bătaie 50 de milioane de euro, s-a deschis pe 2 noiembrie 2015.

Anda LAuDACESCu

n Senatorul Iovescu propune reducerea zilei de lucru la 6 ore

Parlamentarii vor ca ziua de lucru să fie redusă la 6 ore. Exemplul Suediei, unde oamenii muncesc doar 6 ore pe zi, i-a inspirat şi pe aleşii noştri, care vor să le facă o bucurie românilor şi să-i scutească de a munci 8 ore pe zi. Senatorul UNPR Ioan Iovescu vrea să pro-pună reducerea programului de muncă, după modelul Suediei, de la opt ore la doar şase ore, acesta depunând la Parlament un proiect de lege în acest sens. Iovescu susţine că principalul avantaj al reducerii programului de lucru ar fi creşterea eficienţei angajaţilor, dar şi po-sibilitatea ca aceştia să câştige mai mult, după ce mulţi vor prefera să-şi mai ia un job part-time. „Una este un randament la şase ore şi alta e un randament la opt ore. Cei care lucrează în fabrici pe bandă, nu este uşor ca opt ore să tragi.”, a declarat în limba lui senatorul Iovescu. Alesul susţine că astfel cei care nu îşi vor lua un al doilea loc de muncă, vor putea petrece mai mult timp cu familia sau vor avea mai mult timp liber pen-tru alte activităţi relaxante. Legea iniţiată de Iovescu urmează să fie discutată de colegii săi în sesiunea par-lamentară care a început săptămâna asta.

Anda LAuDACESCu

Page 6: Actualitatea 961

6 UTILE & SERVICII 5 - 11 FEBRUARIE 2016ACTUALITATEA

31 IAnUARIE 20166 / 49: 28, 6, 49, 18, 9, 36 noroc: 4 9 5 1 1 5 3 5 / 40: 37, 24, 1, 19, 5, 22super noroc: 7 5 1 0 9 9 JokER: 23, 18, 24, 20, 13, 7 PLUS noRoC: 9 9 3 2 6 4

Primăria Lugoj Casa de Cultură M. Casa de Cultură S. Pro Arte Muzeu Biblioteca Protopopiatul Admin. Financiară Camera de Comerţ Camera de Muncă Forţe de Muncă Meridian 22 Salprest Gara Poliţia Judecătoria Pol. Comunitară Jandarmii Pompierii Spitalul Ambulanţa Stomatologie Pol. cu Plată Pol. Gârleanu Centrul Cev Urgenţe Gaz Număr de Urgenţă

FARMACIIMaydis Farm Salvia Farm Alcris Farm Farmacia 231 Îngerul Farm Farm ACF Civig

TAXILugoj Taxi

LoTo n 6/49

DoBânZI PERSoAnE FIZICE 6 luni 1 anBancpost 3,30 3,35BCR 1,40 1,50Transilvania 3,50 3,75Carpatica 3,75 4,00BRD 3,30 3,60Raiffeisen 2,80 3,05Alpha Bank 3,30 3,40Pireus Bank 3,50 3,80

4 FEBRUARIE 20151 euro 4,5137 1 $ 4,12961 CHF 4,06331 £ 5,97641 g aur 150,0492

ISSN 1584-3688Sãptãmânal editat de

AL LuGOJPrESS SrLStr. Nicolae Bălcescu 6

Tel. 0744.575.853 (Telekom)

rEDACŢIA:Director:

Nicolae SILADEredactor şef:

Constantin-Tufan STAN redactor şef-adj:

Mircea ANGHELSGr:

Anda LAUDACESCU

redactori:Carmen BIZĂUPatricia MANEADan H. BRUDIU Alex. BARANYAI

Cristi VECERDEA-CRIVAdriana WEIMER

Remus V. GIORGIONI

PubLICITATE/mArKETING: Lidia SILADE, 0769.62.62.76

Mădălina [email protected]

Cont:Ro30BTRLRonCRT0283498301

Banca Transilvania Agenţia Lugoj

Cod fiscal: 33979844

n BănCI n

n TELEFoAnE n 352.240351.130353.253357.886354.903351.304351.971351.673

354.920 351.776351.812351.750

352.830491.696351.212352.372353.324353.511351.560353.731

358.0000745.316.998

353.784 359.496 356.688

0800.800.928 112

353.039351.834353.521353.602351.244358.429

351.555

n VALUTA n

Tipar:SC West Tipo International

SRL Timişoararesponsabil tipar:

Micu MARIAN

Abonamente:6 luni=50 lei; 1 an=100 lei.

Abonamentele se fac la sediul redacţiei.

Adresă e-mail:[email protected]

Ingrediente: 3-4 cartofi medii; 250 g ciuperci; 1 ceapă mare; 2-3 linguri d făină + extra pentru tăvălit; 1 ou; sare şi piper după gust; 3 linguri de unt; smântâ-nă; pătrunjel proaspăt. mod de preparare: Fierbe cartofii 25-30 de minute.Taie ceapa şi ciupercile. Pune un pic de unt în tigaie şi căleşte ceapa şi ciupercile. Adaugă pătrunjel proaspăt, asezonează bine şi căleş-te până ceapa se înmoaie şi devine aurie şi sticloasă. Pune unt peste cartofi, pisează-i bine şi asezonează cu sare şi piper. Adaugă oul şi făina şi omogenizează. Pre-sară făină pe un fund de lemn. Pune cam 1 lingură din compoziţia de mai sus şi preaseaz-o cu buricele dege-telor până se nivelează. Fă acelaşi lucru cu tot restul compoziţiei. Apoi pune pe fiecare mini-“aluat” câte o lingură rasă de ciuperci călite. Îmbracă bine umplu-tura astfel, sigilând-o înăuntru. Prăjeşte-le în tigaie, la foc mediu, până se rumenesc şi devin crocante.

n Colţul de cultură n

În perioada 22-23 aprilie a.c., ultimele zile din aşa-numita „Săptămână altfel” a elevilor, la Lugoj se va desfăşura cea de-a IV-a Ediţie a Concursului Internaţional de Interpretare Pianistică „Clara Peia”. Purtând numele unei excepţionale profesoare şi pianiste-concertiste care a înnobilat viaţa culturală a Lugojului inter- şi postbelic, Concursul este unica manifestare muzicală de acest gen din istoria Lugojului, oraşul care poartă cu mândrie inscripţionat pe stema sa simbolul anticei lire. Aflat într-o nemeritată, grotescă chiar, concurenţă cu serbări câmpeneşti de genul Festivalului berii (sau al vinului) – e drept, spirtoase „nobile”, dar care nu au darul de a promova imaginea Lugojului cultural –, organizatorii Concursului se bazează, şi la această ediţie, pe suportul generos al unor instituţii şi firme private, biserici (de toate confesiunile), instituţii publice, persoane particulare, inclusiv politicieni. Da, există politicieni apropiaţi de omul de pe stradă, receptivi la dialog, oameni cu bun-simţ care ştiu să adreseze elementarul salut, să asculte, respectându-şi interlocutorul, potenţialul elector, un adevărat vector care-i propulsează, periodic, în accederea la înalte demnităţi publice. Lugojul, oraşul cu vocaţie muzicală, are nevoie, în continuare, de astfel de oameni, pentru identificarea şi promovarea unor proiecte majore, de perspectivă, pe care le merită din plin. La ediţia precedentă, cea din 2015, s-a înregistrat un adevărat record: 130 de participanţi (la cele două secţiuni: pian solo şi muzică de cameră), din România, Republica Serbia, Republica Moldova, Elveţia, Statele Unite şi Franţa. Fiind o competiţie dedicată copiilor (cu câtă obstinaţie şi dezinvoltură clamează unii politicieni preocuparea pentru destinul tinerilor!), organizatorii au făcut deosebite eforturi de ordin logistic, încorsetaţi de un buget subdimensionat (ca să nu spunem meschin) – care, până la urmă, din varii raţiuni de natură birocratică, a fost acordat tardiv, post festum –, pentru răsplătirea talentului şi profesionalismului. Într-un nefericit final, nici istorica sală a Teatrului „Traian Grozăvescu” nu ne-a mai fost pusă la dispoziţie (fără vreo explicaţie oficială), micii artişti români (din 9 localităţi), sârbi (din oraşul înfrăţit Vârşeţ), români din Republica Moldova (Chişinău), eleveţieni (Zürich), francezi (Paris), părinţii şi profesorii lor, contrariaţi, neînţelegând ce se întâmplă. (În treacăt fie spus, anul trecut, în mod straniu, Traian Grozăvescu, vocea de aur de la Wiener Staatsoper, n-a fost sărbătorit la aniversarea celor 120 de ani de la naştere decât de un entuziast grup de muzicieni şi actori şi de câţiva politicieni conectaţi, spre lauda lor, la importantul şi irepetabilul eveniment!) Am fost salvaţi din neaşteptatul şi ingratul impas graţie generozităţii membrilor staff-ului Universităţii Europene „Drăgan”. (Încă aşteptăm, cu maximă disponibilitate, explicaţii plauzibile şi scuze de rigoare, adresate nu nouă, simpli cetăţeni plătitori de taxe şi impozite, ci copiilor, profesorilor şi părinţilor lor.) La fel ca în orice alt domeniu, şi în artă România are nevoie de lucruri bine şi temeinic făcute. Arta şi sportul se pot constitui în cei mai reprezentativi ambasadori ai României pe toate meridianele, dar mai ales în marile, importantele cancelarii Occidentale, unde, de multe ori, se discută în termeni negativi despre România, se trage linie şi se iau decizii care ne pot afecta în mod direct. Sperăm ca la această nouă ediţie, copiii, destinatarii proiectului, să beneficieze de un buget consistent, în măsură să promoveze talentul şi inteligenţa, cea mai sigură şi productivă investiţie pe termen mediu şi lung.

Prof dr. Constantin-T. Stan, membru al uniunii Compozitorilor şi muzicologilor din românia

n VInERI, 5 FEBRUARIE 2016: Vremea va fi rece, iar cerul va fi variabil. Sunt

posibile lapoviţă şi ninsori. Temperaturile vor fi cuprinse între -2 şi 4ºC. n SâMBăTă, 6 FEBRUARIE 2016:Vremea se va încălzi uşor, iar cerul va fi se-

nin. Temperaturile vor fi cuprinse între -2 şi 11ºC.n DUMInICă, 7 FEBRUARIE 2016: Vremea se va încălzi uşor, iar cerul va fi se-

nin. Temperaturile vor fi cuprinse între 1 şi 13ºC. n LUnI, 8 FEBRUARIE 2016:Vremea se va încălzi uşor, iar cerul va fi în-

norat. Temperaturile vor fi cuprinse între 5 şi 13ºC. n MARţI, 9 FEBRUARIE 2016: Vremea se va răci uşor, iar cerul va fi înnorat.

Sunt posibile precipitaţii. Temperaturile vor fi cuprinse între 3 şi 10ºC. n MIERCURI, 10 FEBRUARIE 2016: Vremea se va răci uşor, iar cerul va fi variabil.

Temperaturile vor fi cuprinse între 3 şi 11ºC. n JoI, 11 FEBRUARIE 2016: Vremea se va răci uşor, iar cerul va fi variabil.

Temperaturile vor fi cuprinse între 3 şi 11ºC.

Programul Cinematografului Bela LugosiVineri, 5 februarie 2015:

ora 17.00 – Brokerii apocalipsei sala Roşieora 17.30 – Bunicul dezlănţuit sala Albastrăora 20.00 – Brokerii apocalipsei sala Roşieora 20.30 – Bunicul dezlănţuit sala Albastră

Sâmbătă, 6 februarie 2015:ora 10.00 – năzdrăvănii din pădure sala Roşieora 17.00 – Brokerii apocalipsei sala Roşieora 17.30 – Bunicul dezlănţuit sala Albastrăora 20.00 – Brokerii apocalipsei sala Roşieora 20.30 – Bunicul dezlănţuit sala Albastră

Duminică, 7 februarie 2015:ora 10.00 – năzdrăvănii din pădure sala Roşieora 17.00 – Brokerii apocalipsei sala Roşieora 17.30 – Bunicul dezlănţuit sala Albastrăora 20.00 – Brokerii apocalipsei sala Roşieora 20.30 – Bunicul dezlănţuit sala Albastră

Joi, 11 februarie 2015:ora 17.00 – Cum să fii singur şi fericit sala Roşieora 17.30 – Trauma sala Albastrăora 20.00 – Cum să fii singur şi fericit sala Roşieora 20.30 – Trauma sala Albastră

Scurte prezentări ale filmelor:Cum Să FII SINGur şI FErICIT. regia:

Christian Ditter. Cu: Dakota Johnson, Alison Brie, Rebel Wilson, Leslie Mann. Gen film: Comedie, Romantic. Oraşul New York este plin de inimi singuratice care doresc perechea potrivită, iar Alice, Robin, Lucy, Meg, Tom şi David au în comun nevoia de a învăţa cum să fie singuri într-o lume plină de definiţii în continuă evoluţie ale dragostei.

TrAumA. regia: Peter Landesman. Cu: Will Smith, Luke Wilson, Gugu Mbatha-Raw, Alec

Baldwin, Adewale Akinnuoye-Agbaje. Gen film: Dramă, Sport. Will Smith interpretează rolul principal din Trauma, un thriller dramatic bazat

pe incredibila dar adevărata poveste a imigrantului Benner Omalu, un strălucit neuropatolog, care făcând o importantă descoperire medicală a ajuns, ca şi David împotriva lui Goliat, să se lupte cu una dintre cele mai puternice instituţii ale lumii.

NăZDrăVANII DIN PăDurE. regia: Cody Cameron. Cu: Matthew J. Munn, Joel McHale. Gen film: Animaţie, Aventuri, Comedie, Familie. . Dezamăgit de faptul că cel mai bun prieten al său – cerbul Elliot – preferă să îşi petreacă timpul liber în compania soţiei şi a celor trei copii decât să pornească într-o excursie cu amicii lui de sex masculin, ursul Boog decide să plece singur în această aventură şi este irezistibil atras de mirajul unui circ ambulant rusesc.

n Concursul Internaţional de In-terpretare Pianistică Clara Peia

n Reţeta săptămânii n

Pârjoale de cartofi umplute cu ciuperci

-20 C 130 C

n Mădălina vă prezintă Vremea

Secretariatul Comun al Programului INTERREG IPA de Cooperare Transfrontalieră România- Serbia din cadrul Biroului Regional pentru Cooperare Transfrontalieră Timişoara anunţă încheierea primei etape de depunere a propunerilor de proiecte transfrontaliere pe graniţa româno-sârbă. În urma apelului pentru propuneri de proiecte deschis în perioada 15.09.2015 - 01.02.2016, un număr mare de instituţii şi organisme neguvernamentale din România şi Serbia au depus 193 de propuneri de proiecte, confirmând interesul crescut al comunităţilor din această zonă transfrontalieră

pentru proiectele cu finanţare europeană. Proiectele depuse urmează să fie examinate şi evaluate de către o Comisie Comună de Evaluare (Joint Evaluation Committee), iar cele mai bune proiecte, din cele 193 de proiecte depuse, vor fi propuse spre finanţare, cu aprobarea Comitetului Comun de Monitorizare (Joint Monitoring Committee). Biroul Regional pentru Cooperare Transfrontalieră Timişoara doreşte să mulţumească tuturor instituţiilor şi ONG-urilor care s-au implicat în conceperea unor proiecte de bună calitate. Efortul depus de instituţiile care au scris proiecte va contribui la dezvoltarea şi la îmbunătăţirea calităţii vieţii pentru locuitorii acestei zone de graniţă. Programul INTERREG IPA de Cooperare Transfrontalieră România-Serbia are un buget total de 50 de milioane Euro din care 22 de milioane sunt dedicate proiectelor strategice. Pentru prima dată în zona de graniţă dintre România şi Serbia pot fi concepute proiecte strategice, care să producă efecte de lungă durată în regiunea transfrontalieră, capabile să asigure creşterea şi dezvoltarea economică pe o perioadă îndelungată. Aceste proiecte de interes strategic pot fi depuse în continuare la sediul BRCT Timişoara până în data de 15.03.2016. Programul INTERREG IPA Cooperare Transfrontalieră România-Serbia este un program finanţat de Uniunea Europeană în ciclul de finanţare 2014-2020, din fonduri IPA-CBC şi cofinanţat de statele partenere în program, România şi Serbia.

Anca LOLESCu,Director executiv brCT Timişoara

Interes crescut pentru Programul de Cooperare românia-Serbia

Page 7: Actualitatea 961

7MoZAIC5 - 11 FEBRUARIE 2016 ACTUALITATEA

SC GRAMy-CEREALIS SRL angajează personal pentru brutărie.

Se oferăsalariu atractiv şi bune condiţii de muncă

Asigurăm transport. Informaţii la sediul din

Coşteiu nr.27, între orele 6-10, sau la tel: 0721.173.575,

0723.570.169.

n Primarul din Fârdea, acuzat pentru abuz în serviciu

Miercuri, 3 februarie 2016, în baza autorizaţiei emise de Judecătoria Făget, poliţiştii Serviciului de Investigare a Criminalităţii Economice au efectuat o percheziţie pe raza localităţii Fârdea, la sediul Primăriei. Percheziţia este efectuată într-un dosar în care primarul Samuel Lupulescu, este anchetat pentru abuz în serviciu. “În fapt, la data de 20 august 2015, un bărbat de 61 de ani, a sesizat poliţiştii despre faptul că reprezentanţii autorităţii locale ar fi refuzat în mod repetat dezmembrarea terenului concesionat acestuia şi ar fi împiedicat intabularea imobilului construit pe acel teren. Astfel, în cauză a fost întocmit un dosar penal sub aspectul săvârşirii infracţiunii de abuz în serviciu, poliţiştii urmărind, prin efectuarea percheziţiei, depistarea şi ridicarea documentelor emise de unitatea bugetară necesare pentru soluţionarea cauzei.”, se arată în comunicatul Poliţiei Timiş. Primarul a fost dus la audieri, pe numele său fiind emis un mandat de aducere. (A.P.)

Peste 400 de sportivi, cei mai valoroşi luptători din ţara noastră, unii dintre ei cu şanse mari să se califice la Jocurile Olimpice de la Rio, s-au adunat sâmbătă, 30 ianuarie 2016, în Sala Polivalentă din Craiova, pentru a lua parte la Campionatul Naţional de lupte libere şi greco-romane.

Competiţia, rezervată atât lup te-lor libere (masculin şi fe mi nin), cât şi luptelor greco-ro ma ne (clasice), a reunit şi luptători de la Clu bul Sportiv Municipal Lugoj, care a avut reprezentanţi la am-be le stiluri:

Robert Papp (cate go ria 98 kg) şi Cristian Va giu nic (categoria 59 kg) - la lup te greco-romane, iar Ivan Guidea (categoria 57 kg), A le xandru Rusteac (cate go ria 61 kg), Nicolae Cojocaru (categoria 71 kg), Valentin Cim poneriu (categoria 86 kg) şi Cristian Ţepeneag (categoria 120 kg) - lupte libere.

Robert Papp a câştigat al zecelea titlu consecutiv de campion naţional la lupte

greco-romane, iar Ivan Guidea al doilea titlu consecutiv de campion naţional la lupte libere. Cristian Ţepeneag, vi ce-campion naţional, a reeditat performanţa, reuşind să câştige argintul.

În drum spre casă, Robert Papp a avut amabilitatea să ne răspundă la câteva întrebări:

- Cum a fost campionatul naţional de lupte 2016, din punct de vedere al sportivilor?

- Se vede o creştere masivă a sportivilor, care sunt şi mult mai pregătiţi, iar asta se datorează faptului că mulţi dintre ei luptă în străinătate.

- Cu cine ai luptat în finală?- Cu un sportiv de la Steaua Bucureşti,

pe care l-am învins cu scorul de 8-0, superioritate tehnică.

- Cum au fost ceilalţi contracandidaţi ai tăi la titlu?

- Toate meciurile le-am câştigat în prima repriză, prin superioritate tehnică şi tus.

- ştim ca esti multiplu campion naţional, al câtelea titlu este cel din 2016?

- 2016 este al zecelea titlu consecutiv.- În încheiere, daca aveţi ceva de

transmis lugojenilor?- Pe această cale doresc să-i mulţumesc

în primul rând dlui primar Francisc Boldea, pentru interesul arătat în promovarea sportului lugojean. Mai mult, sunt alături de dl primar şi-l voi susţine pentru ca sportul lugojean să meargă înainte, nu să desfiinţăm câteva ramuri sportive, cum a spus, zilele trecute, dl director al CSM, Bologa Gheorghe.

- Vă mulţumim şi vă felicităm încă o dată pentru această performanţă!

Anda LAuDACESCu

robert Papp a câştigat al 10-lea titlu consecutiv de campion naţional la lupte greco-romane

n Patru minori din Centrul de Plasament Găvojdia au dat atacul la magazia cu mărfuri

Marţi, 2 februarie 2016, Poliţiştii Secţiei 6 Rurale Găvojdia au identificat patru minori, beneficiari ai Centrului de plasament din localitate, bănuiţi de furtul mai multor bunuri din magazia centrului. Pe numele acestora a fost întocmit dosar penal. Poliţiştii au fost sesizaţi de către reprezentanţii Centrului de plasament Găvojdia cu privire la faptul că persoane necunoscute ar fi sustras din depozitul unităţii mai multe bunuri. În urma investigaţiilor efectuate, poliţiştii au identificat patru minori beneficiari ai centrului, bănuiţi de comiterea furtului. “În fapt, în perioada 30-31 ianuarie a.c., minorii, cu vârste între 14 şi 16 ani, ar fi pătruns în depozit, folosindu-se de chei potrivite, iar din interior ar fi sustras 2 biciclete, 33 de perechi de pantofi şi rechizite şcolare, pe care ulterior le-ar fi valorificat. Prejudiciul în valoare de aproape 2800 de lei a fost în mare parte recuperat de poliţişti, bunurile fiind restituite reprezentanţilor centrului. În cauză a fost întocmit dosar penal sub aspectul săvârşirii infracţiunii de furt calificat”, se arată în comunicatul IPJ Timiş. Poliţiştii continuă cercetările în vederea documentării întregii activităţi infracţionale a minorilor. (A.P.)

Femeile liberale sunt bine pregătite la capitolele învăţământ şi sănătate

În conferinţa de presă de marţi, 2 februarie 2016, liderul PNL Lu-goj, Ioan Ambruş, a prezentat două dintre candidatele PNL pe lista de consilieri locali la alegerile din iunie: mariana Epure, cadru medical, şi Elena Grasu, profesoa-ră la şcoala Gimnazială Nr. 4.

Cele două doamne liberale au făcut cunoscute câteva din proiectele pe care PNL le au în vedere, în două domenii importante: sănătate şi învăţământ.

“Întrucât numărul deceselor şi al bo-lilor cronice a crescut, considerăm că Spitalul Municipal Lugoj ar trebui să de-vină un spital de urgenţă, nu un spital de rangul 4, cum e cel din Făget, aşa cum este acum. Sigur, pentru aceasta avem nevoie de aparatură, de medici specia-

lişti, dar cred că şi de voinţă (...) Am avea nevoie şi de un computer tomograf, care să ajute medicii pentru a pune un dia-gnostic corect şi a administra un trata-ment eficient şi rapid, tomograf care să fie doar al spitalului, exploatat 24 de ore din 24, pentru că un accident vascular cerebral poate surveni şi la 12 noaptea, iar timpul necesar transportului pînă la Timişoara face diferenţa dintre viaţă şi moarte”, a menţionat Mariana Epure, care are 20 de ani de experienţă în do-meniul medical.

O altă iniţiativă liberală vizează extin-derea reţelei after school la toate şcolile din oraş şi dotarea fiecărei unităţi de în-văţământ cu o cantină proprie.

“Pentru învăţământul primar şi gim-nazial, copiii au nevoie nu doar să mear-

gă să se pregătească la şcoală, efectiv în procesul instructiv-educativ, ci şi să aibă o protecţie de specialitate după orele de şcoală. Şi mă refer la extinderea reţelei after school, la nivelul fiecărei unităţi de învăţământ gimnazial. Astfel, părinţii ar sta liniştiţi la locurile de muncă, iar co-piii ar fi supravegheaţi, şi-ar pregăti lec-ţiile şi, evident, ar servi şi o masă caldă. Iar fiecare astfel de unitate şcolară să fie dotată şi cu o cantină proprie”, a spus Elena Grasu, menţionând că finanţarea acestor centre ar putea fi realizată prin parteneriate cu firmele din oraş, dar şi cu Biserica Ortodoxă, “care se pare că are profituri enorme”.

În final, Ioan Ambruş a adus critici ad-ministraţia vizavi de proiectul de buget.

Nicolae SILADE

After school la toate şcoli-le, iar spitalul transformat în unitate medicală de ur-

genţă

Page 8: Actualitatea 961

8 PAnoRAMA 5 - 11 FEBRUARIE 2016ACTUALITATEA

n Germania, titlu după 10 ani. România, lipsă 20

Senzaţional spectacolul generat de handbalul european în Polonia, cu ocazia competiţiei supreme a continentului. Meciuri foarte tari, cu finaluri imprevizibile, rezultate-sur-priză, asistenţe-record şi show de clasă într-un sport care poartă tot mai mult amprenta determinării şi - s-o spu-nem, durităţii chiar, dar care fascinează şi ţine aproape numeroşi suporteri. Germania - prima finalistă, învinse-se în prelungiri, surprinzătoarea Norvegie, cu 34-33 (14-13, 27-27), iar Spania, cea de-a doua, trecuse cu 33-29 de Croaţia, poate cea mai frumoasă echipă a competiţiei. În ciuda palmaresului, care indica Spania favorită, deşi nu câştigase vreodată trofeul, dar învinsese Germania (triplă campioană mondială şi europeană în 2006) destul de clar în grupă, finala a fost una neverosimilă pentru acest nivel, vedetele iberice fiind sufocate de un team german care a meritat din plin titlul, având în lot 12 debutanţi la acest ni-vel şi un antrenor islandez conducător al staff-ului tehnic! Interesant că, la start, pronosticurile specialiştilor menţi-onau favorite, în ordine, Franţa (reprezentativă care are în vitrine toate trofeele importante), Danemarca, cu două titluri europene şi şase podiumuri din şapte prezenţe

n SHORT SPORT n SHORT SPORT n

C.S.m. Lugoj: Ionela Canea, Krista De Geest, Gabriela bălae, Ivana radonjic, Luminiţa Trombiţaş, Adriana rotaru, Laura Lungu, Jasmina Petromăneanţ, Irina Andreica, ramona rus, mădălina şonda, Ivana milanovic.

Antrenori: Valerijan Luka (principal), ugljesa Segrt (antrenor secund) şi Vasile Canea (preparator fizic).

C.S.m. Târgovişte: Alexandra Sobo, Diana Calotă, milagros Collar, bianka busa, marta Drpa, Suzana Cebic, roxana Ivanof, Eva Chantava, Katja medved, bianca moldovan, Andreea Niţulescu, Alexandra Trică.

Antrenori: Zoran Terzic (principal), Zeljko bulatovic (antrenor secund), Danijel misic (preparator fizic).

Meci-spectacol în week-end între lugojencele aflate pe locul opt înainte de start şi dâmboviţencele vicecampioane ale României ediţia trecută, având drept obiectiv titlul în acest sezon. Cu un buget al voleiului târgoviştean de 1.500.000 euro în 2015/2016, posibil cel mai mare din prima ligă, la concurenţă cu Blajul, echipa care şi-a disputat în aprilie finala pentru aur a trecut prin transformări importante în decembrie, datorită ratării turului (locul trei, după Blaj şi C.S.M. Bucureşti) şi eliminării în faza a doua a Cupei CEV. S-a renunţat în acest sens la staff-ul italian Miccoli – D’Ambrosio şi peparatorul Djurovic, fiind contractaţi din ianuarie la cârma echipei antrenorii - campioni europeni şi vicecampioni ai Cupei Mondiale cu naţionala feminină a Serbiei, Zoran Terzic şi Zeljko Bulatovic. Care au convins încă trei nume să se alăture proiectului: Suzana Cebic,

Bianka Busa şi Marta Drpa, sportive cu mare experienţă inernaţională, prima declarată cel mai bun libero al lumii în 2006, la mondialele din Japonia, acolo unde sârboaicele au cucerit bronzul.

Aflate aşadar într-o asiduă cursă de urmărire a bucureştencelor de la C.S.M. (care au câştigat la Târgovişte în tur cu 3:2, după 0:2 !), sportivele “portocalii” nu-şi puteau permite paşi greşiţi, nici măcar la nivel de setaveraj (vezi clasamentul). Neavând ce pierde şi jucând la un nivel foarte bun, lugojencele au fost permanent aproape de adversare, obţinând un set important şi fiind aproape, în setul patru la 19:19, chiar de câştigarea unui punct. Curajos, cu mai puţine erori la preluare (deşi serviciul oaspetelor a fost unul dificil), susţinute de o sală numeroasă ca asistenţă şi cu un tonus optim de competiţie, sportivele gazdă au oferit o

probă de ambiţie şi valoare ce sperăm să fie susţinută şi în viitoarele jocuri.,

Scorurile de 16:15, 18:18, 19:19 în setul I câştigat totuşi de oaspete, revenirea de la 8-12, 10-14, 11-16 la 19-18 în setul IV pierdut la final, plus victoria din partea a treia a jocului au evidenţiat un grup lugojean care, jucând de o asemenea manieră în continuare, poate realiza ceea ce şi-a propus, clasarea în Play-Off la fine de retur. Experienţa internaţionalelor Diana Neaga-Calotă, Alexandra Sobo, Alexandra Trică şi Bianca Moldovan (rezerve de lux pe banca lui Terzic), plus pleiada de vedete din ternul târgoviştean (între care s-au distins sârboaicele Cebic şi Busa, grecoaica Chantava şi spaniola Collar au determinat diferenţa finală de scor şi adjudecarea punctelor de către oaspete, în urma unui joc de ridicat nivel tehnic.

Miercuri (n.red.: textul e editat cu o zi înainte) se desfăşoară etapă intermediară în Liga A 1, în care sportivele antrenate de profesorul Luka întâlnesc, în deplasare, campioana naţională din Blaj, în timp ce Iaşiul se deplasează la Rapid şi va egala probabil la puncte echipa noastră, Piatra Neamţ la Târgovişte şi Craiova la Bacău.

urmând ca sâmbătă, 6 decembrie, într-un joc la care clubul îi invită alături pe suporteri pentru o victorie fără mari emoţii, C.S.m. Lugoj să întâlnească ultima clasată, rapid bucureşti. Partida începe la orele 18,30 şi este arbitrată de cuplul Cristian Dumitrescu (Craiova) – Georgiana Grădinaru (Oradea). Observator FrV: Traian marinescu (bucureşti).

un set şi un loc mai sus în clasamentVolei. Divizia A1. Feminin: CSM Lug oj - CSM Târgovişte 1-3 (21:25, 21:25, 25:22, 22:25)

rezultatele etapei a XIII-a:CSm Lugoj - CSm Târgovişte = 1 : 3 (21:25, 21:25, 25:22, 22:25)univ. Cluj - medicina Tg. mureş = 0:3 (16:25, 23:25, 20:25)SCm univ. Craiova - C.S.m. bucureşti = 0:3 (14:25, 16:25, 21:25)unic Piatra Neamţ - ştiinţa bacău = 0:3 (17:25, 22:25, 15:25)Dinamo bucureşti – rapid bucureşti = 3:0 (25:10, 25:13, 25:16)Penicilina Iaşi - Volei Alba blaj = 0:3 (19:25, 14:25, 13:25)

Etapa a 15-a, sâmbătă, 6 februarie:CSm Lugoj - rapid bucureşti (Sala Sporturilor, orele 18,30) medicina Tg. mureş - ştiinţa bacău (direct Digi Sport, 13,30) Penicilina Iaşi - Dinamo bucureştiCSm bucureşti - universitatea ClujSCm univ. Craiova - CSm Târgovişte (7.02., direct Digi Sport, 13,30) unic Piatra Neamţ - Volei Alba blaj (amânat pentru 17.02.)

Clasament:

Volei Alba blaj 13 12 1 0 0 39 - 5 38CSm bucureşti 13 10 1 2 0 37 - 9 34CSm Târgovişte 13 10 1 1 1 36-11 33Dinamo bucureşti 13 8 1 1 3 30-19 27med. Tg.mureş 13 7 2 0 4 28-16 25ştiinţa bacău 13 7 1 0 5 28-17 23CSm Lugoj 13 4 0 2 7 18-25 14unic Piatra Neamţ 13 4 0 2 7 17-28 14Penicilina Iaşi 13 3 1 0 8 14-30 11SCmu Craiova 13 3 0 0 9 9-31 9universitatea Cluj 13 2 0 0 11 9-34 6rapid bucureşti 13 0 0 0 13 2-39 0

Zoran Terzic

la C.E., Spania şi echipa gazdă, Polonia, menţionând printre posibilele revelaţii ungaria. Clasamentul final i-a contrazis însă drastic: 1. Germania, 2. Spania, 3. Norvegia, 4. Croaţia! La locul surprizelor continentale s-au aflat şi doi oficiali români, arbitrii bogdan Stark şi romeo ştefan. Cât despre echipa naţională, ea n-a mai dat pe la turneul final exact de douăzeci de ani, din 1996!

n Atac la campioană, în Ardeal!După ce şi-a adjudecat patru titluri în cinci ani în Cupa

FED, selecţionata de tenis feminin a Cehiei a aterizat la Cluj pentru a plusa la palmares. românia şi Cehia se vor întâlni în 6-7 februarie în sferturile de finală din Grupa Mondială, acolo unde au rămas doar opt echipe. Şi unde reprezentativa ţării noastre s-a calificat după ce a învins, în luna aprilie, la Montreal, echipa Canadei, cu scorul de 3-2. Nu vă bucuraţi, spectacolul va putea fi văzut doar pe Dolce Sport TV, televiziunea naţională neconsiderându-l înteresant în peisajul său de week-end. “...cred că publicul român va fi un adversar periculos pentru noi, dar ştim cum să jucăm în alte ţări şi cred că vom da totul, ca întotdeau-na.” - declară liderul de valoare al Cehiei, Petra Kvitova. De

urmărit ce atmosferă se va crea în Sala Polivalentă clujeană pentru competiţia ajunsă la ediţia numărul 54 şi pe care aceasta o găzduieşte la debut. Echipa României este alcă-tuită din Simona Halep (3 WTA), monica Niculescu (37 WTA), Andreea mitu (104 WTA) si raluca Olaru (45 WTA la dublu). Din păcate, Irina Begu şi Alexandra Dulgheru nu vor juca la Cluj din cauza unor probleme me-dicale. România nu are în palmares vreun trofeu, revenind în prima grupă valorică după 23 de ani! Din echipa Cehiei (care a ieşit victorioasă în ediţiile 1975, 1983, 1984, 1985 şi 1988 sub sub culorile Cehoslovaciei şi, mai apoi, în 2011, 2012, 2014, 2015) fac parte: Petra Kvitova (9 WTA), Karolina Pliskova (13 WTA), barbora Strycova (41 WTA) şi Denisa Allertova (59 WTA). Pronostic... 2?

Dan H. bruDIu Dan H. bruDIu

Page 9: Actualitatea 961

9PAnoRAMA5 - 11 FEBRUARIE 2016 ACTUALITATEA

La data de 26 ianuarie 2016, într-un spaţiu neconvenţional, lugojeanul nostru Eugen Keri, de câteva zeci de ani trăitor în Germania, a deschis o superbă expoziţie de pictură într-unul dintre cele mai renumite centre de cardiologie din lume, Deutsches Herzzentrum din Munchen, al treilea oraş ca mărime din Germania, unde au fost şi vin la tratament mari personalităţi ale lumii din diverse sfere de activitate. Să amintesc doar câteva: Mihail Gorbaciov, Roman Herzog, Helmuth Schmit, Helmuth Kohl, Mircea Lucescu şi… Eugen Keri.

„Am dedicat expozitia acestui centru, pentru că între anii 2011 – 2013 m-am numărat şi eu printre pacienţii acestuia unde am fost operat de câteva ori, la inimă, artere,

şi asta cu mare succes. Au un personal internaţional cu cei mai buni cardiologi din lume, printre ei numărându-se şi românul Cătălin Constantin Badiu. Poate te întrebi cum am ajuns să expun aici? După reuşitele operaţii efectuate de profesoara doctor Ilka Ott, i-am dăruit acesteia una dintre lucrările mele, lucrare care i-a plăcut foarte mult. După un timp, domnia sa mi-a sugerat, ba mai mult, m-a invitat să deschid o expoziţie în acest centru. Nu puteam să refuz o astfel de oportunitate. Am pregătit expoziţia un an şi jumătate şi, iată, ea s-a materializat!”, ne-a declarat în exclusivitate artistul lugojean.

Sunt expuse 66 de lucrări abstracte cuprinzând trei cicluri: Colaj (2011), Structuri cromatice

(2012) şi Forme cromatice (2013). Aceste lucrări sunt în acryl cu accente grafice reprezentate prin simboluri create de artist, preponderent fiind pătratul.

La vernisaj au participat aproximativ 40 de persoane, artişti plastici, critici de specialitate şi un public iubitor de frumos. La această întâmplare a luat cuvântul Claudia Siegert, o personalitate cunoscută în mediul artistic.

La finalul vernisajului, paleta cromatică s-a îmbogăţit cu culorile vinurilor şi sucurilor de tot felul. Expoziţia rămâne deschisă până la data de 4 martie 2016. Dacă, din greşeală, vă nimeriţi prin München, nu ezitaţi să-i treceţi pragul! Nu veţi regreta nimic. Ba, dimpotrivă!

mircea ANGHEL

Expoziţia lui Eugen Keri, de la münchen,o simfonie forme şi structuri cromatice

În Protopopiatul Lugoj s-au strâns 13.300 de semnături pentru modificarea articolului 48 din Constituţie

Este cunoscut faptul că, acum ceva timp, Coaliţia pentru Familie a declanşat o adevărată „cruciadă” de strângere de semnături împotriva căsătoriilor homosexuale.

Ce doresc iniţiatorii acestei campanii? Un singur lucru. Schimbarea articolului din Constituţie care sună astfel: „Familia se întemeiază pe căsătoria liber consimţită între soţi” cu „Familia se întemeiază pe căsătoria liber consimţită între un bărbat şi o femeie”.

Aproximativ 20 de ONG-uri susţin această iniţiativă, din care amintim doar câteva: Asociaţia Familiilor din România, Familia Tradiţională, Asociaţia Înţelege Autismul, Asociaţia Dascălilor din România şi altele.

Scopul final al întreprinderii a fost acela de a se stânge 500.000 de semnături la nivel naţional. Datele au fost centralizate , urmând a fi trimise către Curtea Constituţională.

Dorind să aflăm cum se prezintă situaţia în Protopopiatul Lugoj, l-am abordat pe P. On. Ioan Cerbu, protopop de Lugoj, care ne-a declarat: „Iniţiativa a venit din partea Coaliţiei pentru Familie şi a constat în ideea de a strânge semnături pentru organizarea şi demararea unui referendum în vederea modificării articolului 48, alineatul întâi din Constituţie.

Desigur că şi noi, Biserica Ortodoxă, ne-am implicat prin preoţii slujitori, prin consiliile parohiale, comitetele parohiale, prin acele persoane acreditate de a aduna semnături pentru această acţiune. La ora actuală, pot să vă spun aşa, informativ şi aproximativ totodată, că în Protopopiatul Lugoj, mai exact în municipiul Lugoj, că parohiile ortodoxe lugojene au adunat

în jur de 3.000 de semnături. Pe întreg Protopopiatul Lugoj numărul acestora este de aproximativ de 13.300 de semnături.

Avem încredere în ceea ce facem, pentru că împreună cu credincioşii noştri putem schimba ceva, pentru că e necesar pentru familia noastră creştină să avem stipulat în Constituţie acest lucru, cum că o căsătorie se poate întemeia doar pe relaţia dintre bărbat şi femeie, nu dintre soţi.” mircea ANGHEL

un set şi un loc mai sus în clasamentn Tarzaniada, o campanie turistică senzaţională

Tarzaniada, o campanie turistică senzaţională, prin care Timişul vrea să dea marea lovitură în 2016, protagonist fiind cel mai celebru timişorean din toate timpurile: Johnny Weissmüller. Campania Tarzani-ada, iniţiată de Casa de Cultură a Studenţilor Timi-şoara şi susţinută de Asociaţia pentru Promovarea şi Dezvoltarea Turismului în judeţul Timiş, se va folosi doar de imaginea personajului Tarzan. Lansarea va avea loc luni, 1 februarie 2016, la Consiliul Judeţean Timiş, când, tot în scopul promovării turistice a ju-deţului, Asociaţia pentru Promovarea şi Dezvoltarea Turismului în judeţul Timiş va lansa şi QR Code - un drum mai scurt spre Turismul în Timiş.

Anda LAuDACESCu

n PS Alexandru Mesian s-a întâlnit cu Papa Francisc

În perioada 27-31 ianuarie 2016, PS Alexan-dru Mesian, episcopul greco-catolic de Lugoj, a participat la Întâlnirea Internaţională „Creştini şi Păstori pentru Biserica de mâine”, organizată la Roma de Comunitatea Sant`Egidio. La aceas-tă manifestare, care a coincis cu aniversarea a 48 de ani de la întemeierea Comunităţii Sant’Egidio, au luat parte numeroşi invitaţi, călugări şi călu-

găriţe, episcopi şi cardinali, delegaţii ecumenice şi ambasadori de pe cinci continente şi de con-fesiuni diferite. România a fost reprezentată de PS Alexandru Mesian, episcopul greco-catolic de Lugoj, de ÎPS Serafim Joantă, mitropolitul orto-dox român al Germaniei, Europei Centrale şi de Nord, şi de PS Visarion Răşinăreanul, episcopul ortodox de Tulcea. În cadrul audienţei papale care a avut loc cu acest prilej, în Piaţa Sf. Petru din Roma, PS Alexandru Mesian i-a prezentat Suveranului Pontif omagii din partea Prea Feri-citului Părinte Cardinal Lucian, Arhiepiscop Ma-jor şi a întregii Biserici Române Unite cu Roma, Greco-Catolică şi i-a oferit Papei Francisc cartea autobiografică „File din Viaţa mea”, apărută re-cent. În cadrul vizitei la Roma, episcopul greco-catolic de Lugoj a mai vizitat Colegiul Pontifical „Pio Romeno” şi închisoarea „Regina Caeli”.

Nicolae SILADE

Page 10: Actualitatea 961

10 DIVERTIS 5 - 11 FEBRUARIE 2016ACTUALITATEA

În conformitate cu Catalogul tipurilor de deşeuri aplicabil în depozitul de deşeuri nepericuloase comuna Ghizela, catalog care face obiectul Anexei nr. 2 din Autorizaţie integrată de mediu nr. 1 din 30.08.2012, în baza căreia se operează în cadrul Depozitului de deşeuri nepericuloase Ghizela, deşeurile menajere colectate de la populaţie sunt deşeurile rezultate dintr-o gospodărie cu excepţia deşeurilor lemnoase, deşeurilor vegetale din grădini şi parcuri, deşeurilor electrice şi electronice şi a deşeurilor de moloz, deşeuri care au alt regim.

Datorită organizării depozitului de la Ghizela pe diferite hale specifice, nu se pot amesteca tipurile de deşeuri, menajer cu moloz, deşeuri vegetale etc. şi se percep taxe diferite pentru fiecare tip de deşeu în parte.

Contractul de salubritate cu SC Salprest SA Lugoj este încheiat numai pentru deşeuri menajere. În baza unei comenzi şi contra cost sunt colectate şi alte tipuri de deşeuri de către SC Salprest SA, care le colectează şi transportă la Depozitul de deşeuri de la Ghizela. Tariful este diferit faţă de cel pentru gunoi menajer.

ConDUCEREA

Salprest S.A. FEM PAnTA RHEI

încălţăminte, îmbrăcăminte, marochinării

n str. Unirii nr.2, telefon: 0356.452.204.n str. Avram Iancu nr.3, telefon: 0356. 175.663

Alege PANTARHEI, alege preţul corect!

în fiecare vineri, REDUCERE DE 10% la toate produsele

orar:9-18

o pâine bună dacă vrei, alege pâinea de Coştei!

Coşteiu, nr.27

BRUTăRIA Coştei

SC GRAMy-CEREALIS SRL

De nota

10

Universitatea de Vest din Timişoara i-a acordat, vineri, 29 ianuarie 2016, titlul de Doctor Honoris Causa Beneficiorum Publicorum fostului preşedinte al Comisiei Europene, Jose Manuel Durao Barroso, în cadrul unei ceremonii desfăşurate în Aula Magna. După încheierea celor două mandate ca preşedinte al Comisiei Europene, dl Barroso a revenit în mediul academic, fiind în prezent lector la universităţi de renume din SUA, Portugalia şi Elveţia. „Este o mare onoare şi o mare satisfacţie să primesc această distincţie care mă face acum membru al comunităţii academice a Universităţii de Vest din Timişoara. […] Înseamnă foarte mult pentru mine, ţinând cont că vine din partea unei instituţii de învăţământ şi cercetare foarte importantă, dintr-o ţară pe care o admir şi pe care o iubesc, România. […] Sunt foarte încântat să fiu azi, aici, în Timişoara, unul dintre cele mai importante oraşe româneşti, un oraş cu o istorie

importantă, cu o tradiţie a multiculturalismului, un oraş al cărui nume este legat de Revoluţia română şi de democraţie. Fiind portughez, ştiind ce înseamnă să vezi căderea unui regim autoritar, cum s-a întâmplat şi în ţara mea în 1974, mă simt aproape de Timişoara şi de România. Mă simt aproape de cei ce odată au fost tineri, cum am fost şi eu la 18 ani, şi am putut vedea căderea unui regim autoritar şi naşterea unei democraţii”, a spus Barroso, la Universitatea de Vest. Prezent la ceremonia de la Universitatea de Vest, primul ministru al României Dacian Cioloş a subliniat meritele de netăgăduit ale lui J.M. Barroso în aderarea României la Uniunea

Europeană şi a mulţumit pentru încrederea pe care i-a acordat-o prin nominalizarea sa pe poziţia de comisar european pentru agricultură într-un moment de mare importanţă pentru viitorul Europei. „Au fost 4 ani în care m-am ataşat enorm de acest optimist incurabil, amorezat de Europa. În fiecare săptămână,

am primit de la el câte o doză de optimism. Europa este într-o succesiune de crize şi de probleme, iar Barroso a transmis perfect că nu trebuie să privim la criză prin stop-cadre, ci în mişcare. Criza este o oportunitate şi, dacă ne limităm doar la a o analiza, rămânem în trecut, dar dacă acţionăm vizionar, atunci

evoluăm. Barroso a expus această perspectivă idealistă unor oameni capabili de a lua decizii rapide şi, de multe ori, foarte dificile. Multe idei lansate de el şi care au făcut obiectul dezbaterii publice, au devenit acum realitate. Iar UE e mai mare şi mai puternică. Barroso este cel care a susţinut cu tărie cauza României pentru aderarea la UE.” Un exemplu de rezultat bun ca răspuns la o criză europeană este cel al crizei constituţionale – atunci când Olanda şi Franţa au respins constituţia, ceea ce a dus la tratatul de la Lisabona, a menţionat proaspătul Doctor Honoris Causa în alocuţiunea de mulţumire.

Lista personalităţilor care au primit titlul de Doctor Honoris Causa din partea instituţiei timişorene îl include din 2015 şi pe un alt fost preşedinte al Comisiei Europene. Este vorba de Romano Prodi, preşedinte al Comisiei Europene în perioada 1999-2004 şi prim-ministru al Italiei (1996-1998; 2006-2008). (N. S.)

Jose manuel Durao barroso, fostul preşedinte al Comisiei Europene: “mă simt aproape de Timişoara şi de românia”

„bătrâneţea nu este decât un jurnal al întregii vieţi”, spunea odată cineva. Jurnalul vieţii lugojeanului robert Gheorghe Stempel a ajuns la fila 100 şi conţine multe întâmplări.

S-a născut la data de 29 ianuarie 1916. A servit patria fiind ofiţer al Armatei Române. În anul 1945 a fost deportat în Rusia, de unde s-a întors în 1950, an în care s-a şi căsătorit cu Ana, care a trecut la cele veşnice în 1986, la numai 60 de ani. A lucrat ca şi contabil-şef la ITL şi de 40 de ani este un venerabil pensionar. Are o singură fată, Carin Spall (64 de ani), care trăieşte în Germania, un nepot şi doi strănepoţi. A mai avut încă doi fraţi, unul mort la 11 ani, de TBC, iar celălat, la 55 de ani, în Austria, de atac de cord. Tatăl său a pierit pe când Robert avea un an, câzând de pe o schelă, zugrav fiind. Fiica sa, Carin, s-a căsătorit şi a plecat în Germania. El a refuzat să o urmeze şi din iulie 2013 este locatarul Centrului de Seniori „Anita Heim”, din Lugoj. Vineri, 29 ianuarie 2016, aici a sărbătorit împlinirea unui veac de existenţă, alături de întreaga familie venită special pentru acest eveniment unic, din Germania. Rugând-o pe fiica sa Carin să-l caracterizeze în câteva cuvinte, aceasta ne-a declarat: „un om muncitor, un model de cinste şi omenie, un tată şi un soţ ideal, bun gospodar, familist convins, un om foarte sănătos, nefiind în viaţa sa bolnav”.

Am mai aflat că până la 97 de ani, Gheorghe Stempel a mers cu bicicleta. Secretul longevităţii sale

ne-a fost făcut cunoscut de nepotul său, prezent şi el la eveniment: echilibru în tot ceea ce a făcut în viaţă şi totdeauna a fost de partea adevărului. La sărbătorire, pe lângă seniorii Centrului, au mai participat primarul Francisc Boldea şi reprezentanţi ai Direcţiei de Asistenţă Socială şi Comunitară din cadrul Primăriei Lugoj, care au înmânat sărbătoritului o diplomă, un superb buchet de flori, un plic cu o anumită sumă de bani şi un tort.

Toţi cei prezenţi au ciocnit în cinstea „centenarului” câte un pahar de şampanie. De asemenea, a mai primit din partea Ministerului Apărării Naţionale o diplomă, pe care scria printre altele:

„Vă asigurăm de întreaga noastră stimă, consideraţie şi recunoştinţă pentru faptele de arme de care aţi dat dovadă, fiind un exemplu pentru generaţiile care v-au urmat.

LA muLŢI ANI! ministrul Apărării Naţionale, mihnea Ioan motoc”Diploma i-a fost înmânată de o delegaţie de ofiţeri

avându-l în frunte pe lt. col. Ioan Teca, comandantul Garnizoanei Lugoj. Prin longevitatea sa, Robert Gheorghe Stempel nu face altceva decât să confirme spusele lui Maggie Kuhn: „bătrâneţea nu este o boală; este tărie şi supravieţuire, triumful asupra tuturor felurilor de vicisitudini şi dezamăgiri, încercări şi boli.”

mircea ANGHEL

robert Gheorghe Stempel, un om bogat în ani, şi-a trecut în contul personal 100 de file

Page 11: Actualitatea 961

11TIMP LIBER5 - 11 FEBRUARIE 2016 ACTUALITATEA

1. Îi arăţi mereu partenerului plăcerea pe care o simţi atunci când faceţi dragoste?

a) Nu, gemetele sunt jenante… b) Uneori da, uneori nu… c) Da, cred că acest lucru îl excită foarte tare

2. Consideri că eşti destul de atractivă pentru el?

a) Depinde de zonele corpului meu b) Nu, şi acest lucru te face să nu ai chef de sex c) Da, mă consider o femeie sexy

3. Dacă vrei să faceţi dragoste îi spui direct?

a) Aştepţi să facă el primul pas b) Nu întotdeauna, poate nu are chef în acel moment c) Sigur că da!

4. Dacă ai o problemă de natură sexuală, îi vorbeşti partenerului despre aceasta destul de uşor?

a) Nu am curaj să-i spun nimic. Dacă ne vom despărţi? b) După multe ezitări reuşeşti să-i spui aproape tot c) Da, comunicarea este foarte importantă

5. Există părţi ale corpului unui bărbat care te dezgustă?

a) Depinde de bărbat b) Nu, corpul unui bărbat este în totalitate atrăgător c) Da, anumite zone chiar nu-mi fac plăcere

6. Alături de un bărbat te simţi întotdeauna obligată să spui da?

a) Depinde de partener b) Da, un bărbat vrea întotdeauna să audă răspunsuri pozitive c) Nu, mă simt foarte bine, în largul meu. Mă consider o persoană independentă.

7. Dacă se întămplă să fie un pic mai gălăgios atunci când faceţi dragoste cum reacţionezi?

a) Gemetele lui te excită foarte tare b) Un pic de atitudine animează întotdeauna atmosfera c) Te blochezi doar la gândul că te vor auzi vecinii

8. Îţi place să-ţi imaginezi că faci dragoste cu el?

a) Uneori mă gândesc, dar nu e fantezia mea preferată b) Da, e excitant c) Niciodată

9. În timpul unui act sexual îi împărtăşeşti din dorinţele tale partenerului?

a) Da, dar nu întotdeauna b) Nu îndrăznesc sa îi spun nimic c) Da, şi el face la fel

10. Îţi place când te sărută şi te strânge în braţe în mijlocul mulţimii?

a) Nu, acest lucru nu-ţi face deloc plăcere b) Da, dar mai depinde şi de locul şi de lumea din jur c) E fantastic şi acest lucru te face să te simţi unică

majoritatea ANivelul armoniei tale sexuale este scăzut. E cazul să

analizezi un pic problema… Nu eşti foarte obişnuită cu sexualitatea în cuplu. De ce? Prima ipoteză: eşti încă tânără şi nu ai multă experienţă. Şi e normal să fie aşa! În timp, vei deveni mai experimentată. Bineînţeles, depinde şi de partener, dar şi de cât eşti dispusă să experimentezi. A doua ipoteză: Probabil că nu te simţi prea bine în corpul tău, nu-ţi place cum arăţi. De aceea, ar fi bine să încerci să te “împaci” cu el. Puţin sport îţi va tonifia muşchii şi îţi va da mai multă încredere în tine. Chiar şi o lenjerie intimă provocatoare te va ajuta să te simţi mai sexy şi încrezătoare. În acest fel, vei deveni mai relaxată şi nerăbdătoare să primeşti atingerile partenerului.

majoritatea bNivelul armoniei tale sexuale este maxim. Pentru

tine sexul este un mod de relaxare şi, mai ales, un mod de cunoaştere şi experimentare a fanteziilor tale şi ale partenerului de cuplu. Îţ i place să-i vorbeşti deschis şi acest lucru te ajută să ajungi foarte repede pe culmile plăcerii. Mai mult, îţi place să-l surprinzi şi asta îl face să fie şi mai atras de tine. În acest moment poţi spune că există o compatibilitate maximă între tine şi partenerul tău. Şi acest lucru face ca viaţa în doi să meargă ca pe roate.

majoritatea CNivelul armoniei tale sexuale este mediu. Eşti pe

cale să câştigi o armonie sexuală excelentă dacă încerci să mai aduci mici îmbunătăţiri. De pildă, trebuie să încerci să scapi de complexele de inferioritate. Dacă vei răspunde cu “nu” la următoarele întrebări vei ştii unde mai trebuie lucrat. Îţi consideri corpul un cadou pentru partener? Ştii să-ţi exprimi dorinţele şi plăcerea partenerului? Te simţi în largul tău atunci când faci dragoste cu el? Îţi place să experimentezi noi fantezii sexuale? Dacă totuşi ai răspuns afirmativ la toate aceste întrebări înseamnă că partenerul tău este cel care trebuie să devină mai receptiv.

Test

Care e nivelul armoniei sexuale în viaţa ta de cuplu?

s bancuri s bancuri sJ J J

Undeva-n Ardeal. Ion şi Gheorghe ies de la birt, liniştiţi, domol. În mijlocul drumului, o broască ţestoa-să. Se freacă ei la ochi, se apleacă, o studiază, o înconjoară...

- Bă, Ioane, ce drac’ îi asta?!?Ion iar s-apleacă deasupra ei,

mormăie, se scarpină-n cap... după cinşpe minute, declară mândru:

- Bă, Gheo, asta ori îi ceva, ori mere undeva!

J J J14 Februarie. El, timid, susură:- Iubito, azi e Ziua Îndrăgostiţilor...Ea, acră:- Aşa, şi...?!?- Dai şi tu ceva de pomană?

J J JSfat util: Dacă eşti fericit mai mult

de o zi, înseamnă că ceilalţi îţi ascund ceva!

J J JCel mai sigur anticoncepţional

rămîne, în continuare, un NU hotărît!J J J

Se întâlnesc doi ardeleni.Primul întreabă: - Ce număr de telefon are Ion?Al doilea: - Nu prea îmi amintesc.Primul: - Zi-mi aproximativ.

J J JGuvernul de la Chişinău a hotărît

să înfiinţeze Ministerul Marinei. La

Bucureşti s-au mirat:- Pentru ce?!? Doar nu aveţi mare!- Şi ce dacă? Voi nu aveţi Ministerul

Culturii?J J J

Romica Jurcă la DNA! A introdus în ţară un val de frig.

J J JSe numeşte norocos un bărbat care

câştigă mai mult decât poate cheltui nevastă-sa.

Se numeşte norocoasă o femeie care găseşte un astfel de bărbat.

J J JSultanul, super încălzit, vrea să-şi

satisfacă nevestele. După ce se îmbăiază şi se dă cu uleiuri aromate, strigă:

- Eunuc, adu-mi prima nevastă!Se duce eunucul, aduce nevasta,

sultanul face treaba şi iar strigă:- Eunuc, adu-mi a doua nevastă!O rezolvă şi pe asta şi tot aşa până la

a 70-a nevastă, după care strigă:- Eunuc, eunuc, eunuc. Ăsta pauză.Se ridică sultanul să caute eunucul.

Când intră în camera nevestelor, ăsta mort. Morala: nu sexul te omoară, ci alergatul după...

J J JSotul, înainte de a pleca în delegaţie:- Sper că în timpul absenţei mele,

nu mă vei înşela!- Fii liniştit, dragă! Astfel de gânduri

îmi vin numai când eşti lângă mine!

CSM Lugoj, cea mai frumoasă echipă din voleiul românesc (13)

nesigurCulme Acea

Un pitic mitologic

Viteji

Aurel RăuÎnsufleţi-

tori

Aripioară

VafelăIon IliescuPlasă de pescuit

Cântec solemn

Abis!Mersul la

peşte

Prefix pentru între

Dement

Jasmina... A diviza

Strigăt puternic

A apăreaorătanie

(reg.)

Indică ruta

Avânt

Bun de atârnat

Blond Vas mic

Şea

Teodor onaca

Ion olaruDans din secolul

XIX

Aduc ploaia

Loc de origine (fem.)

mir

cea

AN

GH

EL

Horoscop săptămânalBERBEC: Acest nativ are parte de

bani, dar indirect. Mai precis, se schimbă în bine situaţia financiară

a unei persoane din familie sau a unui prieten apropiat. Curând, şi Berbecul va profita de pe urma acestei schim-bări. Nativii care au curajul să încerce ceva nou au parte de numeroase critici După încheierea săptămânii de lucru, se anunţă o distracţie de zile mari.

TAUR: Aceşti nativi au ceva de învă-ţat de la persoana iubită. Aceas-ta fie îl duce într-un loc pe care

Taurul încă nu îl cunoaşte, fie îi face cunoştinţă cu o persoană care, pe viitor, are de jucat un rol important în viaţa sa. Taurul capătă curajul de a face lucruri până acum interzise. Se va remarca prin sfaturile bune pe care le oferă celor din jurul său.

GEMEnI: Vor avea de lucru mai mult decât s-ar fi aşteptat. Prin urmare, trebuie să lase deoparte

orice planuri pentru distracţie: ore-le pe care le credeau libere şi le vor petrece muncind, iar apoi vor fi prea obosiţi pentru a mai ieşi undeva. Ge-menii vorbesc deschis despre ceea ce simt, având de câştigat de pe urma faptului că îşi exprimă sentimentele.

RAC: Acest nativ are multe idei bune şi originale. Totul este să capete şi curajul de a le transpu-

ne în practică. Pentru asta, e nevoie de tăria de a ignora criticile celor din jur. Dacă toţi inventatorii ar fi ascul-tat de critici, am fi trăit încă în peş-teri. Nişte zile mai dificile la locul de muncă, după care totul se va regla, treptat, pe parcursul intervalului.

LEU: Acest nativ îşi va petrece mai mult timp decât de obicei în fa-milie, alături de cei dragi lui.

Acest repaus la domiciliu îi va prin-de foarte bine şi din punct de vedere al stării de sănătate. Există nişte zile favorabile pentru Lei, care îşi văd răsplătite eforturi mai vechi. La sfâr-şitul intervalului leii vor fi printre cei care se vor distra la cote maxime.

FECIoARă: Au de făcut mai multe dru-muri, pe parcursul acestui interval, unele dintre ele total neaşteptate.

Deşi sunt luaţi cam din scurt, pe ne-pregătite, totul va merge foarte bine. Fecioara îşi depăşeşte timiditatea şi vorbeşte deschis despre ceea ce simte şi gândeşte. Onestitatea se dovedeşte foarte prielinică pentru acest nativ.

BALAnţă: Pentru aceşti nativi este posibil ca de la serviciu să so-sească, în sfârşit, o serie de veşti

bune legate de bani. Deocamdată sunt încă la nivel de simplu zvon, dar în curând acesta se va concre-tiza. În acest interval nativii îşi vor depăşii propriilor limite, în timp ce există o înţelegere superioară a vie-ţii. Distracţia şi relaxarea continuă.

SCoRPIon: Beneficiază din plin de aspectul favorabil făcut de cele două planete care îl guvernează:

Marte şi Pluton. Va învăţa foarte repe-de lucruri noi, se adaptează uşor ori-cărei situaţii şi câştigă mulţi prieteni. În acest interval există zilele foarte favorabile, în care Scorpionul are şi energia, dar şi priceperea necesară pentru a reuşi în tot ce îşi propune.

SăGETăToR: Aceşti nativi strâng cu grijă bani, într-un scop precis. Sunt secretoşi în legătură cu

sursele de venit, dar şi cu destina-ţia acestor bani. Din această cau-ză, unele persoane îi vor considera zgârciţi. Săgetătorul ia decizia de a face unele schimbări, în programul său zilnic. Au atât energia necesară, cât şi capacitatea de organizare.

C APRICoRn: Aceşti nativi observă lucruri noi la prietenii vechi. Aceştia s-au schimbat, nu întot-

deauna în bine, astfel că relaţiile cu ei ar trebui supuse unor evaluări criti-ce. Zile dificile la serviciu, dar în final roata se întoarce şi eforturile sunt răsplătite. Sfaturile înţelepte şi pline de tâlc ale Capricornului sunt apreci-ate de toată lumea din jurul lui.

VăRSăToR: Încearcă să facă mereu lucrurile într-un fel propriu, mai special. Uneori reuşeşte,

alteori doar îi încurcă şi pe cei din jur. Dar se vorbeşte în permanenţă despre el şi despre acţiunile sale, iar acesta e un lucru bun. După un înce-put mai greoi în interval, Vărsătorul se dezmeticeşte pe parcurs, având parte în final de veşti foarte bune.

PEŞTI: Au senzaţia neplăcută că diferiţi prieteni şi cunoştinţe au evoluat şi s-au dezvoltat, în timp

ce ei nu au progresat prea mult. Vor încerca să analizeze lucrurile şi să ia măsuri, pentru ca şi în viaţa lor să apară îmbunătăţiri vizibile. Unele zile din interval sunt optime să îşi rezolve atunci o mare parte din probleme.

Jose manuel Durao barroso, fostul preşedinte al Comisiei Europene: “mă simt aproape de Timişoara şi de românia”

Page 12: Actualitatea 961

12 MICA PUBLICITATE 5 - 11 FEBRUARIE 2016ACTUALITATEAVÂND

BMW 320 Berlină, an fabr. 2001, negru-met-alizat, motor 2,0 diesel, 100 KW, 136 PS, euro

3, km 217.000, 5 viteze, consum 4,5%, climatron-

ic, 4 geamuri electrice, închidere centralizată cu

telecomandă, 6 airba-guri, bord computer, ABS ESP servo, tem-

pomat, taxa mediu 640 euro, preţ 2700 euro.

Cârlig remorcare, scaune sport, trapă electrică, pachet schiuri iarnă. Maşina funcţionează şi arată foarte bine.

Informaţii la telefoa-nele: 0732.983.248;

0763.145.802.

VÂND VW Golf 4 Edition, an fabricaţie

2003, negru metalizat, motor 1,6 benzină, 77 KW, 105 PS, euro 4,

km 179.000, 5 viteze, consum 6%, climatronic, închidere centralizată cu telecomandă, 6 airbaguri, bord computer, ABS ESP

servo, taxa mediu 211 euro, 2900 euro.

Informaţii la telefoanele:

imobiliare

VÂND casă în localitatea Bârsa, jud. Arad com-

pusă din: două camere, bucătărie, coridor, anexe, foarte bine aranjată. Su-

prafaţa totală a terenului: 2700 mp. Preţ avanta-jos. Informaţii la tel.:

0769.626.276.

VÂND sau schimb în Timişoara, apartament 4 camere, micro 4, etaj 2, 2 băi, termopane, 2

balcoane, încălzire cen-trală. Informaţii la tel.:

0731.659.012.

VÂND teren la centu-ră, 8300 mp, preţ 10 euro/mp, negociabil. Informaţii la telefon:

0731.544.855.

VÂND de urgenţă un hectar de pământ, situat

pe fostul poligon al arma-tei, în Lugoj, strada Timi-şoarei. Preţ: 1 euro mp., negociabil. Informaţii la telefon: 0772.150.010.

VÂND urgent şi ieftin, în rate, sau schimb cu vari-ante Timişoara, cabană

pe Clisura Dunării, 2 dormitoare, living, baie, bucătărie, mobilată şi

utilată modern. Se poate vedea pe Google (Cabana Beea). Informaţii la tele-

fon: 0740.186.710.

VÂND sau închiriez apartament 3 camere, ultracentral, decoman-

dat, parter, balcon închis,

0732.983.248; 0763.145.802.

VÂND VW Golf 5, 4 uşi, an fabricaţie 2004, negru metalizat, motor 1,9 TDI, 77 KW, 105 PS, euro 4, km 163.000, 5 viteze, consum 4,5%,

carte service, klimatic, închidere centralizată

cu telecomandă tip briceag, 8 airbaguri, 2 chei, încălzire scaune

faţă, bord computer, ABS ESP servo, faţă geamuri electrice, spălător faruri, distribuţie schimbată la 112.000 km/2011, taxa mediu 320 euro, 4900 euro. Informaţii la tele-foanele: 0732.983.248;

0763.145.802.

închirieri ÎNCHIrIEZ

cameră mobilată cămin ITL-T1. Informaţii la

telefon: 0724.511.033.

ÎNCHIrIEZ o cameră la casă, la nefumători.

Încălzire cu lemne. Informaţii la telefon:

0726.368.056.

PrImESC fete în gazdă, condiţii

bune, zona gării: doamna Mărioara. Informaţii la

tel. 0256.358.682.

ÎNCHIrIEZ apartament 2 camere,

nemobilat, fără baie. Str. Bucegi, nr. 26.

Informaţii la telefon: 0722.223.986.

CAuT gazdă în Lugoj, la casă sau la bloc,

pe termen lung. Ofer 60 euro/lună.

Informaţii la telefon: 0761.169.304.

diverseCITAŢIE

Nr. 2439/252/2015Pârâtul Creţu Ion, cu ul-timul domiciliu cunoscut în Lugoj, Blocul Witext, str. N. Titulescu, nr. 78,

et. 2, ap. 39, Judeţul Timiş, în prezent cu

domiciliul necunoscut, este citat la Judecătoria

Lugoj pentru termenul de 25 februarie, ora 8, sala 10, Complet C5-CMF,

în proces cu reclamanta Creţu Monica Rita, având

ca obiect divorţ. Preşedinte,

Simona Mihai Grefier,

Tăutu Ştefan Marius

PIErDuT şi declar nul certificatul de absolvire a cursului de pregătire teoretică şi practică pe linie de arme şi muniţii, seria AJVPS

Nr. 0000387, eliberat în data de 24.01.2008 pe numele Muntean Saşa.

VÂND purcei rasă de carne, negociabil şi

grapă disc 3,2 m, nouă la schimb cu presă de balo-tat paie sau tractor 445

cp. Informaţii la telefon: 0723.675.042.

VÂND purcei viet-namezi. Informaţii la

telefon: 0773.375.859.

VÂND mobilier pentru magazin compus din 6 corpuri cu rafturi şi un

birou/pult, aproape noi. Informaţii la telefon:

0722.553.694.

CumPăr roi de albine la ramă. Socotit la ramă.

Informaţii la tele-foanele: 0756.479.327;

0746.654.642.

VÂND plasmă, cu diametru de 80 cm. Informaţii la telefon:

0726.368.056.

VÂND pian cu coadă 2,40 m; 2 sobe fontă; o

oglindă ovală 39/29-cris-tal. Informaţii la telefon:

0725.862.568.

VÂND urgent şi ieftin maşină combinată de

tâmplărie (abriht, grosi-me, circular şi burghiu), o freză de şlefuit cu bandă, circular unghiular + mul-te alte scule de tâmplărie.

Informaţii la telefon: 0728.494.139.

afaceriPrOFESOr de

matematică - pensionar, meditez elevi din clasele V, VI, VII, VIII pentru învăţarea lecţiilor, pre-

gătirea temelor, testelor, tezelor, recuperări,

concursuri şi evaluări na-ţionale. Pregătirea se va

face la domiciliul elevului. Tel.: 0729.866.710.

EXECuT: zidărie, zugrăvit, rigips, termoizo-laţii, hidroizolaţii, gresie, faianţă, piatră, parchet, podele, lambriuri, insta-laţii sanitare şi electrice.

Tel.: 0723.130.340.

LOCurI DE muNCă în

Danemarca, salariu atractiv, cerinţe: limba engleză, permisul de

conducere constituie un avantaj. Transportul şi

cazarea asigurate de firmă. Informaţii la

telefon: 0737.251.621.

ÎmI OFEr serviciile ca menajeră în zona Lugoj - Făget. Informaţii la telefon:

0723.705.747.

FILmărI video – foto nunţi, botezuri, diferite ocazii, la preţ avantajos

şi calitate deosebită. Informaţii la telefon:

0724.695.679.

aniversăriPENTru

Elisa maria:Un sărut să-ţi vină pe pleoape, iubirea,

fericirea să-ţi fie aproape, un vis frumos

ca al unei poveşti… aşa să fie viaţa

pe care o trăieşti! La mulţi ani fericiţi, draga noastră Elisa! Bunicu’ Nicu şi Lidia.

PENTru Elisa maria:

Viaţa să-ţi aştearnă bucurii nemărginite la

fiecare pas, fericire deplină şi iubire infinită.

La mulţi ani, adorabila noastră!

Mami şi Alex.

PENTruElisa maria:

Îţi dorim să te bucuri de fiecare clipă a vieţii

tale, să ai parte de noroc şi fericire oricând şi

pretutindeni! La mulţi ani! Stefania,

Carmen & Robin.

Numele....................................... Prenumele.......................................Adresa ............................................... Telefon.....................................Textul anunţului ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................

ImPOrTANT! un anunţ costă 3 lei, iar la 3 anunţuri plătite beneficiaţi de unul GrATuIT!

2016 talon mica publicitate 2016

OFEr spre vânzare (sau schimb cu similar Timişoara) apartament deosebit cu 3 camere, complet utilat şi mobilat, în Lugoj, Microraion III, Bl. 32, et.2. Informaţii la telefon 0725.352.316.

Locuri de muncă în Austria

Firmă din Austria oferă locuri de muncă la

îngrijit bătrâni la domiciliu. Se cere

limba germană. mai multe detalii

la tel:0731.544.855

vedere în faţa şi spatele blocului, centrală proprie,

bun pentru cabinete medicale, cabinete de

avocatură, spaţii comer-ciale etc. Preţ avantajos. Informaţii la telefoane-le: 0724.538.444 sau

0749.333.080.

VÂND spaţiu de 529 mp, cu destinaţia cantină, curte de 466 mp şi un teren intravilan de 288 mp, alături de clă-

dire, curennt monofazic şi trifazic. Innformaţii la telefon 0769.233.445.

VÂND teren pentru construcţie în Ţipari. Posibilitate de a tra-ge apă şi posibilitate

pentru canalizare. Preţ: 5 euro/mp, negociabil.

Informaţii la telefoa-nele: 0756.479.327,

0746.654.642.

VÂND casă 3 camere, bucătărie, baie, termoizolată,

geamuri termopane, gaz metan, suprafaţă con-struită aprox. 200 mp, 400 mp grădină+curte.

Strada N. Titulescu. Informaţii la telefon:

0726.486.846.

VÂND casă în localitatea Făget, strada Coşbuc nr. 32, compusă din 2 dormitoare, 1 salon, 2 bucătării, garderobă,

baie, centrală termică pe lemne, curte, grădină. Foarte modernă. Preţ

foarte bun. Informaţii la telefon: 0733.751.354.

autoVÂND Suzuki Swift, an fabricaţie 1996, motor 1000 cm, 2 uşi, benzi-nă, stare impecabilă,

recent adus în ţară. Preţ 550 euro, negociabil. Informaţii la telefon:

0727.977.245.

VÂND maşină Fiat Lineea, an 2010 – 1400 cmc, 50.000 km, unic proprietar, ABS, climă,

culoare gri metalizat. Preţ informativ 6.200 euro. Informaţii la telefon:

0733.751.354.

VÂND Opel Astra H, an fabr. 2004, gri-metalizat, 1,4 benzină, 66 KW, 90

PS, euro 4, km 163.000, 5 viteze, consum 4%, climă,

2 geamuri electrice, închidere centralizată cu telecomandă, tip

briceag, 6 airbaguri, bord computer, ABS ESP

servo, tempomat, lanţ de distribuţie schimbat la

163.000 km, taxa mediu 229 euro, 3500 euro. Informaţii la telefoa-nele: 0732.983.248;

0763.145.802.

Închiriez apartament pe

strada Al. mocioni nr. 14 (vizavi de

magazinul Profi), mobilat şi dotat

cu toate utilităţile. 180 euro/ lună.

Informaţii la tel: 0761.141.569.

VÂND casă în Lugoj, ultra-central (zona par-

cului George Enescu, str. Romanilor), 1.000 mp, compusă din: grădină, livadă şi viţă de vie 500

mp, curte 250 mp şi casă

din cărămidă compusă din: hol tranzit, 5 camere,

beci, bucătărie, baie, garaj, magazii şi anexe. Front stradal 16,5 m.

Utilităţi: apă, canal, gazul pe faţadă. Încălzire pe

lemne în sobe teracotă. Informaţii la telefon

0784.172.599.

ÎNCHIrIEZ 2 apartamente

pe strada A. mocioni

nr. 14, recent renovate şi mobilate,

dotate cu centrală termică. Preţul de

închiriere 160 euro/lună şi garanţia 400 euro care se plăteşte

la momentul în-chirierii. Informaţii

la telefon: 0761.141.569.

În săptămâna 4-10 februarie 2016, prietenii noştri de pe Facebook

împlinesc o vârstă frumoasă. Cu această ocazie, Actualitatea le

urează un sincer La mulţi ani!

Carla PredaDaniela blajovanFlorin E. brînzei

mirela CiornovalicDarie Georgetaboghean Gelureberca mariamihaela Canea

Vlad D. Placintăramona Cruceru

rogobete mariaLina Stanca

Doru ViseganEva bardoş

ungurean DanielaSorin boiaşu

Diandra DavidAmalia PacurariuSintescu Ciprianrodica muntean

Pavel CherciuCasian Iova

Violeta SarbuAmalia Oprea

Petrica DamianDaniela Luca

Dany Lupulescu

răducu Cezaramariana VakariaClaudia Ionescu

Virgil răzesurodinel moroşanu

Vasile HateganDorel Dejica

Andy DobrescuAndrada Iova

Tibulec Cristinaroxana Subţire

madoni Alexandru

Calin PirvuAlex botoş

rocsy DubaAndreea Kriştof

rascu CristiIrina brăescu

Doru VeliciConstantin Severin

Lucia CroitoruCristi Novăcescu

Patrick Voichescubone LoredanaTimofte Cătălin

Liliana mărciulescuIgor ursenco

marie Vrânceanurobert Kristof

Nicoleta PopescuIonuţ borca

Krishi Cristianmaria Dandu Sergiu boian

Angelica balaş

VÂND casă în Buziaş, str. Timişul (în apropi-erea parcului) 1.439 mp compusă din: grădină,

livadă, curte şi casă nivel de înălţime M + P + 1E

(mezanin, parter şi etaj); garaj. Front stradal 30 m. Utilităţi: apă, canal. Informaţii la telefon.

0784 172 599

Page 13: Actualitatea 961

TVR 1TVR 1TVR 1TVR 1TVR 109:00 Starea naþiei09:00 Starea naþiei09:00 Starea naþiei09:00 Starea naþiei09:00 Starea naþiei11:0011:0011:0011:0011:00 Cãlãtori în lumiCãlãtori în lumiCãlãtori în lumiCãlãtori în lumiCãlãtori în lumi

paraleleparaleleparaleleparaleleparalele12:30 Comorile Toscanei13:05 O þarã mai bunã

(reluare)13:30 M.A.I. aproape de

tine15:30 Oameni ca noi16:00 Parlamentul

României17:00 Ne vedem la TVR19:00 Exclusiv în România

Prezintã: CristianTabãrã

19:45 Sport20:00 Telejurnal21:10 PIEDONE ÎN21:10 PIEDONE ÎN21:10 PIEDONE ÎN21:10 PIEDONE ÎN21:10 PIEDONE ÎN

EGIPT EGIPT EGIPT EGIPT EGIPT (comedie,Italia, 1979) Cu: BudSpencer, EnzoCannavale,Leopoldo Trieste,Angelo Infanti

23:05 LOVE RANCH23:05 LOVE RANCH23:05 LOVE RANCH23:05 LOVE RANCH23:05 LOVE RANCH(dramã, SUA/Germania, 2010) Cu:Helen Mirren, JoePesci

01:05 Exclusiv în România(reluare)

01:45 01:45 01:45 01:45 01:45 PIEDONE ÎNPIEDONE ÎNPIEDONE ÎNPIEDONE ÎNPIEDONE ÎNEGIPT EGIPT EGIPT EGIPT EGIPT (reluare)

03:30 Telejurnal (reluare)04:20 Poveºti în halate albe

(reluare)04:45 Ne vedem la TVR

(reluare)

PRO TVPRO TVPRO TVPRO TVPRO TV10:30 La Mãruþã

(reluare)12:00 Vorbeºte lumea12:00 Vorbeºte lumea12:00 Vorbeºte lumea12:00 Vorbeºte lumea12:00 Vorbeºte lumea

Cu: Cove, Nadine,Sore ºi VicaBlochina

13:00 ªtirile Pro TV14:00 Vorbeºte lumea14:00 Vorbeºte lumea14:00 Vorbeºte lumea14:00 Vorbeºte lumea14:00 Vorbeºte lumea

Cu: Rãzvan Fodor,Nadina, Sore, VicaBlochina

15:00 Lecþii de viaþã16:00 Ce spun românii

Cu Cabral17:00 ªtirile PRO TV17:30 La Mãruþã.

Emisiune tabloidprezentatã deCãtãlin Mãruþã

19:00 ªtirile PRO TV20:30 JOCURILE20:30 JOCURILE20:30 JOCURILE20:30 JOCURILE20:30 JOCURILE

FOAMEI:FOAMEI:FOAMEI:FOAMEI:FOAMEI:SFIDAREASFIDAREASFIDAREASFIDAREASFIDAREA(acþiune, SUA,2013) Cu: JenniferLawrence, LiamHemsworth, JackQuaid

23:15 REGA23:15 REGA23:15 REGA23:15 REGA23:15 REGATULTULTULTULTULDRAGONILORDRAGONILORDRAGONILORDRAGONILORDRAGONILOR(acþiune, 2008) Cu:Andy Law, SammoHung Kam-Bo,Maggie Q, VannessWu

01:1501:1501:1501:1501:15 JOCURILEJOCURILEJOCURILEJOCURILEJOCURILEFOAMEI:FOAMEI:FOAMEI:FOAMEI:FOAMEI:SFIDAREASFIDAREASFIDAREASFIDAREASFIDAREA(reluare)

ANTENA 1ANTENA 1ANTENA 1ANTENA 1ANTENA 108:00 Neatza cu08:00 Neatza cu08:00 Neatza cu08:00 Neatza cu08:00 Neatza cu

rãzvan ºi Danirãzvan ºi Danirãzvan ºi Danirãzvan ºi Danirãzvan ºi Dani11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru

fiul meufiul meufiul meufiul meufiul meureality showmatrimonial Cu:Andreea Mantea

14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentrufiul meufiul meufiul meufiul meufiul meureality showmatrimonialCu: AndreeaMantea

17:00 17:00 17:00 17:00 17:00 Acces directAcces directAcces directAcces directAcces directEmisiune tabloidprezentatã deSimona Gherghe

19:00 ObservatorCu AndreeaBerecleanu

20:00 Observator specialEmisiune prezentatãde OctaviaGeamãnu

20:30 T20:30 T20:30 T20:30 T20:30 TAKEN 3:AKEN 3:AKEN 3:AKEN 3:AKEN 3:TEROARE ÎN L.A.TEROARE ÎN L.A.TEROARE ÎN L.A.TEROARE ÎN L.A.TEROARE ÎN L.A.(acþiune, Franþa,2014) Cu: LiamNeeson, ForestWhitaker, MaggieGrace, FamkeJanssen

22:30 JOHNNY22:30 JOHNNY22:30 JOHNNY22:30 JOHNNY22:30 JOHNNYENGLISHENGLISHENGLISHENGLISHENGLISH(comedie, 2003)Cu: RowanAtkinson, NataliaImburglia

PRIMA TVPRIMA TVPRIMA TVPRIMA TVPRIMA TV10:00 Focus din inima10:00 Focus din inima10:00 Focus din inima10:00 Focus din inima10:00 Focus din inima

RomânieiRomânieiRomânieiRomânieiRomâniei11:30 Focus magazin

(reluare)12:10 La TV12:10 La TV12:10 La TV12:10 La TV12:10 La TV (reluare)13:50 Cronica zilei

Pastilã de umor15:00 Râzi ºi câºtigi

(reluare)15:30 Cireºa de pe tort15:30 Cireºa de pe tort15:30 Cireºa de pe tort15:30 Cireºa de pe tort15:30 Cireºa de pe tort

(reluare)16:25 Cronica zilei. Pastilã

de umor (reluare)19:15 Cireºa de pe tort19:15 Cireºa de pe tort19:15 Cireºa de pe tort19:15 Cireºa de pe tort19:15 Cireºa de pe tort20:10 Cronica zilei20:10 Cronica zilei20:10 Cronica zilei20:10 Cronica zilei20:10 Cronica zilei

Pastilã de umorPastilã de umorPastilã de umorPastilã de umorPastilã de umor20:15 Nunþi de poveste20:15 Nunþi de poveste20:15 Nunþi de poveste20:15 Nunþi de poveste20:15 Nunþi de poveste

Cu: Nicoleta Luciu ºiDenis ªtefan(reluare)

22:15 La TV22:15 La TV22:15 La TV22:15 La TV22:15 La TVCu: Grig Chiroiu

23:00 T23:00 T23:00 T23:00 T23:00 TrãsniþiirãsniþiirãsniþiirãsniþiirãsniþiiEpisoadele 20, 21,22, 23 din sezonul25 (reluare)

02:00 Nunþi de poveste02:00 Nunþi de poveste02:00 Nunþi de poveste02:00 Nunþi de poveste02:00 Nunþi de povesteCu: Nicoleta Luciu ºiDenis ªtefan(reluare)

03:15 Dupã faptã ºi rãsplatã(reluare)

04:00 Trãdaþi în dragoste(reluare)

04:30 Adevãrul Live05:00 Iubiri secrete05:00 Iubiri secrete05:00 Iubiri secrete05:00 Iubiri secrete05:00 Iubiri secrete06:00 Focus06:00 Focus06:00 Focus06:00 Focus06:00 Focus

(reluare)

HBOHBOHBOHBOHBO06:00 ACEAST06:00 ACEAST06:00 ACEAST06:00 ACEAST06:00 ACEASTA ESTEA ESTEA ESTEA ESTEA ESTE

LUMEA MEALUMEA MEALUMEA MEALUMEA MEALUMEA MEA07:25 GODZILLA07:25 GODZILLA07:25 GODZILLA07:25 GODZILLA07:25 GODZILLA09:25 UN ANTRENOR09:25 UN ANTRENOR09:25 UN ANTRENOR09:25 UN ANTRENOR09:25 UN ANTRENOR

DE LEGENDÃDE LEGENDÃDE LEGENDÃDE LEGENDÃDE LEGENDÃ(dramã, SUA, 2014)

11:20 NU VOM AVEA11:20 NU VOM AVEA11:20 NU VOM AVEA11:20 NU VOM AVEA11:20 NU VOM AVEANICIODANICIODANICIODANICIODANICIODATÃTÃTÃTÃTÃPARISULPARISULPARISULPARISULPARISUL(comedie, SUA,2014)

12:50 AUTORII12:50 AUTORII12:50 AUTORII12:50 AUTORII12:50 AUTORIIANONIMIANONIMIANONIMIANONIMIANONIMI(comedie, SUA,2014)

14:25 REÞET14:25 REÞET14:25 REÞET14:25 REÞET14:25 REÞETAAAAADRAGOSTEIDRAGOSTEIDRAGOSTEIDRAGOSTEIDRAGOSTEI(dramã, SUA, 2007)

16:10 NEW YORK16:10 NEW YORK16:10 NEW YORK16:10 NEW YORK16:10 NEW YORKMELODYMELODYMELODYMELODYMELODY(dramã, SUA, 2013)Cu: Keira Knightley

17:55 Filme ºi vedete17:55 Filme ºi vedete17:55 Filme ºi vedete17:55 Filme ºi vedete17:55 Filme ºi vedete18:30 ACEAST18:30 ACEAST18:30 ACEAST18:30 ACEAST18:30 ACEASTA ESTEA ESTEA ESTEA ESTEA ESTE

LUMEA MEALUMEA MEALUMEA MEALUMEA MEALUMEA MEA(dramã, SUA, 2014)Cu: Kristen Wiig

20:00 Riposta20:00 Riposta20:00 Riposta20:00 Riposta20:00 Riposta20:50 O CÃLÃ20:50 O CÃLÃ20:50 O CÃLÃ20:50 O CÃLÃ20:50 O CÃLÃTORIE CUTORIE CUTORIE CUTORIE CUTORIE CU

MIZÃ MAREMIZÃ MAREMIZÃ MAREMIZÃ MAREMIZÃ MARE(dramã, SUA, 2015)Cu: BenMendelsohn

22:40 MAREA22:40 MAREA22:40 MAREA22:40 MAREA22:40 MAREAFRUMUSEÞEFRUMUSEÞEFRUMUSEÞEFRUMUSEÞEFRUMUSEÞE(dramã, Italia, 2013)

01:00 ANNABELLE01:00 ANNABELLE01:00 ANNABELLE01:00 ANNABELLE01:00 ANNABELLE(horror, SUA, 2014)

NAÞIONALNAÞIONALNAÞIONALNAÞIONALNAÞIONAL12:15 Baronii12:15 Baronii12:15 Baronii12:15 Baronii12:15 Baronii13:30 Dragoste dulce-13:30 Dragoste dulce-13:30 Dragoste dulce-13:30 Dragoste dulce-13:30 Dragoste dulce-

amarãamarãamarãamarãamarãCu: Hina Khan

14:45 Mica mireasã14:45 Mica mireasã14:45 Mica mireasã14:45 Mica mireasã14:45 Mica mireasã (r)16:15 Dragoste dulce-16:15 Dragoste dulce-16:15 Dragoste dulce-16:15 Dragoste dulce-16:15 Dragoste dulce-

amarãamarãamarãamarãamarã17:30 Specialiºti în17:30 Specialiºti în17:30 Specialiºti în17:30 Specialiºti în17:30 Specialiºti în

sãnãtatesãnãtatesãnãtatesãnãtatesãnãtate18:00 Baronii 18:00 Baronii 18:00 Baronii 18:00 Baronii 18:00 Baronii (r)19:1519:1519:1519:1519:15 Suflete trãdateSuflete trãdateSuflete trãdateSuflete trãdateSuflete trãdate20:15 20:15 20:15 20:15 20:15 Dragoste ºi urãDragoste ºi urãDragoste ºi urãDragoste ºi urãDragoste ºi urã22:30 18 DEGETE ALE22:30 18 DEGETE ALE22:30 18 DEGETE ALE22:30 18 DEGETE ALE22:30 18 DEGETE ALE

MORÞIIMORÞIIMORÞIIMORÞIIMORÞII (acþiune, SUA,2006) Cu: LorenzoLamas

TV 1000TV 1000TV 1000TV 1000TV 100005:00 PRINS LA05:00 PRINS LA05:00 PRINS LA05:00 PRINS LA05:00 PRINS LA

ÎNGHESUIALÃÎNGHESUIALÃÎNGHESUIALÃÎNGHESUIALÃÎNGHESUIALÃ07:00 CADILLAC07:00 CADILLAC07:00 CADILLAC07:00 CADILLAC07:00 CADILLAC

RECORDSRECORDSRECORDSRECORDSRECORDS09:00 PAGINA OPT09:00 PAGINA OPT09:00 PAGINA OPT09:00 PAGINA OPT09:00 PAGINA OPT11:00 ENGLEZUL CARE11:00 ENGLEZUL CARE11:00 ENGLEZUL CARE11:00 ENGLEZUL CARE11:00 ENGLEZUL CARE

A URCAA URCAA URCAA URCAA URCAT OT OT OT OT OCOLINÃ DAR ACOLINÃ DAR ACOLINÃ DAR ACOLINÃ DAR ACOLINÃ DAR ACOBORÂCOBORÂCOBORÂCOBORÂCOBORÂT UNT UNT UNT UNT UNMUNTEMUNTEMUNTEMUNTEMUNTE

12:50 PASIUNE12:50 PASIUNE12:50 PASIUNE12:50 PASIUNE12:50 PASIUNENEAªTEPTNEAªTEPTNEAªTEPTNEAªTEPTNEAªTEPTAAAAATÃTÃTÃTÃTÃ

14:30 COLUMBUS14:30 COLUMBUS14:30 COLUMBUS14:30 COLUMBUS14:30 COLUMBUSCIRCLECIRCLECIRCLECIRCLECIRCLE

16:00 UN BÃRBA16:00 UN BÃRBA16:00 UN BÃRBA16:00 UN BÃRBA16:00 UN BÃRBATTTTTMULMULMULMULMULTIPLICATIPLICATIPLICATIPLICATIPLICATTTTT

18:00 21 DE GRAME18:00 21 DE GRAME18:00 21 DE GRAME18:00 21 DE GRAME18:00 21 DE GRAME20:00 OAMENI SERIOªI20:00 OAMENI SERIOªI20:00 OAMENI SERIOªI20:00 OAMENI SERIOªI20:00 OAMENI SERIOªI

KANAL DKANAL DKANAL DKANAL DKANAL D08:00 Teo Show

(reluare)13:30 Te vreau lângã

mine16:45 Teo Show

Emisiune dedivertismentprezentatã de TeoTrandafir

20:0020:0020:0020:0020:00 Bahar: Viaþã Bahar: Viaþã Bahar: Viaþã Bahar: Viaþã Bahar: ViaþãfuratãfuratãfuratãfuratãfuratãCu: Ezgi Asaroglu,Keremcem, SinanAlbayrak

22:30 Norã pentru Leana00:30 ªtirile Kanal D

(reluare)01:4501:4501:4501:4501:45 Bahar: ViaþãBahar: ViaþãBahar: ViaþãBahar: ViaþãBahar: Viaþã

furatãfuratãfuratãfuratãfuratã Cu: EzgiAsaroglu,Keremcem, SinanAlbayrak (reluare)

TVR 2TVR 2TVR 2TVR 2TVR 210:00 Ultimele10:00 Ultimele10:00 Ultimele10:00 Ultimele10:00 Ultimele

caravane dincaravane dincaravane dincaravane dincaravane dinSaharaSaharaSaharaSaharaSahara

11:00 Legea lui Doyle11:00 Legea lui Doyle11:00 Legea lui Doyle11:00 Legea lui Doyle11:00 Legea lui Doyle(reluare)

12:00 12:00 12:00 12:00 12:00 La fixLa fixLa fixLa fixLa fix13:20 Arta fericirii13:20 Arta fericirii13:20 Arta fericirii13:20 Arta fericirii13:20 Arta fericirii14:30 Cultura minoritãþilor17:00 Legea lui Doyle17:00 Legea lui Doyle17:00 Legea lui Doyle17:00 Legea lui Doyle17:00 Legea lui Doyle17:50 Cartea cea de toate

zilele19:00 Naturã ºi aventurã20:10 Poveste dupã

poveste21:00 Arte, carte ºi capricii23:10 BIUTIFUL 23:10 BIUTIFUL 23:10 BIUTIFUL 23:10 BIUTIFUL 23:10 BIUTIFUL (dramã,

coprod. SUA, 2010)Cu: Javier Bardem,Maricel Alvarez,Hanaa Bouchaib

01:40 Deportaþii(reluare)

ACASÃ TVACASÃ TVACASÃ TVACASÃ TVACASÃ TV06:00 Vorbeºte lumea

(reluare)08:45 Avenida Brasil08:45 Avenida Brasil08:45 Avenida Brasil08:45 Avenida Brasil08:45 Avenida Brasil11:15 11:15 11:15 11:15 11:15 Lupta rozelorLupta rozelorLupta rozelorLupta rozelorLupta rozelor

(reluare)14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti

a mea!a mea!a mea!a mea!a mea!17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu

perecheperecheperecheperechepereche18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor

(reluare)03:15 Doamne de poveste04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan

(reluare)05:15 Doamne de poveste

(reluare)

PRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMA067:15 BALADA LUI LUCY WHIPPLE067:15 BALADA LUI LUCY WHIPPLE067:15 BALADA LUI LUCY WHIPPLE067:15 BALADA LUI LUCY WHIPPLE067:15 BALADA LUI LUCY WHIPPLE10:45 La bloc 10:45 La bloc 10:45 La bloc 10:45 La bloc 10:45 La bloc (r) 12:45 EU SUNT MOªUL12:45 EU SUNT MOªUL12:45 EU SUNT MOªUL12:45 EU SUNT MOªUL12:45 EU SUNT MOªUL(comedie, SUA, 2001) (reluare) 14:3014:3014:3014:3014:30CRÃCIUN CU FAMILIA KRANKCRÃCIUN CU FAMILIA KRANKCRÃCIUN CU FAMILIA KRANKCRÃCIUN CU FAMILIA KRANKCRÃCIUN CU FAMILIA KRANK 16:3016:3016:3016:3016:30La blocLa blocLa blocLa blocLa bloc 18:30 GLADIA 18:30 GLADIA 18:30 GLADIA 18:30 GLADIA 18:30 GLADIATORII ROMEITORII ROMEITORII ROMEITORII ROMEITORII ROMEI(reluare) 20:30 20:30 20:30 20:30 20:30 KARAKARAKARAKARAKARATE KID TE KID TE KID TE KID TE KID (dramã, SUA,1984) Cu: Ralph Macchio, Pat Morita,Elisabeth Shue 23:00 STRÃZILE23:00 STRÃZILE23:00 STRÃZILE23:00 STRÃZILE23:00 STRÃZILEÎNDURÃRI ÎNDURÃRI ÎNDURÃRI ÎNDURÃRI ÎNDURÃRI (dramã, SUA, 2000) Cu: EricRoberts, David White, Stacy Keach, L. Taylor(reluare) 01:15 01:15 01:15 01:15 01:15 PLIMBAREPLIMBAREPLIMBAREPLIMBAREPLIMBARE (scurtmetraj,România, 2013) Cu V.Seciu 01:30 MEREU01:30 MEREU01:30 MEREU01:30 MEREU01:30 MEREULA PRIMA ÎNTÂLNIRE LA PRIMA ÎNTÂLNIRE LA PRIMA ÎNTÂLNIRE LA PRIMA ÎNTÂLNIRE LA PRIMA ÎNTÂLNIRE 03:15 Cine A.M.

DIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSAL08:00 Chipul rãzbunãrii 09:00 08:00 Chipul rãzbunãrii 09:00 08:00 Chipul rãzbunãrii 09:00 08:00 Chipul rãzbunãrii 09:00 08:00 Chipul rãzbunãrii 09:00 MISSMISSMISSMISSMISSMARPLE: CADAVRUL DIN BIBLIOTECÃMARPLE: CADAVRUL DIN BIBLIOTECÃMARPLE: CADAVRUL DIN BIBLIOTECÃMARPLE: CADAVRUL DIN BIBLIOTECÃMARPLE: CADAVRUL DIN BIBLIOTECÃ11:00 Medici începãtori 12:00 11:00 Medici începãtori 12:00 11:00 Medici începãtori 12:00 11:00 Medici începãtori 12:00 11:00 Medici începãtori 12:00 CRIMELECRIMELECRIMELECRIMELECRIMELEDIN MIDSOMER: THE DAGGER CLUBDIN MIDSOMER: THE DAGGER CLUBDIN MIDSOMER: THE DAGGER CLUBDIN MIDSOMER: THE DAGGER CLUBDIN MIDSOMER: THE DAGGER CLUB14:00 Neveste disperate14:00 Neveste disperate14:00 Neveste disperate14:00 Neveste disperate14:00 Neveste disperate 17:00 MISS 17:00 MISS 17:00 MISS 17:00 MISS 17:00 MISSMARPLE: CRIMÃ LA VICARIAMARPLE: CRIMÃ LA VICARIAMARPLE: CRIMÃ LA VICARIAMARPLE: CRIMÃ LA VICARIAMARPLE: CRIMÃ LA VICARIAT T T T T 19:0019:0019:0019:0019:00Hawaii 5.0 20:00 În mintea criminaluluiHawaii 5.0 20:00 În mintea criminaluluiHawaii 5.0 20:00 În mintea criminaluluiHawaii 5.0 20:00 În mintea criminaluluiHawaii 5.0 20:00 În mintea criminalului21:00 ARMAGEDDON: SFÂRªITUL21:00 ARMAGEDDON: SFÂRªITUL21:00 ARMAGEDDON: SFÂRªITUL21:00 ARMAGEDDON: SFÂRªITUL21:00 ARMAGEDDON: SFÂRªITULLUMII LUMII LUMII LUMII LUMII (SUA, 1998) 00:00 00:00 00:00 00:00 00:00 ESCAPADÃESCAPADÃESCAPADÃESCAPADÃESCAPADÃSUPER SUPER SUPER SUPER SUPER (dramã, SUA, 2013) 01:45 Chipul01:45 Chipul01:45 Chipul01:45 Chipul01:45 Chipulrãzbunãri i 02:45 rãzbunãri i 02:45 rãzbunãri i 02:45 rãzbunãri i 02:45 rãzbunãri i 02:45 CRIMELE DINCRIMELE DINCRIMELE DINCRIMELE DINCRIMELE DINMIDSOMER: THE DAGGER CLUBMIDSOMER: THE DAGGER CLUBMIDSOMER: THE DAGGER CLUBMIDSOMER: THE DAGGER CLUBMIDSOMER: THE DAGGER CLUB 04:25 04:25 04:25 04:25 04:25MISS MARPLE: CRIMÃ LA VICARIAMISS MARPLE: CRIMÃ LA VICARIAMISS MARPLE: CRIMÃ LA VICARIAMISS MARPLE: CRIMÃ LA VICARIAMISS MARPLE: CRIMÃ LA VICARIATTTTT

09:00 Politicã ºi delicateþuri10:00 Zon@10:30 Maºini, teste ºi

verdicte11:10 O datã-n viaþã

(reluare)14:30 CHARLOT14:30 CHARLOT14:30 CHARLOT14:30 CHARLOT14:30 CHARLOT

EVEVEVEVEVADAADAADAADAADATTTTT(comedie, SUA,1917) Cu: CharlesChaplin

15:00 Ora regelui16:00 Bon anniversaire,

Monsieur Chopin17:15 SÃ JEFUIM17:15 SÃ JEFUIM17:15 SÃ JEFUIM17:15 SÃ JEFUIM17:15 SÃ JEFUIM

BANCA!BANCA!BANCA!BANCA!BANCA! (comedie, Franþa,1964) Cu: Louis deFunes

18:50 Teleenciclopedia19:45 Sport19:55 Starea zilei20:00 Telejurnal21:0021:0021:0021:0021:00 Nebunii de peNebunii de peNebunii de peNebunii de peNebunii de pe

Madison AvenueMadison AvenueMadison AvenueMadison AvenueMadison Avenue22:45 Starea zilei. Emisiune

de Dragoº Pãtraru22:50 Starea naþiei23:45 Profesioniºtii...cu

Eugenia Vodã00:40 UN TRECÃ00:40 UN TRECÃ00:40 UN TRECÃ00:40 UN TRECÃ00:40 UN TRECÃTOR ÎNTOR ÎNTOR ÎNTOR ÎNTOR ÎN

PLOAIEPLOAIEPLOAIEPLOAIEPLOAIE(thriller, Franþa/Italia,1970) Cu: CharlesBronson, MarleneJobert, Jill Ireland

02:40 Zon@03:55 În grãdina Danei (r)

10:00 Ce spun românii10:00 Ce spun românii10:00 Ce spun românii10:00 Ce spun românii10:00 Ce spun românii11:00 JURNALUL UNUI11:00 JURNALUL UNUI11:00 JURNALUL UNUI11:00 JURNALUL UNUI11:00 JURNALUL UNUI

PUªTIPUªTIPUªTIPUªTIPUªTI (comedie, SUA,2010) Cu: ZacharyGordon, RobertCapron, RachelHarris, Steve Zahn

13:00 ªtirile PRO TV13:0513:0513:0513:0513:05 OSTOSTOSTOSTOSTAAAAATICULTICULTICULTICULTICUL

(comedie, SUA,1999) Cu: JamieFoxx, Nia Long,John Cullum, SarahPaulson

15:00 TICÃLOªII15:00 TICÃLOªII15:00 TICÃLOªII15:00 TICÃLOªII15:00 TICÃLOªII(comedie, SUA,1988) Cu: SteveMartin, MichaelCain, Glenne Headly

17:15 I-AM DA17:15 I-AM DA17:15 I-AM DA17:15 I-AM DA17:15 I-AM DAT DET DET DET DET DECAPÃCAPÃCAPÃCAPÃCAPÃT? T? T? T? T? (comedie,SUA/Canada, 2007)Cu: Ice Cube, NiaLong, John C.McGinley, AleishaAllen, Philip Bolden

19:00 ªtirile PRO TV20:30 Las Fierbinþi20:30 Las Fierbinþi20:30 Las Fierbinþi20:30 Las Fierbinþi20:30 Las Fierbinþi22:15 ANUL UNU22:15 ANUL UNU22:15 ANUL UNU22:15 ANUL UNU22:15 ANUL UNU

(comedie, SUA,2009) Cu: JackBlack, Michael Cera,Oliver Platt, DavidCross, CristopherMintz-Plasse, VinnieJones

00:00 Las Fierbinþi 00:00 Las Fierbinþi 00:00 Las Fierbinþi 00:00 Las Fierbinþi 00:00 Las Fierbinþi (r)

06:00 Observator.Emisiuneinformativã

10:00 CÃSÃ10:00 CÃSÃ10:00 CÃSÃ10:00 CÃSÃ10:00 CÃSÃTORIE CUTORIE CUTORIE CUTORIE CUTORIE CUREPETIÞIEREPETIÞIEREPETIÞIEREPETIÞIEREPETIÞIE(comedie, România,1985) Cu: MirceaDiaconu, DragaOlteanu Matei,CatrinelDumitrescu,Octavian Cotescu

13:00 Observator14:0014:0014:0014:0014:00 Mireasã pentruMireasã pentruMireasã pentruMireasã pentruMireasã pentru

fiul meufiul meufiul meufiul meufiul meuCu MirelaBoureanu Vaida

16:30 T16:30 T16:30 T16:30 T16:30 Te pui cue pui cue pui cue pui cue pui cublondele?blondele?blondele?blondele?blondele?

19:00 ObservatorEmisiuneinformativã

20:00 ÎNFRUNT20:00 ÎNFRUNT20:00 ÎNFRUNT20:00 ÎNFRUNT20:00 ÎNFRUNTAREAAREAAREAAREAAREATITTITTITTITTITANILORANILORANILORANILORANILOR(aventuri, SUA,2010) Cu: SamWorthington, JasonFlemyng, RalphFiennes, LiamNeeson, MadsMikkelsen

22:00 AL22:00 AL22:00 AL22:00 AL22:00 ALVIN ªIVIN ªIVIN ªIVIN ªIVIN ªIVEVERIÞELE:VEVERIÞELE:VEVERIÞELE:VEVERIÞELE:VEVERIÞELE:NAUFRAGIAÞIINAUFRAGIAÞIINAUFRAGIAÞIINAUFRAGIAÞIINAUFRAGIAÞII(animaþie, SUA,2011) Cu: AmyPoehler, MatthewGray Gubler

PRIMA TVPRIMA TVPRIMA TVPRIMA TVPRIMA TV10:00 Jurnalul STV10:00 Jurnalul STV10:00 Jurnalul STV10:00 Jurnalul STV10:00 Jurnalul STV

JuniorJuniorJuniorJuniorJunior11:00 Focus magazin11:00 Focus magazin11:00 Focus magazin11:00 Focus magazin11:00 Focus magazin

Best ofBest ofBest ofBest ofBest of11:45 Constantin 60’11:45 Constantin 60’11:45 Constantin 60’11:45 Constantin 60’11:45 Constantin 60’15:15 La TV15:15 La TV15:15 La TV15:15 La TV15:15 La TV

Episodul 6(reluare)

16:00 OPERAÞIUNEA16:00 OPERAÞIUNEA16:00 OPERAÞIUNEA16:00 OPERAÞIUNEA16:00 OPERAÞIUNEA“MONSTRUL”“MONSTRUL”“MONSTRUL”“MONSTRUL”“MONSTRUL” (comedie,România, 1978)Cu: Toma Cragiu,Octavian Cotescu

18:00 Focus19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort

Cu: Horia Vîrlan(reluare)

20:1520:1520:1520:1520:15 Schimb de mameSchimb de mameSchimb de mameSchimb de mameSchimb de mame22:00 Mãrul discordiei22:00 Mãrul discordiei22:00 Mãrul discordiei22:00 Mãrul discordiei22:00 Mãrul discordiei

(reluare)00:00 OPERAÞIUNEA00:00 OPERAÞIUNEA00:00 OPERAÞIUNEA00:00 OPERAÞIUNEA00:00 OPERAÞIUNEA

“MONSTRUL”“MONSTRUL”“MONSTRUL”“MONSTRUL”“MONSTRUL” (comedie,România, 1978)Cu: Toma Cragiu,Octavian Cotescu (reluare)

02:15 Focus magazinEmisiune tabloidCu Diana Bart(reluare)

03:00 Cireaºa de pe tortCu Horia Vîrlan(reluare)

03:30 Jurnalul STV Junior(reluare)

04:30 Iubiri secrete04:30 Iubiri secrete04:30 Iubiri secrete04:30 Iubiri secrete04:30 Iubiri secrete

HBOHBOHBOHBOHBO06:00 AL06:00 AL06:00 AL06:00 AL06:00 ALT LOVET LOVET LOVET LOVET LOVE

BUILDINGBUILDINGBUILDINGBUILDINGBUILDING(comedie, România,2015)

07:55 DANSURI DE07:55 DANSURI DE07:55 DANSURI DE07:55 DANSURI DE07:55 DANSURI DESTRADÃ: SHOW-STRADÃ: SHOW-STRADÃ: SHOW-STRADÃ: SHOW-STRADÃ: SHOW-UL VEDETELORUL VEDETELORUL VEDETELORUL VEDETELORUL VEDETELOR

09:40 PROFII09:40 PROFII09:40 PROFII09:40 PROFII09:40 PROFII11:10 LIGA DREPTÃÞII:11:10 LIGA DREPTÃÞII:11:10 LIGA DREPTÃÞII:11:10 LIGA DREPTÃÞII:11:10 LIGA DREPTÃÞII:

TRONUL DINTRONUL DINTRONUL DINTRONUL DINTRONUL DINAAAAATLANTISTLANTISTLANTISTLANTISTLANTIS

12:25 MAREA12:25 MAREA12:25 MAREA12:25 MAREA12:25 MAREAFRUMUSEÞEFRUMUSEÞEFRUMUSEÞEFRUMUSEÞEFRUMUSEÞE

14:45 PUNCT ªI DE LA14:45 PUNCT ªI DE LA14:45 PUNCT ªI DE LA14:45 PUNCT ªI DE LA14:45 PUNCT ªI DE LACAPÃCAPÃCAPÃCAPÃCAPÃTTTTT

16:30 AL16:30 AL16:30 AL16:30 AL16:30 ALT LOVET LOVET LOVET LOVET LOVEBUILDINGBUILDINGBUILDINGBUILDINGBUILDING(comedie, România,2015)

18:25 CEI P18:25 CEI P18:25 CEI P18:25 CEI P18:25 CEI PAAAAATRUTRUTRUTRUTRUFFFFFANTANTANTANTANTASTICI:ASTICI:ASTICI:ASTICI:ASTICI:ASCENSIUNEAASCENSIUNEAASCENSIUNEAASCENSIUNEAASCENSIUNEALUI SILLUI SILLUI SILLUI SILLUI SILVERVERVERVERVERSURFERSURFERSURFERSURFERSURFER(SF, SUA, 2007)

20:00 DL. TURNER20:00 DL. TURNER20:00 DL. TURNER20:00 DL. TURNER20:00 DL. TURNER(dramã, coprod.,2014) Cu: TimothySpall

22:30 UN ET22:30 UN ET22:30 UN ET22:30 UN ET22:30 UN ETAJ MAIAJ MAIAJ MAIAJ MAIAJ MAIJOSJOSJOSJOSJOS(dramã, România,2015) Cu: TeodorCorban

00:05 Riposta00:05 Riposta00:05 Riposta00:05 Riposta00:05 Riposta00:55 RAIDUL 200:55 RAIDUL 200:55 RAIDUL 200:55 RAIDUL 200:55 RAIDUL 2

(acþiune, Indonezia,2014)

NAÞIONALNAÞIONALNAÞIONALNAÞIONALNAÞIONAL08:30 Vouã08:30 Vouã08:30 Vouã08:30 Vouã08:30 Vouã09:00 Baronii09:00 Baronii09:00 Baronii09:00 Baronii09:00 Baronii12:00 CÃLÃ12:00 CÃLÃ12:00 CÃLÃ12:00 CÃLÃ12:00 CÃLÃTORIETORIETORIETORIETORIE

MAGICÃ ÎNMAGICÃ ÎNMAGICÃ ÎNMAGICÃ ÎNMAGICÃ ÎNAFRICAAFRICAAFRICAAFRICAAFRICA

14:00 14:00 14:00 14:00 14:00 UN BUNIC DEUN BUNIC DEUN BUNIC DEUN BUNIC DEUN BUNIC DEPOMINÃPOMINÃPOMINÃPOMINÃPOMINÃ (dr4amã, SUA,2004) Cu: V. Argo

16:0016:0016:0016:0016:00 Furie ºi dragoste Furie ºi dragoste Furie ºi dragoste Furie ºi dragoste Furie ºi dragoste19:15 Suflete trãdate19:15 Suflete trãdate19:15 Suflete trãdate19:15 Suflete trãdate19:15 Suflete trãdate20:15 Iubire interzisã20:15 Iubire interzisã20:15 Iubire interzisã20:15 Iubire interzisã20:15 Iubire interzisã22:00 Fosta mea iubire22:00 Fosta mea iubire22:00 Fosta mea iubire22:00 Fosta mea iubire22:00 Fosta mea iubire23:4523:4523:4523:4523:45 Cãlãtorie magicãCãlãtorie magicãCãlãtorie magicãCãlãtorie magicãCãlãtorie magicã

în Africaîn Africaîn Africaîn Africaîn Africa01:45 Albumul

naþional (reluare)

TV 1000TV 1000TV 1000TV 1000TV 100005:00 ENGLEZUL CARE05:00 ENGLEZUL CARE05:00 ENGLEZUL CARE05:00 ENGLEZUL CARE05:00 ENGLEZUL CARE

A URCAA URCAA URCAA URCAA URCAT OT OT OT OT OCOLINÃ DAR ACOLINÃ DAR ACOLINÃ DAR ACOLINÃ DAR ACOLINÃ DAR ACOBORÂCOBORÂCOBORÂCOBORÂCOBORÂT UNT UNT UNT UNT UNMUNTEMUNTEMUNTEMUNTEMUNTE

07:00 OAMENI SERIOªI07:00 OAMENI SERIOªI07:00 OAMENI SERIOªI07:00 OAMENI SERIOªI07:00 OAMENI SERIOªI08:50 UN BÃRBA08:50 UN BÃRBA08:50 UN BÃRBA08:50 UN BÃRBA08:50 UN BÃRBATTTTT

MULMULMULMULMULTIPLICATIPLICATIPLICATIPLICATIPLICATTTTT10:50 VIAÞA MEA DE10:50 VIAÞA MEA DE10:50 VIAÞA MEA DE10:50 VIAÞA MEA DE10:50 VIAÞA MEA DE

PÂNÃ ACUMPÂNÃ ACUMPÂNÃ ACUMPÂNÃ ACUMPÂNÃ ACUM12:30 AVENTURILE LUI12:30 AVENTURILE LUI12:30 AVENTURILE LUI12:30 AVENTURILE LUI12:30 AVENTURILE LUI

SHARKBOY ªISHARKBOY ªISHARKBOY ªISHARKBOY ªISHARKBOY ªILAVAGIRL ÎN 3DLAVAGIRL ÎN 3DLAVAGIRL ÎN 3DLAVAGIRL ÎN 3DLAVAGIRL ÎN 3D

14:00 DOVADA14:00 DOVADA14:00 DOVADA14:00 DOVADA14:00 DOVADA15:45 GA15:45 GA15:45 GA15:45 GA15:45 GATTTTTTTTTTACAACAACAACAACA17:30 MUZICA INIMII17:30 MUZICA INIMII17:30 MUZICA INIMII17:30 MUZICA INIMII17:30 MUZICA INIMII19:30 SHAKESPEARE19:30 SHAKESPEARE19:30 SHAKESPEARE19:30 SHAKESPEARE19:30 SHAKESPEARE

ÎNDRÃGOSTITÎNDRÃGOSTITÎNDRÃGOSTITÎNDRÃGOSTITÎNDRÃGOSTIT

KANAL DKANAL DKANAL DKANAL DKANAL D07:00 ªtiri07:00 ªtiri07:00 ªtiri07:00 ªtiri07:00 ªtiri Kanal DKanal DKanal DKanal DKanal D

(reluare)08:30 08:30 08:30 08:30 08:30 Pastila de râsPastila de râsPastila de râsPastila de râsPastila de râs11:30 Fetele lu’ domn11:30 Fetele lu’ domn11:30 Fetele lu’ domn11:30 Fetele lu’ domn11:30 Fetele lu’ domn

profesorprofesorprofesorprofesorprofesor13:45 13:45 13:45 13:45 13:45 Roata noroculuiRoata noroculuiRoata noroculuiRoata noroculuiRoata norocului

Emisiune concurscu Adrian Cristea ºiAna MariaBarnoschi

16:00 Te vreau lângãmine

20:00 Asta-i România!Best of Cu Mihai Ghiþã

21:30 21:30 21:30 21:30 21:30 Sabbagh înSabbagh înSabbagh înSabbagh înSabbagh înacþ iuneacþ iuneacþ iuneacþ iuneacþ iune

22:30 DINCOLO DE22:30 DINCOLO DE22:30 DINCOLO DE22:30 DINCOLO DE22:30 DINCOLO DEÎNTUNERICÎNTUNERICÎNTUNERICÎNTUNERICÎNTUNERIC (dramã, SUA,2012) Cu:Sigourney Weaver

TVR 2TVR 2TVR 2TVR 2TVR 209:30 Mic dejun cu un

campion10:30 Povestitorul:10:30 Povestitorul:10:30 Povestitorul:10:30 Povestitorul:10:30 Povestitorul:

Legendele GrecieiLegendele GrecieiLegendele GrecieiLegendele GrecieiLegendele GrecieiAnticeAnticeAnticeAnticeAntice

12:30 Misterele istoriei12:30 Misterele istoriei12:30 Misterele istoriei12:30 Misterele istoriei12:30 Misterele istoriei13:00 Deportaþii14:10 ÎMPREUNÃ14:10 ÎMPREUNÃ14:10 ÎMPREUNÃ14:10 ÎMPREUNÃ14:10 ÎMPREUNÃ

PENTRUPENTRUPENTRUPENTRUPENTRUTOTDEAUNATOTDEAUNATOTDEAUNATOTDEAUNATOTDEAUNA(comedie, SUA,2000)

15:50 Cartea cea de toatezilele

16:00 Memorialul durerii17:00 Popasuri folclorice18:30 Locuri, oameni ºi

comori20:10 PAPILLON20:10 PAPILLON20:10 PAPILLON20:10 PAPILLON20:10 PAPILLON

(aventuri, SUA,1973) Cu: SteveMcQueen

ACASÃ TVACASÃ TVACASÃ TVACASÃ TVACASÃ TV06:00 Case cu personalitate08:00 Sufletul meu08:00 Sufletul meu08:00 Sufletul meu08:00 Sufletul meu08:00 Sufletul meu

perecheperecheperecheperechepereche09:15 Lupta rozelor09:15 Lupta rozelor09:15 Lupta rozelor09:15 Lupta rozelor09:15 Lupta rozelor

(reluare)11:30 Avenida Brasil11:30 Avenida Brasil11:30 Avenida Brasil11:30 Avenida Brasil11:30 Avenida Brasil

(reluare)15:00 Diamantul nopþii15:00 Diamantul nopþii15:00 Diamantul nopþii15:00 Diamantul nopþii15:00 Diamantul nopþii

Cu: A. Arambula16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti

a mea!a mea!a mea!a mea!a mea!17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu

perecheperecheperecheperechepereche18:00 Suflet cãlãtor18:00 Suflet cãlãtor18:00 Suflet cãlãtor18:00 Suflet cãlãtor18:00 Suflet cãlãtor20:00 O DA20:00 O DA20:00 O DA20:00 O DA20:00 O DATÃ ÎN VIAÞÃTÃ ÎN VIAÞÃTÃ ÎN VIAÞÃTÃ ÎN VIAÞÃTÃ ÎN VIAÞÃ22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla01:30 Suflet cãlãtor01:30 Suflet cãlãtor01:30 Suflet cãlãtor01:30 Suflet cãlãtor01:30 Suflet cãlãtor03:00 Acasã la români

(reluare)04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan

PRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMA08:15 La Mãruþã08:15 La Mãruþã08:15 La Mãruþã08:15 La Mãruþã08:15 La Mãruþã 09:45 La bloc09:45 La bloc09:45 La bloc09:45 La bloc09:45 La bloc (reluare)11:45 GLADIA11:45 GLADIA11:45 GLADIA11:45 GLADIA11:45 GLADIATORII ROMEI TORII ROMEI TORII ROMEI TORII ROMEI TORII ROMEI (reluare)13:30 KARA13:30 KARA13:30 KARA13:30 KARA13:30 KARATE KID TE KID TE KID TE KID TE KID (dramã, SUA, 1984)Cu: Ralph Macchio, Pat Morita, ElisabethShue (reluare) 16:00 La bloc 18:0016:00 La bloc 18:0016:00 La bloc 18:0016:00 La bloc 18:0016:00 La bloc 18:00RAÞIUNE ªI SIMÞIRE RAÞIUNE ªI SIMÞIRE RAÞIUNE ªI SIMÞIRE RAÞIUNE ªI SIMÞIRE RAÞIUNE ªI SIMÞIRE (dramã, coprod.,1995) (reluare) 20:30 20:30 20:30 20:30 20:30 DEJA MORT DEJA MORT DEJA MORT DEJA MORT DEJA MORT (acþiune,SUA, 2007) Cu: Ron Eldard, Til Schweiger,Patrick Kilpatrick,Geoff Pierson, MarisaCoughlan, Christopher Plummer, ConneryHoffman 22:30 ARBORELE VIEÞII22:30 ARBORELE VIEÞII22:30 ARBORELE VIEÞII22:30 ARBORELE VIEÞII22:30 ARBORELE VIEÞII (dramã,SUA, 2011) Cu: Brad Pitt, Sean Penn, Jes-sica Chastain,Tye Sheridan, Fiona Shaw

TVR 1TVR 1TVR 1TVR 1TVR 1 PRO TVPRO TVPRO TVPRO TVPRO TV10:00 Ce spun românii10:00 Ce spun românii10:00 Ce spun românii10:00 Ce spun românii10:00 Ce spun românii

(reluare)11:00 OST11:00 OST11:00 OST11:00 OST11:00 OSTAAAAATICULTICULTICULTICULTICUL

(comedie, SUA,1999) Cu: JamieFoxx, Nia Long,John Cullum, SarahPaulson

13:05 13:05 13:05 13:05 13:05 TICÃLOªIITICÃLOªIITICÃLOªIITICÃLOªIITICÃLOªII(comedie, SUA,1988) Cu: SteveMartin, MichaelCain, Glenne Headly(reluare)

15:1515:1515:1515:1515:15 I-AM DAI-AM DAI-AM DAI-AM DAI-AM DAT DET DET DET DET DECAPÃCAPÃCAPÃCAPÃCAPÃT? T? T? T? T? (comedie,SUA/Canada, 2007)Cu: Ice Cube, NiaLong, John C.McGinley, AleishaAllen, Philip Bolden (reluare)

17:00 UN AN DE17:00 UN AN DE17:00 UN AN DE17:00 UN AN DE17:00 UN AN DEPOMINÃPOMINÃPOMINÃPOMINÃPOMINÃ(comedie, SUA,2011) Cu: JohnClees, Jack Black,Zahf Paroo, StacyScowley, MichaelKarl Richards,Owen Wilson, RosaMunde Pike

20:30 KILLER ELITE:20:30 KILLER ELITE:20:30 KILLER ELITE:20:30 KILLER ELITE:20:30 KILLER ELITE:ÎNFRUNTÎNFRUNTÎNFRUNTÎNFRUNTÎNFRUNTAREAAREAAREAAREAAREA(acþiune, SUA/Australia, 2011)Cu: Jason Statham,Clive Owen

ANTENA 1ANTENA 1ANTENA 1ANTENA 1ANTENA 109:00 AL09:00 AL09:00 AL09:00 AL09:00 ALVIN ªIVIN ªIVIN ªIVIN ªIVIN ªI

VEVERIÞELE:VEVERIÞELE:VEVERIÞELE:VEVERIÞELE:VEVERIÞELE:NAUFRAGIAÞIINAUFRAGIAÞIINAUFRAGIAÞIINAUFRAGIAÞIINAUFRAGIAÞII(animaþie, SUA,2011) Cu: AmyPoehler, MatthewGray Gubler(reluare)

11:00 B.D. ÎN ALERTÃ11:00 B.D. ÎN ALERTÃ11:00 B.D. ÎN ALERTÃ11:00 B.D. ÎN ALERTÃ11:00 B.D. ÎN ALERTÃ (comedie,România, 1970)Cu: Toma Cragiu,Ouiu Cãlinescu,Dem Rãdulescu,Jean Constantin,Sebastian Papaiani

13:00 13:00 13:00 13:00 13:00 ObservatorObservatorObservatorObservatorObservator14:00 X Factor:14:00 X Factor:14:00 X Factor:14:00 X Factor:14:00 X Factor:

Best Moments (I)Best Moments (I)Best Moments (I)Best Moments (I)Best Moments (I)16:00 SuperBingo16:00 SuperBingo16:00 SuperBingo16:00 SuperBingo16:00 SuperBingo

Metropolis.Metropolis.Metropolis.Metropolis.Metropolis.EmisiuneEmisiuneEmisiuneEmisiuneEmisiuneconcursconcursconcursconcursconcurs

17:30 X Factor:17:30 X Factor:17:30 X Factor:17:30 X Factor:17:30 X Factor:Best MomentsBest MomentsBest MomentsBest MomentsBest Moments(II)(II)(II)(II)(II)

19:00 Observator20:00 20:00 20:00 20:00 20:00 MrMrMrMrMr. Bean. Bean. Bean. Bean. Bean20:30 CURSÃ20:30 CURSÃ20:30 CURSÃ20:30 CURSÃ20:30 CURSÃ

MORMORMORMORMORTTTTTALÃ:ALÃ:ALÃ:ALÃ:ALÃ:INFERNULINFERNULINFERNULINFERNULINFERNUL (acþiune, SUA,2012) Cu: DannyTrejo, Luke Goss,Ving Rhames

22:30 OCHI DE VUL22:30 OCHI DE VUL22:30 OCHI DE VUL22:30 OCHI DE VUL22:30 OCHI DE VULTURTURTURTURTUR(thriller, SUA, 2008)Cu: M. Monaghan

PRIMA TVPRIMA TVPRIMA TVPRIMA TVPRIMA TV08:45 Casa: construcþie08:45 Casa: construcþie08:45 Casa: construcþie08:45 Casa: construcþie08:45 Casa: construcþie

ºi designºi designºi designºi designºi design10:00 Secrete de stil10:00 Secrete de stil10:00 Secrete de stil10:00 Secrete de stil10:00 Secrete de stil10:30 10:30 10:30 10:30 10:30 PlaytechPlaytechPlaytechPlaytechPlaytech

(reluare)11:00 Salvaþi iubirea11:00 Salvaþi iubirea11:00 Salvaþi iubirea11:00 Salvaþi iubirea11:00 Salvaþi iubirea12:30 Îmbânzirea scorpiei

(reluare)13:30 Mondenii (reluare)15:30 CHIRIÞA LA IAªI15:30 CHIRIÞA LA IAªI15:30 CHIRIÞA LA IAªI15:30 CHIRIÞA LA IAªI15:30 CHIRIÞA LA IAªI

(comedie, România,1987) Cu: DragaOlteanu Matei, DemRãdulescu, ªtefanTapalagã, CezaraDafinescu, MihaiFotino

17:30 Cronica zilei19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort

Cu: Horia Vîrlan(reluare)

20:15 Schimb20:15 Schimb20:15 Schimb20:15 Schimb20:15 Schimbde mamede mamede mamede mamede mameReality Show

22:00 T22:00 T22:00 T22:00 T22:00 Trãdaþi înrãdaþi înrãdaþi înrãdaþi înrãdaþi îndragostedragostedragostedragostedragoste

00:00 00:00 00:00 00:00 00:00 CHIRIÞA LA IAªICHIRIÞA LA IAªICHIRIÞA LA IAªICHIRIÞA LA IAªICHIRIÞA LA IAªI(comedie, România,1987) Cu: DragaOlteanu Matei, DemRãdulescu, ªtefanTapalagã, CezaraDafinescu, MihaiFotino(reluare)

02:00 Schimb de mame(reluare)

03:00 Cireaºa de pe tort (r)

HBOHBOHBOHBOHBO06:00 JOHN TUCKER06:00 JOHN TUCKER06:00 JOHN TUCKER06:00 JOHN TUCKER06:00 JOHN TUCKER

TREBUIE SÃTREBUIE SÃTREBUIE SÃTREBUIE SÃTREBUIE SÃMOARÃMOARÃMOARÃMOARÃMOARÃ

07:30 BLESTEMUL07:30 BLESTEMUL07:30 BLESTEMUL07:30 BLESTEMUL07:30 BLESTEMULREGELUI MIDASREGELUI MIDASREGELUI MIDASREGELUI MIDASREGELUI MIDAS

09:10 PINGUINII DIN09:10 PINGUINII DIN09:10 PINGUINII DIN09:10 PINGUINII DIN09:10 PINGUINII DINMADAGASCARMADAGASCARMADAGASCARMADAGASCARMADAGASCAR

10:45 CEI P10:45 CEI P10:45 CEI P10:45 CEI P10:45 CEI PAAAAATRUTRUTRUTRUTRUFFFFFANTANTANTANTANTASTICI:ASTICI:ASTICI:ASTICI:ASTICI:ASCENSIUNEAASCENSIUNEAASCENSIUNEAASCENSIUNEAASCENSIUNEALUI SILCVERLUI SILCVERLUI SILCVERLUI SILCVERLUI SILCVERSURFERSURFERSURFERSURFERSURFER

12:20 DL. TURNER12:20 DL. TURNER12:20 DL. TURNER12:20 DL. TURNER12:20 DL. TURNER(dramã, MareaBritanie, 2014)

14:45 CIRCUL14:45 CIRCUL14:45 CIRCUL14:45 CIRCUL14:45 CIRCUL(dramã, MareaBritanie, 2013)

16:25 DACÃ Aª16:25 DACÃ Aª16:25 DACÃ Aª16:25 DACÃ Aª16:25 DACÃ AªRÃMÂNERÃMÂNERÃMÂNERÃMÂNERÃMÂNE(dramã, SUA, 2014)

18:10 VERONICA MARS18:10 VERONICA MARS18:10 VERONICA MARS18:10 VERONICA MARS18:10 VERONICA MARS(poliþist, SUA, 2014)Cu: Kristen Bell

20:00 SUPRAVIEÞUITO-20:00 SUPRAVIEÞUITO-20:00 SUPRAVIEÞUITO-20:00 SUPRAVIEÞUITO-20:00 SUPRAVIEÞUITO-RULRULRULRULRUL(rãzboi, SUA, 2013)

22:00 PRÃDÃ22:00 PRÃDÃ22:00 PRÃDÃ22:00 PRÃDÃ22:00 PRÃDÃTOR DETOR DETOR DETOR DETOR DENOAPTENOAPTENOAPTENOAPTENOAPTE(thriller, SUA, 2014)Cu: Jake Gyllenhaal

23:55 GREU DE UCIS 423:55 GREU DE UCIS 423:55 GREU DE UCIS 423:55 GREU DE UCIS 423:55 GREU DE UCIS 4(acþiune, SUA,2007) Cu: BruceWillis

02:00 SUPRAVIEÞUITO-02:00 SUPRAVIEÞUITO-02:00 SUPRAVIEÞUITO-02:00 SUPRAVIEÞUITO-02:00 SUPRAVIEÞUITO-RULRULRULRULRUL (rãzboi, SUA,2013)

NAÞIONALNAÞIONALNAÞIONALNAÞIONALNAÞIONAL06:15 Albumul naþional06:15 Albumul naþional06:15 Albumul naþional06:15 Albumul naþional06:15 Albumul naþional09:00 Suflete trãdate09:00 Suflete trãdate09:00 Suflete trãdate09:00 Suflete trãdate09:00 Suflete trãdate12:0012:0012:0012:0012:00 UN BUNIC DEUN BUNIC DEUN BUNIC DEUN BUNIC DEUN BUNIC DE

POMINÃPOMINÃPOMINÃPOMINÃPOMINÃ (dramã, SUA,2014) Cu: VictorArgo, Celine Marget

14:00 Opriþi timpul!16:45 Iubire interzisã19:1519:1519:1519:1519:15 Suflete trãdateSuflete trãdateSuflete trãdateSuflete trãdateSuflete trãdate

Cu: Firoza Khan20:15 COMISARUL20:15 COMISARUL20:15 COMISARUL20:15 COMISARUL20:15 COMISARUL

INDRAJEETINDRAJEETINDRAJEETINDRAJEETINDRAJEET(dramã, India, 1991)Cu: ArmitabhBachchan,Jayapradha

TV 1000TV 1000TV 1000TV 1000TV 100005:00 VAN WILDER:05:00 VAN WILDER:05:00 VAN WILDER:05:00 VAN WILDER:05:00 VAN WILDER:

PRIMUL AN DEPRIMUL AN DEPRIMUL AN DEPRIMUL AN DEPRIMUL AN DEFFFFFACULACULACULACULACULTTTTTAAAAATETETETETE

07:00 VIAÞA MEA DE07:00 VIAÞA MEA DE07:00 VIAÞA MEA DE07:00 VIAÞA MEA DE07:00 VIAÞA MEA DEPÂNÃ ACUMPÂNÃ ACUMPÂNÃ ACUMPÂNÃ ACUMPÂNÃ ACUM

09:00 AVENTURILE LUI09:00 AVENTURILE LUI09:00 AVENTURILE LUI09:00 AVENTURILE LUI09:00 AVENTURILE LUISHARKBOY ªISHARKBOY ªISHARKBOY ªISHARKBOY ªISHARKBOY ªILAVAGIRL ÎN 3DLAVAGIRL ÎN 3DLAVAGIRL ÎN 3DLAVAGIRL ÎN 3DLAVAGIRL ÎN 3D

11:00 DOVADA11:00 DOVADA11:00 DOVADA11:00 DOVADA11:00 DOVADA12:40 SHAKESPEAR12:40 SHAKESPEAR12:40 SHAKESPEAR12:40 SHAKESPEAR12:40 SHAKESPEAR

ÎNDRÃGOSTITÎNDRÃGOSTITÎNDRÃGOSTITÎNDRÃGOSTITÎNDRÃGOSTIT14:40 SURPRIZÃ: VINE14:40 SURPRIZÃ: VINE14:40 SURPRIZÃ: VINE14:40 SURPRIZÃ: VINE14:40 SURPRIZÃ: VINE

POLLPOLLPOLLPOLLPOLLY!Y!Y!Y!Y!16:10 RACHEL SE16:10 RACHEL SE16:10 RACHEL SE16:10 RACHEL SE16:10 RACHEL SE

MÃRITÃMÃRITÃMÃRITÃMÃRITÃMÃRITÃ18:00 ELIZABETH18:00 ELIZABETH18:00 ELIZABETH18:00 ELIZABETH18:00 ELIZABETH20:00 LEGILE MIªCÃRII20:00 LEGILE MIªCÃRII20:00 LEGILE MIªCÃRII20:00 LEGILE MIªCÃRII20:00 LEGILE MIªCÃRII21:30 8 MILE21:30 8 MILE21:30 8 MILE21:30 8 MILE21:30 8 MILE

KANAL DKANAL DKANAL DKANAL DKANAL D08:3008:3008:3008:3008:30 Pastila de râs Pastila de râs Pastila de râs Pastila de râs Pastila de râs12:00 Pastila de râs12:00 Pastila de râs12:00 Pastila de râs12:00 Pastila de râs12:00 Pastila de râs13:4513:4513:4513:4513:45 Fetele lui domn’Fetele lui domn’Fetele lui domn’Fetele lui domn’Fetele lui domn’

profesorprofesorprofesorprofesorprofesor14:45 SURFER DE14:45 SURFER DE14:45 SURFER DE14:45 SURFER DE14:45 SURFER DE

NISANISANISANISANISA (comedie, coprod.,2005) Cu: JeanDujardin

17:00 Asta-i România!17:00 Asta-i România!17:00 Asta-i România!17:00 Asta-i România!17:00 Asta-i România!Cu Mihai Ghiþã

20:00 Pistruiatul20:00 Pistruiatul20:00 Pistruiatul20:00 Pistruiatul20:00 PistruiatulEpisodul 2

22:00 Ochii din umbrãCu Ernest

23:30 VAMPS23:30 VAMPS23:30 VAMPS23:30 VAMPS23:30 VAMPS (comedie, SUA,2012) Cu: AliciaSilverstone, LarryWillmore, KrystenRitter

02:45 Ochii din umbrã (r)

TVR 2TVR 2TVR 2TVR 2TVR 209:00 Ferma12:00 Cap compas12:00 Cap compas12:00 Cap compas12:00 Cap compas12:00 Cap compas12:30 A doua emigrare12:30 A doua emigrare12:30 A doua emigrare12:30 A doua emigrare12:30 A doua emigrare13:00 Naturã ºi13:00 Naturã ºi13:00 Naturã ºi13:00 Naturã ºi13:00 Naturã ºi

aventurãaventurãaventurãaventurãaventurã13:30 Naturã ºi sãnãtate14:10 La porþile pãmântului16:00 Festivalul

Internaþional de Circde la Monte Carlo

18:00 Telejurnal20:10 CAPCANA20:10 CAPCANA20:10 CAPCANA20:10 CAPCANA20:10 CAPCANA

MERCENARILORMERCENARILORMERCENARILORMERCENARILORMERCENARILOR(aventuri, România,1981) Cu: GheorgheCozorici, SergiuNicolaescu, MirceaAlbulescu, AmzaPelea

22:10 MORGEN22:10 MORGEN22:10 MORGEN22:10 MORGEN22:10 MORGEN(dramã, coprod.,2010)

ACASÃ TVACASÃ TVACASÃ TVACASÃ TVACASÃ TV06:00 Case cu personalitate08:45 Suflet cãlãtor08:45 Suflet cãlãtor08:45 Suflet cãlãtor08:45 Suflet cãlãtor08:45 Suflet cãlãtor11:30 O DA11:30 O DA11:30 O DA11:30 O DA11:30 O DATÃ ÎN VIAÞÃTÃ ÎN VIAÞÃTÃ ÎN VIAÞÃTÃ ÎN VIAÞÃTÃ ÎN VIAÞÃ14:00 Pasiune interyisã14:00 Pasiune interyisã14:00 Pasiune interyisã14:00 Pasiune interyisã14:00 Pasiune interyisã15:00 Diamantul nopþii15:00 Diamantul nopþii15:00 Diamantul nopþii15:00 Diamantul nopþii15:00 Diamantul nopþii16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti

a mea! a mea! a mea! a mea! a mea! Cu:Angelique Boyer,Arambula C. Bach

17:0017:0017:0017:0017:00 Sufletul meuSufletul meuSufletul meuSufletul meuSufletul meuperecheperecheperecheperechepereche

18:00 Suflet cãlãtor18:00 Suflet cãlãtor18:00 Suflet cãlãtor18:00 Suflet cãlãtor18:00 Suflet cãlãtor20:00 AMINTIRI20:00 AMINTIRI20:00 AMINTIRI20:00 AMINTIRI20:00 AMINTIRI22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla01:30 Suflet cãlãtor01:30 Suflet cãlãtor01:30 Suflet cãlãtor01:30 Suflet cãlãtor01:30 Suflet cãlãtor03:00 Acasã la români04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan

(reluare)05:15 Dincolo de poveºtiri

(reluare)

PRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMA08:30 Doamne de poveste 08:30 Doamne de poveste 08:30 Doamne de poveste 08:30 Doamne de poveste 08:30 Doamne de poveste 11:30 KA-11:30 KA-11:30 KA-11:30 KA-11:30 KA-RARARARARATE KIDTE KIDTE KIDTE KIDTE KID (reluare) 13:4513:4513:4513:4513:45 RAÞIUNE ªI RAÞIUNE ªI RAÞIUNE ªI RAÞIUNE ªI RAÞIUNE ªISIMÞIRESIMÞIRESIMÞIRESIMÞIRESIMÞIRE (dramã, coprod., 1995) Cu: KateWinslet, Emma Thompson, Hugh Grant, AllanRickman (reluare) 18:15 O PACOSTE DE 18:15 O PACOSTE DE 18:15 O PACOSTE DE 18:15 O PACOSTE DE 18:15 O PACOSTE DECOMOARÃ COMOARÃ COMOARÃ COMOARÃ COMOARÃ (comedie, SUA, 1994) (reluare)20:30 JULIE ªI JULIA 20:30 JULIE ªI JULIA 20:30 JULIE ªI JULIA 20:30 JULIE ªI JULIA 20:30 JULIE ªI JULIA (comedie, SUA,2009) Cu Meryl Streep, Amy Adams, StanleyTucci 23:00 SE MAI ÎNTÂMPLÃ 23:00 SE MAI ÎNTÂMPLÃ 23:00 SE MAI ÎNTÂMPLÃ 23:00 SE MAI ÎNTÂMPLÃ 23:00 SE MAI ÎNTÂMPLÃ (comedie,SUA/Canada, 2011) Cu: Krysten Ritter, KateBosworth, Rachel Bilson, Geoff Stults, JustinKirk (reluare) 01:0001:0001:0001:0001:00 JULIE ªI JULIAJULIE ªI JULIAJULIE ªI JULIAJULIE ªI JULIAJULIE ªI JULIA(comedie, SUA, 2009) 03:15 Cine A.M.

DIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSAL0606060606:00 Chipul rãzbunãrii 11:00 :00 Chipul rãzbunãrii 11:00 :00 Chipul rãzbunãrii 11:00 :00 Chipul rãzbunãrii 11:00 :00 Chipul rãzbunãrii 11:00 CRIMELECRIMELECRIMELECRIMELECRIMELEDIN MIDSOMER: THE SICILIAN DE-DIN MIDSOMER: THE SICILIAN DE-DIN MIDSOMER: THE SICILIAN DE-DIN MIDSOMER: THE SICILIAN DE-DIN MIDSOMER: THE SICILIAN DE-FENCEFENCEFENCEFENCEFENCE 13:00 13:00 13:00 13:00 13:00 CRIMELE DIN MIDSOMER:CRIMELE DIN MIDSOMER:CRIMELE DIN MIDSOMER:CRIMELE DIN MIDSOMER:CRIMELE DIN MIDSOMER:SCHOOLED IN MURDERSCHOOLED IN MURDERSCHOOLED IN MURDERSCHOOLED IN MURDERSCHOOLED IN MURDER 15:00 MISS15:00 MISS15:00 MISS15:00 MISS15:00 MISSMARPLE: GREENSHAMARPLE: GREENSHAMARPLE: GREENSHAMARPLE: GREENSHAMARPLE: GREENSHAWS FOLLWS FOLLWS FOLLWS FOLLWS FOLLY 17:00Y 17:00Y 17:00Y 17:00Y 17:00CASA DE LÂNGÃ LAC 19:00 CASA DE LÂNGÃ LAC 19:00 CASA DE LÂNGÃ LAC 19:00 CASA DE LÂNGÃ LAC 19:00 CASA DE LÂNGÃ LAC 19:00 AnatomiaAnatomiaAnatomiaAnatomiaAnatomialui Greylui Greylui Greylui Greylui Grey 21:00 TREI BÃRBAÞI ªI O MICÃ 21:00 TREI BÃRBAÞI ªI O MICÃ 21:00 TREI BÃRBAÞI ªI O MICÃ 21:00 TREI BÃRBAÞI ªI O MICÃ 21:00 TREI BÃRBAÞI ªI O MICÃDOMNIªOARA DOMNIªOARA DOMNIªOARA DOMNIªOARA DOMNIªOARA (comedie, SUA, 1990) Cu:Tom Selleck 23:00 23:00 23:00 23:00 23:00 O ESCAPO ESCAPO ESCAPO ESCAPO ESCAPADÃ SUPERADÃ SUPERADÃ SUPERADÃ SUPERADÃ SUPER(dramã, SUA, 2013) Cu: Lori Loughlin(reluare) 00:50 MISS MARPLE:00:50 MISS MARPLE:00:50 MISS MARPLE:00:50 MISS MARPLE:00:50 MISS MARPLE:CADAVRUL DIN BIBLIOTECÃCADAVRUL DIN BIBLIOTECÃCADAVRUL DIN BIBLIOTECÃCADAVRUL DIN BIBLIOTECÃCADAVRUL DIN BIBLIOTECÃ 02:00 02:00 02:00 02:00 02:00Neveste disperate Neveste disperate Neveste disperate Neveste disperate Neveste disperate Ep. 7-10 din sez. 8

TVR 1TVR 1TVR 1TVR 1TVR 1 PRO TVPRO TVPRO TVPRO TVPRO TV ANTENA 1ANTENA 1ANTENA 1ANTENA 1ANTENA 1

DIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSAL06 :00 Ana tomia lu i Grey 11 :0006 :00 Ana tomia lu i Grey 11 :0006 :00 Ana tomia lu i Grey 11 :0006 :00 Ana tomia lu i Grey 11 :0006 :00 Ana tomia lu i Grey 11 :00CRIMELE DIN MIDSOMER: WRITTENCRIMELE DIN MIDSOMER: WRITTENCRIMELE DIN MIDSOMER: WRITTENCRIMELE DIN MIDSOMER: WRITTENCRIMELE DIN MIDSOMER: WRITTENIN THE STIN THE STIN THE STIN THE STIN THE STARS ARS ARS ARS ARS 13:00 CRIMELE DIN13:00 CRIMELE DIN13:00 CRIMELE DIN13:00 CRIMELE DIN13:00 CRIMELE DINMIDSOMER: DEAMIDSOMER: DEAMIDSOMER: DEAMIDSOMER: DEAMIDSOMER: DEATH AND THE DIVTH AND THE DIVTH AND THE DIVTH AND THE DIVTH AND THE DIVASASASASAS15:00 MISS MARPLE: A CARIBBEAN15:00 MISS MARPLE: A CARIBBEAN15:00 MISS MARPLE: A CARIBBEAN15:00 MISS MARPLE: A CARIBBEAN15:00 MISS MARPLE: A CARIBBEANMYSTERY 17:00 ÎN ECHIPÃ MYSTERY 17:00 ÎN ECHIPÃ MYSTERY 17:00 ÎN ECHIPÃ MYSTERY 17:00 ÎN ECHIPÃ MYSTERY 17:00 ÎN ECHIPÃ (dramã,SUA, 2010) Cu: Crystal Brown 19:00 19:00 19:00 19:00 19:00 ÎnÎnÎnÎnÎnmintea criminalului mintea criminalului mintea criminalului mintea criminalului mintea criminalului 21:00 TRECUTUL21:00 TRECUTUL21:00 TRECUTUL21:00 TRECUTUL21:00 TRECUTULGEORGIEI GEORGIEI GEORGIEI GEORGIEI GEORGIEI (dramã, Australia, 2011) Cu: PiaMiranda 22:50 22:50 22:50 22:50 22:50 Anatomia lui GreyAnatomia lui GreyAnatomia lui GreyAnatomia lui GreyAnatomia lui Grey 00:5000:5000:5000:5000:50MISS MARPLE: ENDLESS NIGHT 02:40MISS MARPLE: ENDLESS NIGHT 02:40MISS MARPLE: ENDLESS NIGHT 02:40MISS MARPLE: ENDLESS NIGHT 02:40MISS MARPLE: ENDLESS NIGHT 02:40Neveste disperateNeveste disperateNeveste disperateNeveste disperateNeveste disperate Episoadele 1 - 4 dinsezonul 8 Cu: Teri Hatcher, F. Huffman

07:55 Discover07:55 Discover07:55 Discover07:55 Discover07:55 DiscoverRomâniaRomâniaRomâniaRomâniaRomânia

08:1008:1008:1008:1008:10 UniversulUniversulUniversulUniversulUniversulcredinþeicredinþeicredinþeicredinþeicredinþei

10:00 În grãdina Danei10:35 Viaþa satului13:00 Tezaur folcloric14:30 Tezaur folcloric15:30 Descãlecaþi în Carpaþi16:00 Politicã ºi delicateþuri17:00 Gala umorului18:00 Lozul cel mare -

Tragerile loto18:35 La taifas cu Europa19:30 Zâmbeºte, mâine va fi

mai bine (sau la fel)20:00 T20:00 T20:00 T20:00 T20:00 Telejurnalelejurnalelejurnalelejurnalelejurnal21:10 VUL21:10 VUL21:10 VUL21:10 VUL21:10 VULTURII LEGIITURII LEGIITURII LEGIITURII LEGIITURII LEGII

(dramã, SUA, 1986)Cu: Robert Redford,Debra Winger, DarrylHannah

23:10 Garantat 100%00:00 Nebunii de pe00:00 Nebunii de pe00:00 Nebunii de pe00:00 Nebunii de pe00:00 Nebunii de pe

Madison AvenueMadison AvenueMadison AvenueMadison AvenueMadison AvenueEpisoadele 9 ºi 10din sezonul 4

01:40 Gala umorului02:30 CHARLOT02:30 CHARLOT02:30 CHARLOT02:30 CHARLOT02:30 CHARLOT

EVEVEVEVEVADAADAADAADAADATTTTT (comedie,SUA, 1917) Cu:Charles Chaplin

03:50 Descãlecaþi înCarpaþi(reluare)

04:15 Universul credinþei(reluare)

05:35 Tezaur folcloric

6 FEBRUARIE 2016SÂMBÃTÃ

DUMINICÃ 7 FEBRUARIE 2016

ACTUALITATEA 13RECOMANDÃRI TVVINERI

Page 14: Actualitatea 961

10:30 La Mãruþã10:30 La Mãruþã10:30 La Mãruþã10:30 La Mãruþã10:30 La Mãruþã(reluare)

12:00 Vorbeºte lumea14:00 Vorbeºte lumea14:00 Vorbeºte lumea14:00 Vorbeºte lumea14:00 Vorbeºte lumea14:00 Vorbeºte lumea

Cu: Sore, VicaBlochina, RãzvanFodor, Nadine

16:00 Ce spun românii17:30 La Mãruþã20:30 SCHIMB DE20:30 SCHIMB DE20:30 SCHIMB DE20:30 SCHIMB DE20:30 SCHIMB DE

PRIZONIERIPRIZONIERIPRIZONIERIPRIZONIERIPRIZONIERI(acþiune, SUA,2006) Cu:LaurenceDFishburne, PaulWalkner

22:45 T22:45 T22:45 T22:45 T22:45 Terra Novaerra Novaerra Novaerra Novaerra NovaEpisodul 8 dinsezonul 1

00:45 00:45 00:45 00:45 00:45 SCHIMB DESCHIMB DESCHIMB DESCHIMB DESCHIMB DEPRIZONIERIPRIZONIERIPRIZONIERIPRIZONIERIPRIZONIERI(acþiune, SUA,2006) Cu:LaurenceDFishburne, PaulWalkner (reluare)

04:45 Lecþii de viaþã (r)

ANTENA 1ANTENA 1ANTENA 1ANTENA 1ANTENA 108:00 Neatza cu08:00 Neatza cu08:00 Neatza cu08:00 Neatza cu08:00 Neatza cu

Rãzvan ºi DaniRãzvan ºi DaniRãzvan ºi DaniRãzvan ºi DaniRãzvan ºi Dani11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru

fiul meufiul meufiul meufiul meufiul meureality show

14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentrufiul meufiul meufiul meufiul meufiul meuCu MirelaBoureanu Vaida

16:00 Observator17:00 17:00 17:00 17:00 17:00 Acces directAcces directAcces directAcces directAcces direct20:30 Poftiþi pe la20:30 Poftiþi pe la20:30 Poftiþi pe la20:30 Poftiþi pe la20:30 Poftiþi pe la

noi: Poftiþi ºinoi: Poftiþi ºinoi: Poftiþi ºinoi: Poftiþi ºinoi: Poftiþi ºidãruiþi !dãruiþi !dãruiþi !dãruiþi !dãruiþi !

23:00 Un show23:00 Un show23:00 Un show23:00 Un show23:00 Un showpãcãtospãcãtospãcãtospãcãtospãcãtos Emisiune tabloidprezentatã de DanCapatos

01:00 Observator specialCu: OctaviaGeamãnu (reluare)

01:30 Poftiþi pe la01:30 Poftiþi pe la01:30 Poftiþi pe la01:30 Poftiþi pe la01:30 Poftiþi pe lanoi: Poftiþi ºinoi: Poftiþi ºinoi: Poftiþi ºinoi: Poftiþi ºinoi: Poftiþi ºidãruiþi! dãruiþi! dãruiþi! dãruiþi! dãruiþi! (reluare)

03:45 Acces direct(reluare)

PRIMA TVPRIMA TVPRIMA TVPRIMA TVPRIMA TV07:15 Miss fata de la þarã

(reluare)10:00 Mondenii10:00 Mondenii10:00 Mondenii10:00 Mondenii10:00 Mondenii

(reluare)15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:30 Cireaºa de pe tort15:30 Cireaºa de pe tort15:30 Cireaºa de pe tort15:30 Cireaºa de pe tort15:30 Cireaºa de pe tort

(reluare)16:30 Focus16:30 Focus16:30 Focus16:30 Focus16:30 Focus17:00 La TV17:00 La TV17:00 La TV17:00 La TV17:00 La TV

(reluare)18:00 Focus19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort

(reluare)20:10 Cronica zilei20:10 Cronica zilei20:10 Cronica zilei20:10 Cronica zilei20:10 Cronica zilei20:15 DETECTIVUL20:15 DETECTIVUL20:15 DETECTIVUL20:15 DETECTIVUL20:15 DETECTIVUL

MALONEMALONEMALONEMALONEMALONE (acþiune,SUA, 2009) Cu:Ving Rhames

22:15 T22:15 T22:15 T22:15 T22:15 Trãsniþiirãsniþiirãsniþiirãsniþiirãsniþii22:5522:5522:5522:5522:55 Cronica zilei. Cronica zilei. Cronica zilei. Cronica zilei. Cronica zilei.

Pastilã de umorPastilã de umorPastilã de umorPastilã de umorPastilã de umor23:00 Focus din inima23:00 Focus din inima23:00 Focus din inima23:00 Focus din inima23:00 Focus din inima

RomânieiRomânieiRomânieiRomânieiRomâniei23:30 Focus magazin23:30 Focus magazin23:30 Focus magazin23:30 Focus magazin23:30 Focus magazin00:15 00:15 00:15 00:15 00:15 DETECTIVULDETECTIVULDETECTIVULDETECTIVULDETECTIVUL

MALONEMALONEMALONEMALONEMALONE (acþiune,SUA, 2009) Cu:Ving Rhames (r)

PRO TVPRO TVPRO TVPRO TVPRO TV KANAL DKANAL DKANAL DKANAL DKANAL D08:0008:0008:0008:0008:00 PistruiatulPistruiatulPistruiatulPistruiatulPistruiatul10:30 10:30 10:30 10:30 10:30 IffetIffetIffetIffetIffet13:30 T13:30 T13:30 T13:30 T13:30 Te vreau lângãe vreau lângãe vreau lângãe vreau lângãe vreau lângã

mineminemineminemine16:45 Teo Show.

Emisiune dedivertisment

20:00 Bahar: Viaþã20:00 Bahar: Viaþã20:00 Bahar: Viaþã20:00 Bahar: Viaþã20:00 Bahar: Viaþãfuratãfuratãfuratãfuratãfuratã

22:30 Wow Biz01:45 Bahar: Viaþã01:45 Bahar: Viaþã01:45 Bahar: Viaþã01:45 Bahar: Viaþã01:45 Bahar: Viaþã

furatãfuratãfuratãfuratãfuratã(reluare)

03:45 Te vreau lângãmine(reluare)

06:00 Teleshopping

ACASÃ TVACASÃ TVACASÃ TVACASÃ TVACASÃ TV06:00 Vorbeºte lumea08:45 Suflet cãlãtor08:45 Suflet cãlãtor08:45 Suflet cãlãtor08:45 Suflet cãlãtor08:45 Suflet cãlãtor11:15 DANIELLE11:15 DANIELLE11:15 DANIELLE11:15 DANIELLE11:15 DANIELLE

STEELSTEELSTEELSTEELSTEEL’S -’S -’S -’S -’S -AMINTIRIAMINTIRIAMINTIRIAMINTIRIAMINTIRI

14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã15:00 Diamantul nopþii15:00 Diamantul nopþii15:00 Diamantul nopþii15:00 Diamantul nopþii15:00 Diamantul nopþii16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti

a mea!a mea!a mea!a mea!a mea!17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu

perecheperecheperecheperechepereche18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor

TVR 2TVR 2TVR 2TVR 2TVR 210:00 Guano - Munca10:00 Guano - Munca10:00 Guano - Munca10:00 Guano - Munca10:00 Guano - Munca

murdarã dinmurdarã dinmurdarã dinmurdarã dinmurdarã dinparadisulparadisulparadisulparadisulparadisulpãsãrilorpãsãrilorpãsãrilorpãsãrilorpãsãrilor

11:00 Legea lui Doyle11:00 Legea lui Doyle11:00 Legea lui Doyle11:00 Legea lui Doyle11:00 Legea lui Doyle12:00 La fix12:00 La fix12:00 La fix12:00 La fix12:00 La fix14:30 Cultura14:30 Cultura14:30 Cultura14:30 Cultura14:30 Cultura

minoritãþilorminoritãþilorminoritãþilorminoritãþilorminoritãþilor16:0016:0016:0016:0016:00 Ieri-azi-mâine Ieri-azi-mâine Ieri-azi-mâine Ieri-azi-mâine Ieri-azi-mâine17:0017:0017:0017:0017:00 Legea lui DoyleLegea lui DoyleLegea lui DoyleLegea lui DoyleLegea lui Doyle17:50 Cartea cea de toate

zilele2323232323:10 :10 :10 :10 :10 CSI: Crime ºiCSI: Crime ºiCSI: Crime ºiCSI: Crime ºiCSI: Crime ºi

investigaþiiinvestigaþiiinvestigaþiiinvestigaþiiinvestigaþiiEpisodul 15 dinsezonul 14

00:00 La fix 00:00 La fix 00:00 La fix 00:00 La fix 00:00 La fix (reluare)

07:15 O DA07:15 O DA07:15 O DA07:15 O DA07:15 O DATÃ ÎN VIAÞÃ TÃ ÎN VIAÞÃ TÃ ÎN VIAÞÃ TÃ ÎN VIAÞÃ TÃ ÎN VIAÞÃ 10:45 La bloc10:45 La bloc10:45 La bloc10:45 La bloc10:45 La bloc12:45 O PACOSTE DE COMOARÃ12:45 O PACOSTE DE COMOARÃ12:45 O PACOSTE DE COMOARÃ12:45 O PACOSTE DE COMOARÃ12:45 O PACOSTE DE COMOARÃ(comedie, SUA, 1994) 15:00 15:00 15:00 15:00 15:00 OSTOSTOSTOSTOSTAAAAATICULTICULTICULTICULTICUL(comedie, SUA, 1999) (reluare) 16:45 La 16:45 La 16:45 La 16:45 La 16:45 Labloc bloc bloc bloc bloc 18:45 CULOAREA DRAGOSTEI18:45 CULOAREA DRAGOSTEI18:45 CULOAREA DRAGOSTEI18:45 CULOAREA DRAGOSTEI18:45 CULOAREA DRAGOSTEI(dramã, SUA, 2000) 20:30 20:30 20:30 20:30 20:30 HAI SÃ NEHAI SÃ NEHAI SÃ NEHAI SÃ NEHAI SÃ NECÃSÃCÃSÃCÃSÃCÃSÃCÃSÃTORIM! (I) TORIM! (I) TORIM! (I) TORIM! (I) TORIM! (I) (comedie romanticã, SUA,2010) 22:15 SUSPECTUL 22:15 SUSPECTUL 22:15 SUSPECTUL 22:15 SUSPECTUL 22:15 SUSPECTUL (thriller, SUA,2002) Cu: James Caan (r) 02:00 Cine A.M.

PRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMA09:00 MISS MARPLE: CRIMÃ LA09:00 MISS MARPLE: CRIMÃ LA09:00 MISS MARPLE: CRIMÃ LA09:00 MISS MARPLE: CRIMÃ LA09:00 MISS MARPLE: CRIMÃ LAVICARIAVICARIAVICARIAVICARIAVICARIATTTTT 11:00 Medici începãtori 11:00 Medici începãtori 11:00 Medici începãtori 11:00 Medici începãtori 11:00 Medici începãtori12:00 12:00 12:00 12:00 12:00 CRIMELE DIN MIDSOMER: MUR-CRIMELE DIN MIDSOMER: MUR-CRIMELE DIN MIDSOMER: MUR-CRIMELE DIN MIDSOMER: MUR-CRIMELE DIN MIDSOMER: MUR-DER BY MAGIC 14:00 DER BY MAGIC 14:00 DER BY MAGIC 14:00 DER BY MAGIC 14:00 DER BY MAGIC 14:00 Neveste Neveste Neveste Neveste Nevestedisperatedisperatedisperatedisperatedisperate 17:00 MISS MARPLE: VER- 17:00 MISS MARPLE: VER- 17:00 MISS MARPLE: VER- 17:00 MISS MARPLE: VER- 17:00 MISS MARPLE: VER-DICT - CRIMÃDICT - CRIMÃDICT - CRIMÃDICT - CRIMÃDICT - CRIMÃ 19:00 Hawaii 5.0 20:00 19:00 Hawaii 5.0 20:00 19:00 Hawaii 5.0 20:00 19:00 Hawaii 5.0 20:00 19:00 Hawaii 5.0 20:00În mintea criminalului 21:00În mintea criminalului 21:00În mintea criminalului 21:00În mintea criminalului 21:00În mintea criminalului 21:00 FUGARÃ FUGARÃ FUGARÃ FUGARÃ FUGARÃLA 17 ANILA 17 ANILA 17 ANILA 17 ANILA 17 ANI 23:00 Anatomia lui Grey 23:00 Anatomia lui Grey 23:00 Anatomia lui Grey 23:00 Anatomia lui Grey 23:00 Anatomia lui Grey01:00 În mintea criminalului (serial)01:00 În mintea criminalului (serial)01:00 În mintea criminalului (serial)01:00 În mintea criminalului (serial)01:00 În mintea criminalului (serial)

DIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSAL

HBOHBOHBOHBOHBO06:00 CIRCUL06:00 CIRCUL06:00 CIRCUL06:00 CIRCUL06:00 CIRCUL07:40 DACÃ Aª07:40 DACÃ Aª07:40 DACÃ Aª07:40 DACÃ Aª07:40 DACÃ Aª

RÃMÂNERÃMÂNERÃMÂNERÃMÂNERÃMÂNE09:25 A FOST ODA09:25 A FOST ODA09:25 A FOST ODA09:25 A FOST ODA09:25 A FOST ODATÃTÃTÃTÃTÃ

CA NICIODACA NICIODACA NICIODACA NICIODACA NICIODATÃTÃTÃTÃTÃ11:00 AªA SE SCRIE11:00 AªA SE SCRIE11:00 AªA SE SCRIE11:00 AªA SE SCRIE11:00 AªA SE SCRIE

ISTORIA!ISTORIA!ISTORIA!ISTORIA!ISTORIA!12:40 GODZILLA12:40 GODZILLA12:40 GODZILLA12:40 GODZILLA12:40 GODZILLA14:45 FERMA14:45 FERMA14:45 FERMA14:45 FERMA14:45 FERMA

LEBEDELORLEBEDELORLEBEDELORLEBEDELORLEBEDELOR16:25 PAUL, MARE16:25 PAUL, MARE16:25 PAUL, MARE16:25 PAUL, MARE16:25 PAUL, MARE

POLIÞIST LAPOLIÞIST LAPOLIÞIST LAPOLIÞIST LAPOLIÞIST LAMALL 2MALL 2MALL 2MALL 2MALL 2

18:30 JOSEPHINE18:30 JOSEPHINE18:30 JOSEPHINE18:30 JOSEPHINE18:30 JOSEPHINE20:00 Umbre20:00 Umbre20:00 Umbre20:00 Umbre20:00 Umbre21:30 Sub acelaºi21:30 Sub acelaºi21:30 Sub acelaºi21:30 Sub acelaºi21:30 Sub acelaºi

acoperiºacoperiºacoperiºacoperiºacoperiº22:00 BINE AÞI VENIT22:00 BINE AÞI VENIT22:00 BINE AÞI VENIT22:00 BINE AÞI VENIT22:00 BINE AÞI VENIT

LA NEW YORK!LA NEW YORK!LA NEW YORK!LA NEW YORK!LA NEW YORK!(dramã, coprod.,2014) Cu: G.Depardieu

00:05 WALESA00:05 WALESA00:05 WALESA00:05 WALESA00:05 WALESA (biografic, Polonia,2013)

02:10 LONE ST02:10 LONE ST02:10 LONE ST02:10 LONE ST02:10 LONE STARARARARAR(dramã, SUA, 1996)Cu: Chris Cooper

05:20 PINEAPPLE05:20 PINEAPPLE05:20 PINEAPPLE05:20 PINEAPPLE05:20 PINEAPPLEEXPRESS: OEXPRESS: OEXPRESS: OEXPRESS: OEXPRESS: OAFACEREAFACEREAFACEREAFACEREAFACERERISCANTÃRISCANTÃRISCANTÃRISCANTÃRISCANTÃ

07:10 SURPRIZÃ: VINE07:10 SURPRIZÃ: VINE07:10 SURPRIZÃ: VINE07:10 SURPRIZÃ: VINE07:10 SURPRIZÃ: VINEPOLLPOLLPOLLPOLLPOLLY!Y!Y!Y!Y!

09:00 RACHEL SE09:00 RACHEL SE09:00 RACHEL SE09:00 RACHEL SE09:00 RACHEL SEMÃRITÃMÃRITÃMÃRITÃMÃRITÃMÃRITÃ

11:00 FAMILIA DIN11:00 FAMILIA DIN11:00 FAMILIA DIN11:00 FAMILIA DIN11:00 FAMILIA DINMANSFIELDMANSFIELDMANSFIELDMANSFIELDMANSFIELDPARKPARKPARKPARKPARK

13:00 LEGILE MIªCÃRII13:00 LEGILE MIªCÃRII13:00 LEGILE MIªCÃRII13:00 LEGILE MIªCÃRII13:00 LEGILE MIªCÃRII17:50 8 MILE17:50 8 MILE17:50 8 MILE17:50 8 MILE17:50 8 MILE

TV 1000TV 1000TV 1000TV 1000TV 1000

07:15 COMISARUL07:15 COMISARUL07:15 COMISARUL07:15 COMISARUL07:15 COMISARULINDRAJEETINDRAJEETINDRAJEETINDRAJEETINDRAJEET

11:00 T11:00 T11:00 T11:00 T11:00 Tradiþii de laradiþii de laradiþii de laradiþii de laradiþii de labunica bunica bunica bunica bunica (r)

12:30 Vouã12:30 Vouã12:30 Vouã12:30 Vouã12:30 Vouã13:30 Dragoste dulce13:30 Dragoste dulce13:30 Dragoste dulce13:30 Dragoste dulce13:30 Dragoste dulce

amarãamarãamarãamarãamarã14:45 Suflete trãdate 14:45 Suflete trãdate 14:45 Suflete trãdate 14:45 Suflete trãdate 14:45 Suflete trãdate (r)17:15 Înfruntarea17:15 Înfruntarea17:15 Înfruntarea17:15 Înfruntarea17:15 Înfruntarea

dinastiilordinastiilordinastiilordinastiilordinastiilor20:15 Destine împlinite20:15 Destine împlinite20:15 Destine împlinite20:15 Destine împlinite20:15 Destine împlinite21:15 21:15 21:15 21:15 21:15 RINGO SERINGO SERINGO SERINGO SERINGO SE

ÎNTOARCEÎNTOARCEÎNTOARCEÎNTOARCEÎNTOARCE

NAÞIONALNAÞIONALNAÞIONALNAÞIONALNAÞIONALTVR 1TVR 1TVR 1TVR 1TVR 1

09:00 Starea naþiei09:00 Starea naþiei09:00 Starea naþiei09:00 Starea naþiei09:00 Starea naþiei10:00 Rezistenþa prin

culturã - procesulceasului de apoi

11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi11:00 Cãlãtori în lumiparaleleparaleleparaleleparaleleparalele

12:30 Comorile Toscanei13:00 Fãrã etichetã13:00 Fãrã etichetã13:00 Fãrã etichetã13:00 Fãrã etichetã13:00 Fãrã etichetã15:30 Convieþuiri15:30 Convieþuiri15:30 Convieþuiri15:30 Convieþuiri15:30 Convieþuiri16:55 Vorbeºte corect17:00 Profesioniºtii...cu

Eugenia Vodã18:00 Superconsuma-

torul19:00 Exclusiv în România19:45 Sport19:55 Starea zilei21:00 Prim - plan22:25 Starea zilei22:30 Starea naþiei.

Cu Dragoº Pãtraru23:25 Maºini, teste ºi

verdicte00:00 ÎNTR-O SEARÃ00:00 ÎNTR-O SEARÃ00:00 ÎNTR-O SEARÃ00:00 ÎNTR-O SEARÃ00:00 ÎNTR-O SEARÃ

DE OCTOMBRIEDE OCTOMBRIEDE OCTOMBRIEDE OCTOMBRIEDE OCTOMBRIE(I) (I) (I) (I) (I) (dramã, Italia,‘09)

01:40 Exclusiv în România(reluare)

10:30 La Mãruþã10:30 La Mãruþã10:30 La Mãruþã10:30 La Mãruþã10:30 La Mãruþã (r)12:00 Vorbeºte lumea12:00 Vorbeºte lumea12:00 Vorbeºte lumea12:00 Vorbeºte lumea12:00 Vorbeºte lumea

(reluare)14:00 14:00 14:00 14:00 14:00 Vorbeºte lumeaVorbeºte lumeaVorbeºte lumeaVorbeºte lumeaVorbeºte lumea15:00 Lecþii de viaþã17:00 ªtirile PRO TV17:30 La Mãruþã.....

Emisiune tabloid19:00 ªtirile PRO TV

Cu Andreea Esca20:30 NU TE PUNE CU20:30 NU TE PUNE CU20:30 NU TE PUNE CU20:30 NU TE PUNE CU20:30 NU TE PUNE CU

ZOHANZOHANZOHANZOHANZOHAN (comedie,SUA, 2008) Cu:Adam Sandler,John Turturro,EmmanuelleChriqui

22:30 ªtirile PRO TV23:00 T23:00 T23:00 T23:00 T23:00 Terra Novaerra Novaerra Novaerra Novaerra Nova23:30 Lege ºi dreptate23:30 Lege ºi dreptate23:30 Lege ºi dreptate23:30 Lege ºi dreptate23:30 Lege ºi dreptate01:0001:0001:0001:0001:00 NU TE PUNE CU NU TE PUNE CU NU TE PUNE CU NU TE PUNE CU NU TE PUNE CU

ZOHANZOHANZOHANZOHANZOHAN (comedie,SUA, 2008) Cu:Adam Sandler,John Turturro,EmmanuelleChriqui (reluare)

ANTENA 1ANTENA 1ANTENA 1ANTENA 1ANTENA 108:00 Neatza cu08:00 Neatza cu08:00 Neatza cu08:00 Neatza cu08:00 Neatza cu

Rãzvan ºi DaniRãzvan ºi DaniRãzvan ºi DaniRãzvan ºi DaniRãzvan ºi Dani11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru

fiul meufiul meufiul meufiul meufiul meuReality show

14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentrufiul meufiul meufiul meufiul meufiul meuCu MirelaBoureanu Vaida

17:00 17:00 17:00 17:00 17:00 Acces directAcces directAcces directAcces directAcces direct20:00 Observator special

Cu: OctaviaGeamãnu

20:30 T20:30 T20:30 T20:30 T20:30 Te pui cue pui cue pui cue pui cue pui cublondele?blondele?blondele?blondele?blondele?Emisiune concurs

23:00 Un show pãcãtosEmisiune tabloidprezentatã de DanCapatos. Invitaþipermanenþi: CãtãlinBordea, DJ SilviuAndreI

01:00 Observator01:00 Observator01:00 Observator01:00 Observator01:00 Observator(reluare)

02:00 Închidereaprogramului,revizie tehnicã

PRIMA TVPRIMA TVPRIMA TVPRIMA TVPRIMA TV10:00 Focus din inima10:00 Focus din inima10:00 Focus din inima10:00 Focus din inima10:00 Focus din inima

RomânieiRomânieiRomânieiRomânieiRomâniei11:3011:3011:3011:3011:30 Focus magazinFocus magazinFocus magazinFocus magazinFocus magazin13:50 Cronica zilei13:55 Nimeni nu-i13:55 Nimeni nu-i13:55 Nimeni nu-i13:55 Nimeni nu-i13:55 Nimeni nu-i

perfectperfectperfectperfectperfect15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:30 Cireaºa de pe tort

(reluare)17:00 Trãsniþii

(reluare)19:15 Cireaºa de pe tort

(reluare)20:15 Mondenii20:15 Mondenii20:15 Mondenii20:15 Mondenii20:15 Mondenii22:15 Trãsniþii

Episodul 26 dinsezonul 25

23:0023:0023:0023:0023:00 Focus din inima Focus din inima Focus din inima Focus din inima Focus din inimaRomânieiRomânieiRomânieiRomânieiRomâniei

23:30 Focus magazin23:30 Focus magazin23:30 Focus magazin23:30 Focus magazin23:30 Focus magazin(reluare)

00:15 ÎNVÃLUIÞI DE00:15 ÎNVÃLUIÞI DE00:15 ÎNVÃLUIÞI DE00:15 ÎNVÃLUIÞI DE00:15 ÎNVÃLUIÞI DEIUBIRE (II)IUBIRE (II)IUBIRE (II)IUBIRE (II)IUBIRE (II)(dragoste, SUA,2011) Cu: NatalieHall, JoBethWilliams, G.Vaughan

PRO TVPRO TVPRO TVPRO TVPRO TV KANAL DKANAL DKANAL DKANAL DKANAL D08:00 T08:00 T08:00 T08:00 T08:00 Teo Showeo Showeo Showeo Showeo Show10:3010:3010:3010:3010:30 IffetIffetIffetIffetIffet13:30 T13:30 T13:30 T13:30 T13:30 Te vreaue vreaue vreaue vreaue vreau

lângã minelângã minelângã minelângã minelângã mineEmisiunematrimonialã

16:45 16:45 16:45 16:45 16:45 TTTTTeo Showeo Showeo Showeo Showeo Show20:00 Bahar: Viaþã20:00 Bahar: Viaþã20:00 Bahar: Viaþã20:00 Bahar: Viaþã20:00 Bahar: Viaþã

furatãfuratãfuratãfuratãfuratã22:30 Wow Biz Emisiune

tabloid prezentatãde MãdãlinaIonescu ºi AdelinaPestriþu

01:45 Bahar: Viaþã01:45 Bahar: Viaþã01:45 Bahar: Viaþã01:45 Bahar: Viaþã01:45 Bahar: Viaþãfuratãfuratãfuratãfuratãfuratã(reluare)

ACASÃ TVACASÃ TVACASÃ TVACASÃ TVACASÃ TV06:00 Vorbeºte lumea08:45 Avenida Brasil08:45 Avenida Brasil08:45 Avenida Brasil08:45 Avenida Brasil08:45 Avenida Brasil11:15 Lupta rozelor11:15 Lupta rozelor11:15 Lupta rozelor11:15 Lupta rozelor11:15 Lupta rozelor14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti

a mea!a mea!a mea!a mea!a mea!17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu

perecheperecheperecheperechepereche18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor

(reluare)03:15 Doamne de poveste04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan (r)

TVR 2TVR 2TVR 2TVR 2TVR 208:10 Arta fericirii08:10 Arta fericirii08:10 Arta fericirii08:10 Arta fericirii08:10 Arta fericirii11:00 Legea lui Doyle11:00 Legea lui Doyle11:00 Legea lui Doyle11:00 Legea lui Doyle11:00 Legea lui Doyle12:00 La fix12:00 La fix12:00 La fix12:00 La fix12:00 La fix13:00 5 minute de13:00 5 minute de13:00 5 minute de13:00 5 minute de13:00 5 minute de

istorieistorieistorieistorieistorie13:20 Arta fericirii13:20 Arta fericirii13:20 Arta fericirii13:20 Arta fericirii13:20 Arta fericirii14:30 Cultura minoritãþilor17:00 Legea lui Doyle17:00 Legea lui Doyle17:00 Legea lui Doyle17:00 Legea lui Doyle17:00 Legea lui Doyle19:00 Iordania -19:00 Iordania -19:00 Iordania -19:00 Iordania -19:00 Iordania -

Dinastia cailorDinastia cailorDinastia cailorDinastia cailorDinastia cailor20:10 CASA DE SUB20:10 CASA DE SUB20:10 CASA DE SUB20:10 CASA DE SUB20:10 CASA DE SUB

ARBORIARBORIARBORIARBORIARBORI23:1023:1023:1023:1023:10 CSI: Crime ºi CSI: Crime ºi CSI: Crime ºi CSI: Crime ºi CSI: Crime ºi

investigaþiiinvestigaþiiinvestigaþiiinvestigaþiiinvestigaþii00:00 La fix00:00 La fix00:00 La fix00:00 La fix00:00 La fix

(reluare)02:20 Arta fericirii (reluare)

07:1507:1507:1507:1507:15 CA-N VREMURILE BUNE CA-N VREMURILE BUNE CA-N VREMURILE BUNE CA-N VREMURILE BUNE CA-N VREMURILE BUNE (reluare)12:45 CULOAREA DRAGOSTEI 12:45 CULOAREA DRAGOSTEI 12:45 CULOAREA DRAGOSTEI 12:45 CULOAREA DRAGOSTEI 12:45 CULOAREA DRAGOSTEI (reluare)14:30 O PACOSTE DE COMOARÃ14:30 O PACOSTE DE COMOARÃ14:30 O PACOSTE DE COMOARÃ14:30 O PACOSTE DE COMOARÃ14:30 O PACOSTE DE COMOARÃ(comedie, SUA, 1994) (reluare) 18:45 STÃ 18:45 STÃ 18:45 STÃ 18:45 STÃ 18:45 STÃSÃ PLOUÃ CU CHIFTELESÃ PLOUÃ CU CHIFTELESÃ PLOUÃ CU CHIFTELESÃ PLOUÃ CU CHIFTELESÃ PLOUÃ CU CHIFTELE (animaþie, SUA,2009) (reluare) 20:30 REÞEAUA20:30 REÞEAUA20:30 REÞEAUA20:30 REÞEAUA20:30 REÞEAUA (thriller,SUA, 1995) 22:45 22:45 22:45 22:45 22:45 BANI ÎNSÂNGERAÞIBANI ÎNSÂNGERAÞIBANI ÎNSÂNGERAÞIBANI ÎNSÂNGERAÞIBANI ÎNSÂNGERAÞI(thriller, SUA, 2008) 00:45 00:45 00:45 00:45 00:45 REÞEAUAREÞEAUAREÞEAUAREÞEAUAREÞEAUA(thriller, SUA, 1995) (reluare) 02:45 Cine A.M.

PRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMA12:00 CRIMELE DIN MIDSOMER: A12:00 CRIMELE DIN MIDSOMER: A12:00 CRIMELE DIN MIDSOMER: A12:00 CRIMELE DIN MIDSOMER: A12:00 CRIMELE DIN MIDSOMER: AVINTVINTVINTVINTVINTAGE MURDERAGE MURDERAGE MURDERAGE MURDERAGE MURDER 14:0014:0014:0014:0014:00 Neveste Neveste Neveste Neveste Nevestedisperatedisperatedisperatedisperatedisperate 16:00 Chipul rãzbunãrii16:00 Chipul rãzbunãrii16:00 Chipul rãzbunãrii16:00 Chipul rãzbunãrii16:00 Chipul rãzbunãrii17:00 17:00 17:00 17:00 17:00 MISS MARPLE: AMINTIRIMISS MARPLE: AMINTIRIMISS MARPLE: AMINTIRIMISS MARPLE: AMINTIRIMISS MARPLE: AMINTIRITREZITETREZITETREZITETREZITETREZITE 19:00 Hwaii 5.0 19:00 Hwaii 5.0 19:00 Hwaii 5.0 19:00 Hwaii 5.0 19:00 Hwaii 5.0 20:00 20:00 20:00 20:00 20:00 ÎnÎnÎnÎnÎnmintea cr iminaluluimintea cr iminaluluimintea cr iminaluluimintea cr iminaluluimintea cr iminalului 23:00 23:00 23:00 23:00 23:00 TREITREITREITREITREIBÃRBAÞI ªI O MICÃ DOMNIªOARÃBÃRBAÞI ªI O MICÃ DOMNIªOARÃBÃRBAÞI ªI O MICÃ DOMNIªOARÃBÃRBAÞI ªI O MICÃ DOMNIªOARÃBÃRBAÞI ªI O MICÃ DOMNIªOARÃ01:10 01:10 01:10 01:10 01:10 În mintea criminaluluiÎn mintea criminaluluiÎn mintea criminaluluiÎn mintea criminaluluiÎn mintea criminalului 02:00 02:00 02:00 02:00 02:00Chipul rãzbunãriiChipul rãzbunãriiChipul rãzbunãriiChipul rãzbunãriiChipul rãzbunãrii (reluare) (serial)

DIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSAL

HBOHBOHBOHBOHBO06:00 ACASÃ LA T06:00 ACASÃ LA T06:00 ACASÃ LA T06:00 ACASÃ LA T06:00 ACASÃ LA TAAAAATTTTTAAAAA07:35 DRUMUL07:35 DRUMUL07:35 DRUMUL07:35 DRUMUL07:35 DRUMUL

RUªINIIRUªINIIRUªINIIRUªINIIRUªINII09:10 NU VOM AVEA09:10 NU VOM AVEA09:10 NU VOM AVEA09:10 NU VOM AVEA09:10 NU VOM AVEA

NICIODANICIODANICIODANICIODANICIODATÃTÃTÃTÃTÃPARISULPARISULPARISULPARISULPARISUL

10:40 COªARII10:40 COªARII10:40 COªARII10:40 COªARII10:40 COªARII12:25 FAST FOOD12:25 FAST FOOD12:25 FAST FOOD12:25 FAST FOOD12:25 FAST FOOD14:00 CE-AR FI DACÃ?14:00 CE-AR FI DACÃ?14:00 CE-AR FI DACÃ?14:00 CE-AR FI DACÃ?14:00 CE-AR FI DACÃ?15:40 LIGA DREPTÃÞII15:40 LIGA DREPTÃÞII15:40 LIGA DREPTÃÞII15:40 LIGA DREPTÃÞII15:40 LIGA DREPTÃÞII

VERSUS LIGAVERSUS LIGAVERSUS LIGAVERSUS LIGAVERSUS LIGABIZARROBIZARROBIZARROBIZARROBIZARRO

16:30 VERONICA16:30 VERONICA16:30 VERONICA16:30 VERONICA16:30 VERONICAMARSMARSMARSMARSMARS

18:20 BHOPAL: O18:20 BHOPAL: O18:20 BHOPAL: O18:20 BHOPAL: O18:20 BHOPAL: ORUGÃCIUNERUGÃCIUNERUGÃCIUNERUGÃCIUNERUGÃCIUNEPENTRU PLOAIEPENTRU PLOAIEPENTRU PLOAIEPENTRU PLOAIEPENTRU PLOAIE

20:00 SUPRAVIEÞU-20:00 SUPRAVIEÞU-20:00 SUPRAVIEÞU-20:00 SUPRAVIEÞU-20:00 SUPRAVIEÞU-ITORULITORULITORULITORULITORUL

22:00 INTERVIUL22:00 INTERVIUL22:00 INTERVIUL22:00 INTERVIUL22:00 INTERVIUL23:50 PRÃDÃ23:50 PRÃDÃ23:50 PRÃDÃ23:50 PRÃDÃ23:50 PRÃDÃTOR DETOR DETOR DETOR DETOR DE

NOAPTE NOAPTE NOAPTE NOAPTE NOAPTE (thriller,SUA, 2014)

01:45 COLECÞIA DE01:45 COLECÞIA DE01:45 COLECÞIA DE01:45 COLECÞIA DE01:45 COLECÞIA DEAROMEAROMEAROMEAROMEAROME(scurtmetraj,Republica Moldova,2013)

05:00 COLUMBUS05:00 COLUMBUS05:00 COLUMBUS05:00 COLUMBUS05:00 COLUMBUSCIRCLECIRCLECIRCLECIRCLECIRCLE

07:00 NOPÞI07:00 NOPÞI07:00 NOPÞI07:00 NOPÞI07:00 NOPÞIHOLLHOLLHOLLHOLLHOLLYWOODIENEYWOODIENEYWOODIENEYWOODIENEYWOODIENE

09:10 ENGLEZUL CARE09:10 ENGLEZUL CARE09:10 ENGLEZUL CARE09:10 ENGLEZUL CARE09:10 ENGLEZUL CAREA URCAA URCAA URCAA URCAA URCAT OT OT OT OT OCOLINÃ DAR ACOLINÃ DAR ACOLINÃ DAR ACOLINÃ DAR ACOLINÃ DAR ACOBORÂCOBORÂCOBORÂCOBORÂCOBORÂT UNT UNT UNT UNT UNMUNTEMUNTEMUNTEMUNTEMUNTE

17:50 DOAMNA BROWN17:50 DOAMNA BROWN17:50 DOAMNA BROWN17:50 DOAMNA BROWN17:50 DOAMNA BROWN19:40 CAPOTE19:40 CAPOTE19:40 CAPOTE19:40 CAPOTE19:40 CAPOTE21:30 O IUBIRE FÃRÃ21:30 O IUBIRE FÃRÃ21:30 O IUBIRE FÃRÃ21:30 O IUBIRE FÃRÃ21:30 O IUBIRE FÃRÃ

SFÂRªITSFÂRªITSFÂRªITSFÂRªITSFÂRªIT

TV 1000TV 1000TV 1000TV 1000TV 1000

09:15 Baronii09:15 Baronii09:15 Baronii09:15 Baronii09:15 Baronii11:00 Înfruntarea11:00 Înfruntarea11:00 Înfruntarea11:00 Înfruntarea11:00 Înfruntarea

dinastiilordinastiilordinastiilordinastiilordinastiilor12:15 Baronii12:15 Baronii12:15 Baronii12:15 Baronii12:15 Baronii13:30 Dragoste dulce-13:30 Dragoste dulce-13:30 Dragoste dulce-13:30 Dragoste dulce-13:30 Dragoste dulce-

amarãamarãamarãamarãamarã14:45 Mica mireasã 14:45 Mica mireasã 14:45 Mica mireasã 14:45 Mica mireasã 14:45 Mica mireasã (r)16:15 Destine împlinite16:15 Destine împlinite16:15 Destine împlinite16:15 Destine împlinite16:15 Destine împlinite19:1519:1519:1519:1519:15 Mica mireasãMica mireasãMica mireasãMica mireasãMica mireasã20:15 SW20:15 SW20:15 SW20:15 SW20:15 SWAAAAATTTTT: T: T: T: T: TACTICALACTICALACTICALACTICALACTICAL

FORCEFORCEFORCEFORCEFORCE22:15 INSULA22:15 INSULA22:15 INSULA22:15 INSULA22:15 INSULA

DINOZAURILORDINOZAURILORDINOZAURILORDINOZAURILORDINOZAURILOR

NAÞIONALNAÞIONALNAÞIONALNAÞIONALNAÞIONALTVR 1TVR 1TVR 1TVR 1TVR 1

09:00 Starea naþiei09:00 Starea naþiei09:00 Starea naþiei09:00 Starea naþiei09:00 Starea naþiei(reluare)

11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi11:00 Cãlãtori în lumiparaleleparaleleparaleleparaleleparalele

13:00 De joi pânã joi13:00 De joi pânã joi13:00 De joi pânã joi13:00 De joi pânã joi13:00 De joi pânã joi15:30 Akzente

Prezintã LauraMoise

16:55 Vorbeºte corect18:00 Lozul cel mare18:30 Magazin FIFA18:30 Magazin FIFA18:30 Magazin FIFA18:30 Magazin FIFA18:30 Magazin FIFA19:00 Exclusiv în19:00 Exclusiv în19:00 Exclusiv în19:00 Exclusiv în19:00 Exclusiv în

RomâniaRomâniaRomâniaRomâniaRomânia19:45 Sport21:00 Prim - plan22:25 Starea zilei22:30 Starea naþiei.

Cu Dragoº Pãtraru23:25 Anchetele

comisaruluiAntonescu

00:00 ÎNTR-O SEARÃ00:00 ÎNTR-O SEARÃ00:00 ÎNTR-O SEARÃ00:00 ÎNTR-O SEARÃ00:00 ÎNTR-O SEARÃDE OCTOMBRIEDE OCTOMBRIEDE OCTOMBRIEDE OCTOMBRIEDE OCTOMBRIE(II) (II) (II) (II) (II) (dramã, Italia,2009) Cu: VanessaHessler, G. Greco

01:40 Exclusiv în România(reluare)

10:30 La Mãruþã(reluare)

12:00 Vorbeºte lumea12:00 Vorbeºte lumea12:00 Vorbeºte lumea12:00 Vorbeºte lumea12:00 Vorbeºte lumea14:00 Vorbeºte lumea15:00 Lecþii de viaþã17:00 ªtirile PRO TV17:30 La Mãruþã

Emisiune tabloid cuCãtãlin Mãruþã

20:3020:3020:3020:3020:30 SABOTSABOTSABOTSABOTSABOTAJAJAJAJAJ(acþiune, SUA,2014) Cu: ArnoldSchwarzenegger,Sam Worthington,Joe Mananiello

23:00 T23:00 T23:00 T23:00 T23:00 Terra Novaerra Novaerra Novaerra Novaerra Nova00:00 Lege ºi dreptate00:00 Lege ºi dreptate00:00 Lege ºi dreptate00:00 Lege ºi dreptate00:00 Lege ºi dreptate01:30 01:30 01:30 01:30 01:30 SABOTSABOTSABOTSABOTSABOTAJAJAJAJAJ

(acþiune, SUA,2014) Cu: ArnoldSchwarzenegger,Sam Worthington,Joe Mananiello(reluare)

03:15 Vorbeºte lumea(reluare)

04:45 Lecþii de viaþã(reluare)

ANTENA 1ANTENA 1ANTENA 1ANTENA 1ANTENA 108:00 Neatza cu08:00 Neatza cu08:00 Neatza cu08:00 Neatza cu08:00 Neatza cu

Rãzvan ºi DaniRãzvan ºi DaniRãzvan ºi DaniRãzvan ºi DaniRãzvan ºi Dani11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru

fiul meufiul meufiul meufiul meufiul meuCu MirelaBoureanu Vaida

14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentrufiul meufiul meufiul meufiul meufiul meuCu MirelaBoureanu Vaida

17:00 17:00 17:00 17:00 17:00 Acces direct.Acces direct.Acces direct.Acces direct.Acces direct.Emisiune tabloidprezentatã deSimona Gherghe

20:00 Observator specialCu: OctaviaGeamãnu

20:30 Next StarSezon nou

23:00 Un show pãcãtosEmisiune tabloid deDan Capatos

01:00 Observator(reluare)

02:00 VENIN02:00 VENIN02:00 VENIN02:00 VENIN02:00 VENINDISTRUGÃDISTRUGÃDISTRUGÃDISTRUGÃDISTRUGÃTORTORTORTORTOR(thriller, SUA,2009) Cu: L. Perry

PRIMA TVPRIMA TVPRIMA TVPRIMA TVPRIMA TV10:00 Focus din inima10:00 Focus din inima10:00 Focus din inima10:00 Focus din inima10:00 Focus din inima

RomânieiRomânieiRomânieiRomânieiRomâniei10:15 Casa: construcþie10:15 Casa: construcþie10:15 Casa: construcþie10:15 Casa: construcþie10:15 Casa: construcþie

ºi designºi designºi designºi designºi design11:30 Focus magazin11:30 Focus magazin11:30 Focus magazin11:30 Focus magazin11:30 Focus magazin13:50 Cronica zilei15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:30 Cireaºa de pe tort15:30 Cireaºa de pe tort15:30 Cireaºa de pe tort15:30 Cireaºa de pe tort15:30 Cireaºa de pe tort

(reluare)19:30 Cireaºa de pe tort19:30 Cireaºa de pe tort19:30 Cireaºa de pe tort19:30 Cireaºa de pe tort19:30 Cireaºa de pe tort20:10 Cronica zilei20:15 M-a fãcut mama20:15 M-a fãcut mama20:15 M-a fãcut mama20:15 M-a fãcut mama20:15 M-a fãcut mama

artistartistartistartistartist Cu AndreeaRaicu ºi DanFinþescu

22:15 T22:15 T22:15 T22:15 T22:15 TrãsniþiirãsniþiirãsniþiirãsniþiirãsniþiiEpisodul 27 dinsezonul 25

23:0023:0023:0023:0023:00 Focus din inima Focus din inima Focus din inima Focus din inima Focus din inimaRomânieiRomânieiRomânieiRomânieiRomâniei

23:30 23:30 23:30 23:30 23:30 Focus magazinFocus magazinFocus magazinFocus magazinFocus magazinCu: Diana Bart ºiAlexandruConstantin

00:00:00:00:00:15 M-a fãcut mama15 M-a fãcut mama15 M-a fãcut mama15 M-a fãcut mama15 M-a fãcut mamaartistartistartistartistartist Cu AndreeaRaicu ºi DanFinþescu (reluare)

PRO TVPRO TVPRO TVPRO TVPRO TV KANAL DKANAL DKANAL DKANAL DKANAL D08:0008:0008:0008:0008:00 TTTTTeo Showeo Showeo Showeo Showeo Show10:30 Iffet10:30 Iffet10:30 Iffet10:30 Iffet10:30 Iffet13:30 T13:30 T13:30 T13:30 T13:30 Te vreaue vreaue vreaue vreaue vreau

lângã minelângã minelângã minelângã minelângã mine16:45 16:45 16:45 16:45 16:45 TTTTTeo Showeo Showeo Showeo Showeo Show20:00 Bahar: Viaþã20:00 Bahar: Viaþã20:00 Bahar: Viaþã20:00 Bahar: Viaþã20:00 Bahar: Viaþã

furatãfuratãfuratãfuratãfuratã22:30 Wow Biz

Emisiune tabloidprezentatã deMãdãlina Ionescu ºiAdelina Pestriþu

01:45 Bahar: Viaþã01:45 Bahar: Viaþã01:45 Bahar: Viaþã01:45 Bahar: Viaþã01:45 Bahar: Viaþãfuratãfuratãfuratãfuratãfuratã(reluare)

03:45 T03:45 T03:45 T03:45 T03:45 Te vreau lângãe vreau lângãe vreau lângãe vreau lângãe vreau lângãmineminemineminemine (reluare)

ACASÃ TVACASÃ TVACASÃ TVACASÃ TVACASÃ TV06:00 Vorbeºte lumea08:45 Avenida Brasil08:45 Avenida Brasil08:45 Avenida Brasil08:45 Avenida Brasil08:45 Avenida Brasil11:15 Lupta rozelor11:15 Lupta rozelor11:15 Lupta rozelor11:15 Lupta rozelor11:15 Lupta rozelor14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti

a mea!a mea!a mea!a mea!a mea!17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu

perecheperecheperecheperechepereche18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor

(reluare)03:15 Doamne de poveste04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan (r)

TVR 2TVR 2TVR 2TVR 2TVR 212:00 La fix 12:00 La fix 12:00 La fix 12:00 La fix 12:00 La fix (r)13:20 Arta fericirii13:20 Arta fericirii13:20 Arta fericirii13:20 Arta fericirii13:20 Arta fericirii14:30 Cultura minoritãþilor16:0016:0016:0016:0016:00 Ieri-azi-mâine Ieri-azi-mâine Ieri-azi-mâine Ieri-azi-mâine Ieri-azi-mâine17:00 Legea lui Doyle17:00 Legea lui Doyle17:00 Legea lui Doyle17:00 Legea lui Doyle17:00 Legea lui Doyle20:10 PARIURI ªI20:10 PARIURI ªI20:10 PARIURI ªI20:10 PARIURI ªI20:10 PARIURI ªI

ROCHII DEROCHII DEROCHII DEROCHII DEROCHII DEMIREASÃMIREASÃMIREASÃMIREASÃMIREASÃ (dramã,Italia, 2009) Cu:Sergio Castellitto,Martina Gedeck,Paolo Briguglia

23:10 CSI: Crime ºi23:10 CSI: Crime ºi23:10 CSI: Crime ºi23:10 CSI: Crime ºi23:10 CSI: Crime ºiinvestigaþiiinvestigaþiiinvestigaþiiinvestigaþiiinvestigaþii

00:00 La fix00:00 La fix00:00 La fix00:00 La fix00:00 La fix(reluare)

02:20 Arta fericirii (r)

09:15 CA-N VREMURILE BUNE 09:15 CA-N VREMURILE BUNE 09:15 CA-N VREMURILE BUNE 09:15 CA-N VREMURILE BUNE 09:15 CA-N VREMURILE BUNE 13:1513:1513:1513:1513:15ULULULULULTIMA CÃLÃTIMA CÃLÃTIMA CÃLÃTIMA CÃLÃTIMA CÃLÃTORIETORIETORIETORIETORIE (reluare) 15:00 STÃ 15:00 STÃ 15:00 STÃ 15:00 STÃ 15:00 STÃSÃ PLOUÃ CU CHIFTELE SÃ PLOUÃ CU CHIFTELE SÃ PLOUÃ CU CHIFTELE SÃ PLOUÃ CU CHIFTELE SÃ PLOUÃ CU CHIFTELE (animaþie, SUA,2009) (reluare) 18:45 CARTEA JUNGLEI18:45 CARTEA JUNGLEI18:45 CARTEA JUNGLEI18:45 CARTEA JUNGLEI18:45 CARTEA JUNGLEI2 20:30 RENUNÞÃ, DOROTHY! 2 20:30 RENUNÞÃ, DOROTHY! 2 20:30 RENUNÞÃ, DOROTHY! 2 20:30 RENUNÞÃ, DOROTHY! 2 20:30 RENUNÞÃ, DOROTHY! (dramã,SUA, 2006) Cu: Diane Keaton, Tom EverettScott, Alexa Davalos 22:15 O MOARTE MAI 22:15 O MOARTE MAI 22:15 O MOARTE MAI 22:15 O MOARTE MAI 22:15 O MOARTE MAIBUNÃ BUNÃ BUNÃ BUNÃ BUNÃ (acþiune, SUA, 2000) 00:15 BANI 00:15 BANI 00:15 BANI 00:15 BANI 00:15 BANIÎNSÂNGERAÞI ÎNSÂNGERAÞI ÎNSÂNGERAÞI ÎNSÂNGERAÞI ÎNSÂNGERAÞI (thriller, SUA, 2008) (r)

PRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMA08:00 Chipul rãzbunãrii 14:00 Neveste08:00 Chipul rãzbunãrii 14:00 Neveste08:00 Chipul rãzbunãrii 14:00 Neveste08:00 Chipul rãzbunãrii 14:00 Neveste08:00 Chipul rãzbunãrii 14:00 Nevestedisperate 17:00disperate 17:00disperate 17:00disperate 17:00disperate 17:00 MISS MARPLE: MÂNA MISS MARPLE: MÂNA MISS MARPLE: MÂNA MISS MARPLE: MÂNA MISS MARPLE: MÂNAASCUNSÃ ASCUNSÃ ASCUNSÃ ASCUNSÃ ASCUNSÃ (reluare) 19:00 19:00 19:00 19:00 19:00 Hawaii 5.0Hawaii 5.0Hawaii 5.0Hawaii 5.0Hawaii 5.020:00 În mintea criminalului20:00 În mintea criminalului20:00 În mintea criminalului20:00 În mintea criminalului20:00 În mintea criminalului 21:00 21:00 21:00 21:00 21:00Pompierii din Chicago 23:00 AnatomiaPompierii din Chicago 23:00 AnatomiaPompierii din Chicago 23:00 AnatomiaPompierii din Chicago 23:00 AnatomiaPompierii din Chicago 23:00 Anatomialui Greylui Greylui Greylui Greylui Grey 01:00 ÎN MINTEA 01:00 ÎN MINTEA 01:00 ÎN MINTEA 01:00 ÎN MINTEA 01:00 ÎN MINTEACRIMINALULUI CRIMINALULUI CRIMINALULUI CRIMINALULUI CRIMINALULUI 02:00 Chipul rãzbunãrii02:00 Chipul rãzbunãrii02:00 Chipul rãzbunãrii02:00 Chipul rãzbunãrii02:00 Chipul rãzbunãrii02:45 02:45 02:45 02:45 02:45 HERCULE POIROTHERCULE POIROTHERCULE POIROTHERCULE POIROTHERCULE POIROT: ELEPHANTS: ELEPHANTS: ELEPHANTS: ELEPHANTS: ELEPHANTSCAN REMEMBER CAN REMEMBER CAN REMEMBER CAN REMEMBER CAN REMEMBER (serial, reluare)

DIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSAL

HBOHBOHBOHBOHBO06:00 CE-AR FI DACÃ?06:00 CE-AR FI DACÃ?06:00 CE-AR FI DACÃ?06:00 CE-AR FI DACÃ?06:00 CE-AR FI DACÃ?07:35 LIGA DREPTÃÞII07:35 LIGA DREPTÃÞII07:35 LIGA DREPTÃÞII07:35 LIGA DREPTÃÞII07:35 LIGA DREPTÃÞII

VERSUS LIGAVERSUS LIGAVERSUS LIGAVERSUS LIGAVERSUS LIGABIZARROBIZARROBIZARROBIZARROBIZARRO

08:25 VERONICA08:25 VERONICA08:25 VERONICA08:25 VERONICA08:25 VERONICAMARSMARSMARSMARSMARS

10:10 BHOPAL: O10:10 BHOPAL: O10:10 BHOPAL: O10:10 BHOPAL: O10:10 BHOPAL: ORUGÃCIUNERUGÃCIUNERUGÃCIUNERUGÃCIUNERUGÃCIUNEPENTRU PLOAIEPENTRU PLOAIEPENTRU PLOAIEPENTRU PLOAIEPENTRU PLOAIE

11:55 GARDIENII11:55 GARDIENII11:55 GARDIENII11:55 GARDIENII11:55 GARDIENIIGALAXIEIGALAXIEIGALAXIEIGALAXIEIGALAXIEI

13:55 LIGA DREPTÃÞII:13:55 LIGA DREPTÃÞII:13:55 LIGA DREPTÃÞII:13:55 LIGA DREPTÃÞII:13:55 LIGA DREPTÃÞII:TRONUL DINTRONUL DINTRONUL DINTRONUL DINTRONUL DINAAAAATLANTISTLANTISTLANTISTLANTISTLANTIS

15:10 ACASÃ DE15:10 ACASÃ DE15:10 ACASÃ DE15:10 ACASÃ DE15:10 ACASÃ DECRÃCIUNCRÃCIUNCRÃCIUNCRÃCIUNCRÃCIUN

17:10 INTERSTELLAR:17:10 INTERSTELLAR:17:10 INTERSTELLAR:17:10 INTERSTELLAR:17:10 INTERSTELLAR:CÃLÃCÃLÃCÃLÃCÃLÃCÃLÃTORINDTORINDTORINDTORINDTORINDPRIN UNIVERSPRIN UNIVERSPRIN UNIVERSPRIN UNIVERSPRIN UNIVERS

20:45 WHITNEY20:45 WHITNEY20:45 WHITNEY20:45 WHITNEY20:45 WHITNEY22:15 RIPOST22:15 RIPOST22:15 RIPOST22:15 RIPOST22:15 RIPOSTAAAAA23:05 ÞINUTUL DIN23:05 ÞINUTUL DIN23:05 ÞINUTUL DIN23:05 ÞINUTUL DIN23:05 ÞINUTUL DIN

NORDNORDNORDNORDNORD01:10 UN ET01:10 UN ET01:10 UN ET01:10 UN ET01:10 UN ETAJ MAIAJ MAIAJ MAIAJ MAIAJ MAI

JOSJOSJOSJOSJOS02:45 SIN CITY: AM02:45 SIN CITY: AM02:45 SIN CITY: AM02:45 SIN CITY: AM02:45 SIN CITY: AM

UCIS PENTRU EAUCIS PENTRU EAUCIS PENTRU EAUCIS PENTRU EAUCIS PENTRU EA(poliþist, SUA, ‘14)

05:00 P05:00 P05:00 P05:00 P05:00 PAAAAATCH ADAMS,TCH ADAMS,TCH ADAMS,TCH ADAMS,TCH ADAMS,UN DOCTORUN DOCTORUN DOCTORUN DOCTORUN DOCTORTRÃSNITTRÃSNITTRÃSNITTRÃSNITTRÃSNIT

07:00 THE OTHER END07:00 THE OTHER END07:00 THE OTHER END07:00 THE OTHER END07:00 THE OTHER ENDOF THE LINEOF THE LINEOF THE LINEOF THE LINEOF THE LINE

09:00 AVENTURILE LUI09:00 AVENTURILE LUI09:00 AVENTURILE LUI09:00 AVENTURILE LUI09:00 AVENTURILE LUISHARKBOY ªISHARKBOY ªISHARKBOY ªISHARKBOY ªISHARKBOY ªILAVAGIRL ÎN 3DLAVAGIRL ÎN 3DLAVAGIRL ÎN 3DLAVAGIRL ÎN 3DLAVAGIRL ÎN 3D

11:00 GA11:00 GA11:00 GA11:00 GA11:00 GATTTTTTTTTTACAACAACAACAACA12:50 CAPOTE12:50 CAPOTE12:50 CAPOTE12:50 CAPOTE12:50 CAPOTE14:50 LEGILE MIªCÃRII14:50 LEGILE MIªCÃRII14:50 LEGILE MIªCÃRII14:50 LEGILE MIªCÃRII14:50 LEGILE MIªCÃRII16:20 RACHEL SE16:20 RACHEL SE16:20 RACHEL SE16:20 RACHEL SE16:20 RACHEL SE

MÃRITÃMÃRITÃMÃRITÃMÃRITÃMÃRITÃ

TV 1000TV 1000TV 1000TV 1000TV 1000

11:00 Înfruntarea11:00 Înfruntarea11:00 Înfruntarea11:00 Înfruntarea11:00 Înfruntareadinastiilordinastiilordinastiilordinastiilordinastiilor

12:15 Baronii12:15 Baronii12:15 Baronii12:15 Baronii12:15 Baronii13:30 Dragoste dulce-13:30 Dragoste dulce-13:30 Dragoste dulce-13:30 Dragoste dulce-13:30 Dragoste dulce-

amarãamarãamarãamarãamarã14:45 Mica mireasã14:45 Mica mireasã14:45 Mica mireasã14:45 Mica mireasã14:45 Mica mireasã17:15 Înfruntarea17:15 Înfruntarea17:15 Înfruntarea17:15 Înfruntarea17:15 Înfruntarea

dinastiilordinastiilordinastiilordinastiilordinastiilor19:1519:1519:1519:1519:15 Mica mireasãMica mireasãMica mireasãMica mireasãMica mireasã20:15 Dragoste ºi urã20:15 Dragoste ºi urã20:15 Dragoste ºi urã20:15 Dragoste ºi urã20:15 Dragoste ºi urã21:15 21:15 21:15 21:15 21:15 Furie ºi dragosteFurie ºi dragosteFurie ºi dragosteFurie ºi dragosteFurie ºi dragoste22:30 SEX POT22:30 SEX POT22:30 SEX POT22:30 SEX POT22:30 SEX POT

(comedie, SUA, ‘09)

NAÞIONALNAÞIONALNAÞIONALNAÞIONALNAÞIONALTVR 1TVR 1TVR 1TVR 1TVR 1

ACTUALITATEA14

09:00 Starea naþiei11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi

paraleleparaleleparaleleparaleleparalele12:30 Tribuna partidelor

parlamentare13:00 EUROpolis

Cu Nicoleta Epure15:30 Mghiara de pe unu16:55 Vorbeºte corect17:00 Nocturne18:00 Reconstituiri - Fã-l

sã disparã19:00 Exclusiv în19:00 Exclusiv în19:00 Exclusiv în19:00 Exclusiv în19:00 Exclusiv în

RomâniaRomâniaRomâniaRomâniaRomânia19:45 Sport19:55 Starea zilei21:00 Prim - plan22:25 Starea zilei22:30 Starea naþiei.

Cu Dragoº Pãtraru23:25 Repriza a treia

Moderator: CristianMîndru

00:20 Politicã ºi delicateþuri(reluare)

01:15 Exclusiv în România(reluare)

06:00 Poveºti în halate albe

10:30 La Mãruþã10:30 La Mãruþã10:30 La Mãruþã10:30 La Mãruþã10:30 La Mãruþã(reluare)

12:00 Vorbeºte lumea13:00 ªtirile PRO TV14:00 Vorbeºte lumea

Cu: Cove, Nadine16:00 Ce spun românii17:30 17:30 17:30 17:30 17:30 La MãruþãLa MãruþãLa MãruþãLa MãruþãLa Mãruþã20:30 PREÞUL20:30 PREÞUL20:30 PREÞUL20:30 PREÞUL20:30 PREÞUL

RÃZBUNÃRIIRÃZBUNÃRIIRÃZBUNÃRIIRÃZBUNÃRIIRÃZBUNÃRII (acþiune, SUA,2011) Cu: DjimonHounsou, KevinBacon, JirantainPitakporntrakul

22:15 ªtirile PRO TV22:15 ªtirile PRO TV22:15 ªtirile PRO TV22:15 ªtirile PRO TV22:15 ªtirile PRO TV22:45 T22:45 T22:45 T22:45 T22:45 Terra Novaerra Novaerra Novaerra Novaerra Nova23:45 Lege ºi dreptate23:45 Lege ºi dreptate23:45 Lege ºi dreptate23:45 Lege ºi dreptate23:45 Lege ºi dreptate00:45 00:45 00:45 00:45 00:45 PREÞULPREÞULPREÞULPREÞULPREÞUL

RÃZBUNÃRIIRÃZBUNÃRIIRÃZBUNÃRIIRÃZBUNÃRIIRÃZBUNÃRII (acþiune, SUA,2011) Cu: DjimonHounsou, KevinBacon, JirantainPitakporntrakul(reluare)

02:30 Ce spun românii(reluare)

ANTENA 1ANTENA 1ANTENA 1ANTENA 1ANTENA 108:00 Neatza cu08:00 Neatza cu08:00 Neatza cu08:00 Neatza cu08:00 Neatza cu

Rãzvan ºi DaniRãzvan ºi DaniRãzvan ºi DaniRãzvan ºi DaniRãzvan ºi Dani11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru11:15 Mireasã pentru

fiul meufiul meufiul meufiul meufiul meureality show

14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentru14:00 Mireasã pentrufiul meufiul meufiul meufiul meufiul meuCu MirelaBoureanu Vaida

17:00 17:00 17:00 17:00 17:00 Acces directAcces directAcces directAcces directAcces direct20:00 Observator special

Cu: OctaviaGeamãnu

20:30 20:30 20:30 20:30 20:30 Poftiþi pe laPoftiþi pe laPoftiþi pe laPoftiþi pe laPoftiþi pe lanoi: Poftiþi ºinoi: Poftiþi ºinoi: Poftiþi ºinoi: Poftiþi ºinoi: Poftiþi ºidãruiþi !dãruiþi !dãruiþi !dãruiþi !dãruiþi !

23:00 Un show pãcãtos.Emisiune tabloidprezentatã de DanCapatos

01:00 Observator specialEmisiune cuOctavia Geamãnu

01:30 Poftiþi pe la01:30 Poftiþi pe la01:30 Poftiþi pe la01:30 Poftiþi pe la01:30 Poftiþi pe lanoi: Poftiþi ºinoi: Poftiþi ºinoi: Poftiþi ºinoi: Poftiþi ºinoi: Poftiþi ºidãruiþi! dãruiþi! dãruiþi! dãruiþi! dãruiþi! (reluare)

03:45 Acces direct(reluare)

PRIMA TVPRIMA TVPRIMA TVPRIMA TVPRIMA TV10:00 Focus din inima10:00 Focus din inima10:00 Focus din inima10:00 Focus din inima10:00 Focus din inima

RomânieiRomânieiRomânieiRomânieiRomâniei11:30 Focus magazin12:10 Dupã faptã ºi rãsplatã13:50 Cronica zilei13:55 Nimeni nu-i13:55 Nimeni nu-i13:55 Nimeni nu-i13:55 Nimeni nu-i13:55 Nimeni nu-i

perfectperfectperfectperfectperfect15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi15:00 Râzi ºi câºtigi

(reluare)15:30 Cireaºa de pe tort15:30 Cireaºa de pe tort15:30 Cireaºa de pe tort15:30 Cireaºa de pe tort15:30 Cireaºa de pe tort

(reluare)16:25 Cronica zilei17:00 T17:00 T17:00 T17:00 T17:00 Trãsniþiirãsniþiirãsniþiirãsniþiirãsniþii18:00 Focus18:00 Focus18:00 Focus18:00 Focus18:00 Focus19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort19:15 Cireaºa de pe tort20:10 Cronica zilei20:15 RÃZBUNARE20:15 RÃZBUNARE20:15 RÃZBUNARE20:15 RÃZBUNARE20:15 RÃZBUNARE

ROªIEROªIEROªIEROªIEROªIE (acþiune, SUA,1999) Cu: AngieEverhart, JeffSpeakman

22:15 T22:15 T22:15 T22:15 T22:15 TrãsniþiirãsniþiirãsniþiirãsniþiirãsniþiiEp. 25 din sez. 25

23:0023:0023:0023:0023:00 Focus din inima Focus din inima Focus din inima Focus din inima Focus din inimaRomânieiRomânieiRomânieiRomânieiRomâniei

23:30 Focus magazin23:30 Focus magazin23:30 Focus magazin23:30 Focus magazin23:30 Focus magazinCu: Diana Bart

PRO TVPRO TVPRO TVPRO TVPRO TV KANAL DKANAL DKANAL DKANAL DKANAL D08:00 08:00 08:00 08:00 08:00 T T T T Teo Showeo Showeo Showeo Showeo Show10:30 Iffet10:30 Iffet10:30 Iffet10:30 Iffet10:30 Iffet12:30 ªtirile Kanal D13:30 T13:30 T13:30 T13:30 T13:30 Te vreaue vreaue vreaue vreaue vreau

lângã minelângã minelângã minelângã minelângã mine16:45 16:45 16:45 16:45 16:45 TTTTTeo Showeo Showeo Showeo Showeo Show20:00 Bahar: Viþã20:00 Bahar: Viþã20:00 Bahar: Viþã20:00 Bahar: Viþã20:00 Bahar: Viþã

furatãfuratãfuratãfuratãfuratã22:30 Wow Biz

Emisiune tabloid01:45 Bahar: Viþã01:45 Bahar: Viþã01:45 Bahar: Viþã01:45 Bahar: Viþã01:45 Bahar: Viþã

furatãfuratãfuratãfuratãfuratã(reluare)

03:45 T03:45 T03:45 T03:45 T03:45 Te vreau lângãe vreau lângãe vreau lângãe vreau lângãe vreau lângãmineminemineminemine(reluare)

06:00 Teleshopping

ACASÃ TVACASÃ TVACASÃ TVACASÃ TVACASÃ TV06:00 Vorbeºte lumea08:45 Avenida Brasil08:45 Avenida Brasil08:45 Avenida Brasil08:45 Avenida Brasil08:45 Avenida Brasil11:15 Lupta rozelor11:15 Lupta rozelor11:15 Lupta rozelor11:15 Lupta rozelor11:15 Lupta rozelor14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã14:00 Pasiune interzisã16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti16:00 Spune-mi cã eºti

a mea!a mea!a mea!a mea!a mea!17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu17:00 Sufletul meu

perecheperecheperecheperechepereche18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor18:00 Lupta rozelor20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil20:00 Avenida Brasil22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald22:00 Vise de smarald23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan23:00 Inimã de þigan00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla00:30 Santa Diabla01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor01:30 Lupta rozelor

(reluare)03:15 Doamne de poveste04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan04:00 Inimã de þigan (r)

TVR 2TVR 2TVR 2TVR 2TVR 208:10 Arta fericirii08:10 Arta fericirii08:10 Arta fericirii08:10 Arta fericirii08:10 Arta fericirii10:00 Furtuni în10:00 Furtuni în10:00 Furtuni în10:00 Furtuni în10:00 Furtuni în

strâmtoareastrâmtoareastrâmtoareastrâmtoareastrâmtoareaMagellanMagellanMagellanMagellanMagellan

12:00 La fix14:30 Cultura minoritãþilor16:0016:0016:0016:0016:00 Ieri-azi-mâine Ieri-azi-mâine Ieri-azi-mâine Ieri-azi-mâine Ieri-azi-mâine17:00 Legea lui Doyle17:00 Legea lui Doyle17:00 Legea lui Doyle17:00 Legea lui Doyle17:00 Legea lui Doyle17:50 Cartea cea de17:50 Cartea cea de17:50 Cartea cea de17:50 Cartea cea de17:50 Cartea cea de

toate zileletoate zileletoate zileletoate zileletoate zilele20:10 D’ale lu’ Miticã20:10 D’ale lu’ Miticã20:10 D’ale lu’ Miticã20:10 D’ale lu’ Miticã20:10 D’ale lu’ Miticã21:00 Detine ca-n filme21:00 Detine ca-n filme21:00 Detine ca-n filme21:00 Detine ca-n filme21:00 Detine ca-n filme23:10 CSI: Crime ºi23:10 CSI: Crime ºi23:10 CSI: Crime ºi23:10 CSI: Crime ºi23:10 CSI: Crime ºi

investigaþiiinvestigaþiiinvestigaþiiinvestigaþiiinvestigaþii00:00 La fix (reluare)01:00 Memorialul durerii

(reluare)

07:45 La Mãruþã07:45 La Mãruþã07:45 La Mãruþã07:45 La Mãruþã07:45 La Mãruþã 09:15 09:15 09:15 09:15 09:15 AMINTIRIAMINTIRIAMINTIRIAMINTIRIAMINTIRI 13:15 13:15 13:15 13:15 13:15ULULULULULTIMA CÃLÃTIMA CÃLÃTIMA CÃLÃTIMA CÃLÃTIMA CÃLÃTORIETORIETORIETORIETORIE (reluare) 15:00 15:00 15:00 15:00 15:00 MAIMAIMAIMAIMAIE MULE MULE MULE MULE MULT PÂNÃ AJUNGEM? T PÂNÃ AJUNGEM? T PÂNÃ AJUNGEM? T PÂNÃ AJUNGEM? T PÂNÃ AJUNGEM? (comedie,SUA, 2005) (reluare) 18:45 CA-N18:45 CA-N18:45 CA-N18:45 CA-N18:45 CA-NVREMURILE BUNE 20:30 IHAI SÃ NEVREMURILE BUNE 20:30 IHAI SÃ NEVREMURILE BUNE 20:30 IHAI SÃ NEVREMURILE BUNE 20:30 IHAI SÃ NEVREMURILE BUNE 20:30 IHAI SÃ NECÃSÃCÃSÃCÃSÃCÃSÃCÃSÃTORIM (II) 22:15 MAESTRULTORIM (II) 22:15 MAESTRULTORIM (II) 22:15 MAESTRULTORIM (II) 22:15 MAESTRULTORIM (II) 22:15 MAESTRULBEÞIV BEÞIV BEÞIV BEÞIV BEÞIV (acþiune, Hong Kong, 1978) Cu:Jackie Chan, Simon Yuen Jr., Hwang Jang00:30 ANUL UNU 00:30 ANUL UNU 00:30 ANUL UNU 00:30 ANUL UNU 00:30 ANUL UNU (r) 02:30 Cine A.M.

PRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMAPRO CINEMA08:00 Chipul rãzbunãrii 09:00 08:00 Chipul rãzbunãrii 09:00 08:00 Chipul rãzbunãrii 09:00 08:00 Chipul rãzbunãrii 09:00 08:00 Chipul rãzbunãrii 09:00 MISSMISSMISSMISSMISSMARPLE: VERDICT - CRIMÃMARPLE: VERDICT - CRIMÃMARPLE: VERDICT - CRIMÃMARPLE: VERDICT - CRIMÃMARPLE: VERDICT - CRIMÃ 11:00 11:00 11:00 11:00 11:00Medici începãtori 12:00Medici începãtori 12:00Medici începãtori 12:00Medici începãtori 12:00Medici începãtori 12:00 CRIMELE DIN CRIMELE DIN CRIMELE DIN CRIMELE DIN CRIMELE DINMIDSOMER: THE BALLAD OFMIDSOMER: THE BALLAD OFMIDSOMER: THE BALLAD OFMIDSOMER: THE BALLAD OFMIDSOMER: THE BALLAD OFMIDSOMER COUNTY 14:00 MIDSOMER COUNTY 14:00 MIDSOMER COUNTY 14:00 MIDSOMER COUNTY 14:00 MIDSOMER COUNTY 14:00 NevesteNevesteNevesteNevesteNevestedisperate 16:00 Chipul rãzbunãriidisperate 16:00 Chipul rãzbunãriidisperate 16:00 Chipul rãzbunãriidisperate 16:00 Chipul rãzbunãriidisperate 16:00 Chipul rãzbunãrii20:00 În mintea criminalului20:00 În mintea criminalului20:00 În mintea criminalului20:00 În mintea criminalului20:00 În mintea criminalului 21:00 21:00 21:00 21:00 21:00MÂNA CARE ÎMPINGE LEAGÃNULMÂNA CARE ÎMPINGE LEAGÃNULMÂNA CARE ÎMPINGE LEAGÃNULMÂNA CARE ÎMPINGE LEAGÃNULMÂNA CARE ÎMPINGE LEAGÃNUL23:15 ARMAGEDDON: SF23:15 ARMAGEDDON: SF23:15 ARMAGEDDON: SF23:15 ARMAGEDDON: SF23:15 ARMAGEDDON: SF. LUMII?. LUMII?. LUMII?. LUMII?. LUMII?

DIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSALDIVA UNIVERSAL

HBOHBOHBOHBOHBO06:00 GODZILLA06:00 GODZILLA06:00 GODZILLA06:00 GODZILLA06:00 GODZILLA08:05 PAUL, MARE08:05 PAUL, MARE08:05 PAUL, MARE08:05 PAUL, MARE08:05 PAUL, MARE

POLIÞIST LAPOLIÞIST LAPOLIÞIST LAPOLIÞIST LAPOLIÞIST LAMALL 2MALL 2MALL 2MALL 2MALL 2

09:40 JOSEPHINE09:40 JOSEPHINE09:40 JOSEPHINE09:40 JOSEPHINE09:40 JOSEPHINE11:10 WALESA11:10 WALESA11:10 WALESA11:10 WALESA11:10 WALESA13:15 ACASÃ LA T13:15 ACASÃ LA T13:15 ACASÃ LA T13:15 ACASÃ LA T13:15 ACASÃ LA TAAAAATTTTTAAAAA14:55 DRUMUL14:55 DRUMUL14:55 DRUMUL14:55 DRUMUL14:55 DRUMUL

RUªINIIRUªINIIRUªINIIRUªINIIRUªINII16:30 UN ANTRENOR16:30 UN ANTRENOR16:30 UN ANTRENOR16:30 UN ANTRENOR16:30 UN ANTRENOR

DE LEGENDÃDE LEGENDÃDE LEGENDÃDE LEGENDÃDE LEGENDÃ(dramã, SUA, 2014)Cu: J. Caviezel

18:25 NU VOM AFLA18:25 NU VOM AFLA18:25 NU VOM AFLA18:25 NU VOM AFLA18:25 NU VOM AFLANICIODANICIODANICIODANICIODANICIODATÃTÃTÃTÃTÃPARISULPARISULPARISULPARISULPARISUL(comedie, SUA,2014) Cu: SimonHelberg

20:00 COªARII20:00 COªARII20:00 COªARII20:00 COªARII20:00 COªARII (dramã, Germania,2013)

21:45 E nevoie de un21:45 E nevoie de un21:45 E nevoie de un21:45 E nevoie de un21:45 E nevoie de unerouerouerouerouerou

23:40 CE-AM GÃSIT23:40 CE-AM GÃSIT23:40 CE-AM GÃSIT23:40 CE-AM GÃSIT23:40 CE-AM GÃSITSÃ FIE AL MEUSÃ FIE AL MEUSÃ FIE AL MEUSÃ FIE AL MEUSÃ FIE AL MEU(horror, SUA, 2014)

01:10 COPILUL DORIT01:10 COPILUL DORIT01:10 COPILUL DORIT01:10 COPILUL DORIT01:10 COPILUL DORIT

05:00 O F05:00 O F05:00 O F05:00 O F05:00 O FAAAAATÃ ÎN PTÃ ÎN PTÃ ÎN PTÃ ÎN PTÃ ÎN PARCARCARCARCARC07:00 FAMILIA DIN07:00 FAMILIA DIN07:00 FAMILIA DIN07:00 FAMILIA DIN07:00 FAMILIA DIN

MANSFIELDMANSFIELDMANSFIELDMANSFIELDMANSFIELDPARKPARKPARKPARKPARK

09:00 NOPÞI09:00 NOPÞI09:00 NOPÞI09:00 NOPÞI09:00 NOPÞIHOLLHOLLHOLLHOLLHOLLYWOODIENEYWOODIENEYWOODIENEYWOODIENEYWOODIENE

11:10 TREZINDU-TE LA11:10 TREZINDU-TE LA11:10 TREZINDU-TE LA11:10 TREZINDU-TE LA11:10 TREZINDU-TE LARENORENORENORENORENO

13:00 DEGUST13:00 DEGUST13:00 DEGUST13:00 DEGUST13:00 DEGUSTAREA DEAREA DEAREA DEAREA DEAREA DEVINURIVINURIVINURIVINURIVINURI

16:40 COLUMBUS16:40 COLUMBUS16:40 COLUMBUS16:40 COLUMBUS16:40 COLUMBUSCIRCLECIRCLECIRCLECIRCLECIRCLE

21:30 DOAMNA BROWN21:30 DOAMNA BROWN21:30 DOAMNA BROWN21:30 DOAMNA BROWN21:30 DOAMNA BROWN

TV 1000TV 1000TV 1000TV 1000TV 1000

08:00 Opriþi timpul08:00 Opriþi timpul08:00 Opriþi timpul08:00 Opriþi timpul08:00 Opriþi timpul11:00 11:00 11:00 11:00 11:00 ÎnfruntareaÎnfruntareaÎnfruntareaÎnfruntareaÎnfruntarea

dinastiilordinastiilordinastiilordinastiilordinastiilor12:15 Baronii12:15 Baronii12:15 Baronii12:15 Baronii12:15 Baronii13:30 Dragoste dulce-13:30 Dragoste dulce-13:30 Dragoste dulce-13:30 Dragoste dulce-13:30 Dragoste dulce-

amarãamarãamarãamarãamarã16:15 Destine împlinite16:15 Destine împlinite16:15 Destine împlinite16:15 Destine împlinite16:15 Destine împlinite

(reluare)19:1519:1519:1519:1519:15 Mica mireasãMica mireasãMica mireasãMica mireasãMica mireasã20:15 20:15 20:15 20:15 20:15 Destine împliniteDestine împliniteDestine împliniteDestine împliniteDestine împlinite21:15 21:15 21:15 21:15 21:15 AAAAATTILA TTILA TTILA TTILA TTILA (acþiune,

SUA, 2013) Cu:Cheick Kongo

NAÞIONALNAÞIONALNAÞIONALNAÞIONALNAÞIONALTVR 1TVR 1TVR 1TVR 1TVR 1

10 FEBRUARIE 2016 MIERCURI

11 FEBRUARIE 2016 JOI

PAªTE FERICIT! LUNI09:00 Starea naþiei09:00 Starea naþiei09:00 Starea naþiei09:00 Starea naþiei09:00 Starea naþiei11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi11:00 Cãlãtori în lumi

paraleleparaleleparaleleparaleleparalele12:30 Comorile12:30 Comorile12:30 Comorile12:30 Comorile12:30 Comorile

TTTTToscaneioscaneioscaneioscaneioscanei13:00 Germana... la 115:30 Maghiara de pe unu16:55 Vorbeºte corect17:00 Garanatat 100%18:00 Reconstituiri -18:00 Reconstituiri -18:00 Reconstituiri -18:00 Reconstituiri -18:00 Reconstituiri -

Bãieþi rãiBãieþi rãiBãieþi rãiBãieþi rãiBãieþi rãi19:00 Exclusiv în România19:45 Sport20:00 Telejurnal21:00 Prim - plan22:25 Starea zilei22:30 Starea naþiei.

Cu Dragoº Pãtraru23:25 Nocturne.

Moderator: MarinaConstantinescu

00:20 La taifas cu Europa(reluare)

01:15 Exclusiv în România(reluare)

02:00 Un doctor pentrudumneavoastrã

03:00 Sport (reluare)

9 FEBRUARIE 2016 MARÞI

LUNIRECOMANDÃRI TVACTUALITATEA14

Page 15: Actualitatea 961

15SUPERSTAR5 - 11 FEBRUARIE 2016 ACTUALITATEA

Este cunoscută pentru posterio-rul ei impresionant, iar acest lucru este perceput şi de costumaţiile pe

care Jennifer Lopez le poartă în spectacole. Cântăreaţa are de sus-ţinut 20 de concerte în Las Vegas, însă încă de la primul, vedeta a re-uşit să iasă în evidenţă. mai precis, în timp ce saluta publicul, lui J. Lo i-au pocnit pantalonii. Incidentul

nu a tulburat-o pe vedetă, care şi-a văzut liniştită de show în continua-

re. Asta însemnă să fii artist!

La 46 de ani, Catherine Zeta-Jones nu mai este frumuseţea la apariţia căreia bărbaţilor

li se tăia răsuflarea. S-a văzut acest lucru la premiera mondială a filmului „Dad’s Army”,

care a avut loc la Leicester Square cinema din Londra. Vedeta căsătorită cu michael

Douglas a încercat să pară cât mai sexy într-o rochie lungă, dar decoltată şi despicată. Dar

ţinuta i-a pus probleme şi s-a văzut că s-au cam ofilit farmecele laureatei cu Oscar,

care a debutat în 1990 interpretând rolul şeherezadei în filmul lui

Philippe de broca, „Les 1001 nuits - 1001 de nopţi”.

Actriţa a încercat repede să ascundă ceea ce nu dorea să se remarce.

Dar, pentru ea, povestea merge mai departe. şi

a durat mai mult decât

un basm.

A fost şi încă mai este visul multor bărbaţi, iar monica

bellucci reuşeşte să păstreze această aură chiar şi la 51 de ani.

Actriţa italiană a apărut la di-neul oferit după gala Sidaction, asociaţie de luptă contra SIDA, în timpul Săptămânii modei de

la Paris, într-o rochie mulată care a făcut-o să se afle în cen-

trul atenţiei. Pentru că italianca nu încearcă să apeleze la subter-

fugii, ascunzându-şi vârsta, ci mizează pe sex-appeal-ul dăruit

de natură. Evident, câştigă de fiecare dată.

Ch

rist

ina

Ag

uil

era

a

de

ve

nit

no

sta

lgic

ă

Avril Lavigne, surprinsă la shopping

Ca

rla

bru

ni

- S

ark

ozy

, în

pli

fo

rmă

rita Ora, fără

lenjerie intimă la un eveniment

Ca

ther

ine

Zet

a-J

on

es,

dec

olt

ată

, d

ar

pre

cau

monica bellucci, frumuseţe fără

vârstă

Jennifer Lopez cupantalonii crăpaţi

în plin concert

Degeaba s-au străduit manechi-

nele să strălucească pe catwalk, rita Ora tot a reuşit să le fure

prim-planul.Vedeta de 25 de ani

a renunţat la lenjeria intimă şi s-a bazat pe o rochie mulată, in-tens decupată, ca să demonstreze că este în cea mai bună for-

mă. Iar puţină lume a mai avut ochi pentru prezentarea Versa-ce de la Paris când

interpreta şi-a făcut apariţia şi s-a văzut

că nu poartă nimic pe sub ţinuta scurtă şi

portocalie. Celebră şi hot, ce îşi poate dori

mai mult cineva?

Nu pare să-i pese de zvonul lansat de presă că ar fi în prag de divorţ de soţul ei, fos-tul preşedinte francez Nicolas Sarkozy.

Carla Bruni a apărut în pli-nă formă şi cu zâmbetul pe faţă la Săptă-mâna Modei de la Paris. Fostul model conver-tit la muzică are 48 de ani, dar şi-a păstrat silueta care i-a deschis multe uşi în viaţă. Şi nici acum nu a trădat-o.

Toate priviri-le au fost aţin-tite asupra ei la prezentarea colecţiei pri-măvară - vară a casei Schiapa-relli. Deşi fosta prima doamnă a Franţei nu se afla pe catwalk, ci în public.

Moment de nos-talgie pentru Christi-na Aguilera? Aşa s-ar părea, după imagini-le pe care interpreta le-a postat. Vedeta de 35 de ani şi-a amintit de pictorialul pe care i l-a realizat celebra Ellen Von Unwerth. A postat două ima-gini şi a scris: „Îmi plac aceste momente atemporale cu unul dintre fotografii mei favoriţi din toate timpurile!”. Cântă-reaţa a omis proba-bil deliberat să ofere mai multe amănun-te. Nu de alta, dar pictorialul deja are o „vârstă”. Datează din 2004. Dar, ce-i drept, imaginile sunt la fel de incitante încă în ziua de azi.

Când te relaxezi la shopping, mai uiţi că eşti vedetă şi fotogra-fii abia aşteaptă să te surprindă într-o po-ziţie indecentă. I s-a întâmplat asta lui Avril Lavigne. Cântăreaţa de 31 de ani a ieşit la cumpărături în Bever-ly Hills. Şi a încercat să îşi ascundă corpul de paparazzi, în timp ce i se prezenta catalogul cu produse, pentru a decide ce îşi doreşte. Dar a fost suficient un moment de neatenţie pentru ca vedeta cana-diană cu 30 de milioa-ne de albume vândute la activ să arate mai mult decât ar fi vrut. Oricum, şi când îţi des-faci picioarele tot pro-movare se numeşte.

Page 16: Actualitatea 961

16 PEnTRU DVS. 5 - 11 FEBRUARIE 2016ACTUALITATEA

rieker romania

angajează n frigotehnist n mecanic specialist mecanică finăn 2 electrostivuitorişti

Te poţi prezenta începând cu ora 6.30 dimineaţa la sediul firmei din Lugoj pe strada Timişorii nr.139-141.

O pasăre care a zburat dintr-o rezervaţie natu-rală israeliană în Liban a fost prinsă de localnici, după ce aceştia au ob-servat că aceasta purta un transmiţător. Vultu-rul a fost reţinut pentru spionaj, a precizat auto-ritatea israeliană pen-tru rezervaţii naturale. Pasărea a fost prinsă de localnicii oraşului li-banez Bint Jbeil. “Mai multe fotografii arată vulturul legat cu frân-ghie de persoane care susţin că pasărea este suspectată de spionaj pentru Israel, din cauza transmiţătorului pe care îl avea ataşat”, au preci-zat israelienii. “În seco-lul 21, ne aşteptăm de la

oameni să înţeleagă că animalele sălbatice nu vor să facă rău. Sperăm că libanezii îl vor elibe-ra”, se menţionează în comunicatul autorităţii israeliene.Pasărea a fost eliberată la scurt timp după ce transmiţătorul a fost cercetat. Teoriile conspiraţiei sunt foarte răspândite în Orientul Mijlociu. Anul trecut, Hamas a anunţat că a

capturat un delfin pe coasta Mării Meditera-ne, care avea asupra sa o cameră video, fiind în-tr-o misiune de spionaj pentru Israel.

În 2011, presa saudi-tă a anunţat capturarea unui vultur cu transmi-ţător GPS şi un inel de identificare aparţinând Universităţii din Tel Aviv. Şi acel vultur a fost reţinut pentru spionaj.

1. Ciuma dansului – 1518În iulie 1518, la Strasbourg, o femeie pe nume Frau

Troffea a început să danseze singură, în mijlocul străzii. În prima săptămână i s-au alăturat 34 de oameni, iar după încă trei săptămâni mulţimea număra aproximativ 400 de oameni, toţi dansând zi şi noapte, fără încetare. Unii au cedat prăbuşindu-se pe caldarâm din cauza epu-izării, atacurilor de cord sau accidentelor vasculare cere-brale. Nici până în ziua de azi nu s-a putut găsi o explica-ţie ştiinţifică plauzibilă cu privire la această epidemie.

2. Febra râsului - 1962S-a declanşat brusc, în ianuarie 1962, la o şcoală de

fete. Trei fete au început să râdă din senin, iar epidemia a cuprins rapid întreaga clasă, iar apoi întreaga şcoală. Unele fete au râs în continuu timp de două săptămâni şi, ce este şi mai ciudat e că râsetele s-au extins şi asupra populaţiilor unor sate din apropiere. În total au fost afec-tate peste 1.000 de persoane, pe o perioadă de 18 luni.

Top 5 cele mai ciudate epidemii din istorie

Kim este mama a două fetiţe şi şi-a dorit, împreu-nă cu soţul ei, să aibă şi un băieţel. Nici prin cap nu i-a trecut că ar putea să aibă parte de una din cele mai rare sarcini posibile. Kim a fost anunţată, în timpul unei ecografii, că aşteaptă într-adevăr un bă-ieţel, dar şi alte patru fetiţe. Cazul ei este extrem de rar şi se întâmplă în 1 din 60 de milioane de sarcini. Drept urmare, Kim şi-a lansat o pagină de Facebook specială, “Surprised by Five”, în care îi ţine pe cei dragi la curent cu evoluţia sarcinii ei miraculoase. În cel de-al treilea trimestru ea şi-a făcut şi o şedinţă foto, iar imaginile sunt de-a dreptul superbe.

n Sarcina care “apare” în 1 din 60 de milioane de cazuri

n Insul care trebuie să declarepoliţiei orice activitate sexuală

Omenirea se străduieşte să dezle-ge unul dintre cele mai mari mistere, anume acela potrivit căruia extratereş-trii au făcut experimente pe oameni. Iar teoriile unora par să dovedească faptul că au existat pământeni răpiţi de forme de viaţă de pe alte planete.

Era în 25 ianuarie, 1967. Betty An-dreasson era acasă împreună cu fami-lia ei, când, deodată, s-a întrerupt cu-rentul electric în locuinţa lor, iar o rază de lumină foarte puternică, orbitoare, a pătruns prin fereastra de la bucătărie. Când Betty şi ceilalţi membri ai famili-ei sale s-au uitat pe fereastră, au văzut cinci creaturi care “ţopăiau” în curte, îndreptându-se către casa lor. Au in-trat în locuinţă trecând prin uşa solidă

din lemn şi, instantaneu, i-au băgat în transă pe toţi membrii familiei An-dreasson. Betty şi tatăl său au povestit mai târziu ceea ce li s-a întâmplat. Ei i-au descris pe extratereştrii care îi vi-zitaseră ca fiind nişte fiinţe scunde şi lipsite de trăsături umane obişnuite. Extratereştrii comunicau numai tele-patic, iar Betty, în mod ciudat, nu s-a speriat, a rămas calmă şi nu se temea de nimic. La fel s-a comportat şi tatăl ei. Tatăl lui Betty a fost “interceptat” de unul dintre cei cinci extratereştri, în timp ce un altul începuse să comunice telepatic cu Betty. Atât Betty, cât şi ta-tăl ei au înţeles că una dintre ciudatele creaturi era “şeful”. Era şi cel mai în-alt dintre ei. Extratereştrii aveau ochii mari, urechile şi nasurile mici, capete-le lor semănau cu o pară şi nu aveau gură. Betty a povestit că a fost luată de extratereştri şi dusă pe nava lor, unde au examinat-o în amănunt prin tehnici necunoscute şi, uneori, chiar dureroa-se. Cazul ei este unul dintre cele mai faimoase cazuri de răpiri de oameni de pe fiinţe de pe alte planete.

Femeia care a fost răpită şi ţinută ostatică de fiinţe de pe alte planete

Magistraţii de la tribunalul din York i-au impus o măsura preventivă cel puţin bizară unui suspect. Bărbatul, în vârstă de 40 de ani, trebuie să notifice poliţia de fiecare dată când are în plan o activitate cu caracter sexual, altminteri riscând până la 5 ani de închisoare. Bărbatul trebuie să le furnizeze poliţişti-lor datele femeii - nume, adresă, data naşterii - cu 24 de ore înainte de actul sexual. Măsura preventivă a fost instituită de magistraţii din York după ce omul a fost acuzat de viol. În 2015, el a făcut recurs şi a fost achitat, după ce a susţinut că presupusa victimă şi-a dat consimţământul. Magistraţii susţin însă că el prezintă un risc de agresiune sexuală, chiar dacă nu a fost condamnat. Astfel de măsuri preventive au fost introduse în Anglia şi Ţara Galilor în martie anul trecut. Ele pot fi aplicate oricărei persoane despre care se bănuieşte că ar putea comite agresiuni sexu-ale, chiar dacă nu a fost niciodată condamnată.

Deşi poate părea greu de cre-zut, prespunctura chiar funcţi-onează şi te ajută să ameliorezi anumite afecţiuni. Practicanţii presopuncturii folosesc aces-te tehnici de 5.000 de ani! Gândeşte-te la această terapie ca la versiunea fără ace a acu-puncturii! Dacă nu ştiai deja, degetul arătător este asociat cu splina şi stomacul. Astfel că, un simplu masaj la acest deget te poate scăpa de constipaţie sau

dureri stomacale. Presează pe degetul arătător timp de 60 de secunde şi vei vedea imediat efectele miraculoase! Atunci când apeşi anumite puncte din organism, reechilibrezi sau eliberezi qi, o formă subtilă de energie care curge prin corp pe canale care se intersectează asemenea unor şosele. Sau, cel puţin, aceasta este explicaţia oferită de cei care practică me-dicina tradiţională chineză.

un vultur a fost arestat în Liban pentru spionaj

3. Epidemia leşinurilor - 1983Aşa cum se întâmplă adesea în cazul epidemiilor ge-

nerate de isteria colectivă, femeile sunt primele victime. Aşa a fost cazul şi în martie 1983, în Cisiordania, atunci când un număr mare de adolescente au început să se plângă de ameţeli şi stări de leşin. În total, epidemia a determinat 943 de spitalizări, dar nimeni nu a înţeles ce s-a întâmplat cu adevărat.

4. Epidemia de encefalită letargicăMai este numită şi boala somnului european şi a fost

consemnată ultima oară între 1915 şi 1926. Persoanele atinse de această boală în forma sa severă aveau aspectul de zombi: faţa lipsită de orice expresie, mişcările lente şi dezordonate. Noţiunile de timp şi spaţiu le erau grav afec-tate, rătăceau fără ţintă şi se loveau de obstacole. Unele descriau un cerc, continuu, până-şi pierdeau echilibrul. Encefalita letargică a omorât 5 milioane de oameni.

5. Isteria telenoveleiMorangos com Açúcar a fost un serial foarte cunoscut

în Portugalia şi Brazilia, destinat copiilor şi adolescenţi-lor şi difuzat la un moment dat şi în România. Proble-mele le-a cauzat însă numai în Portugalia, în mai 2006, când peste 300 de elevi de la 14 şcoli au fost spitalizaţi, acuzând probleme respiratorii, iritaţii de piele şi ame-ţeală. Ministerul Sănătăţii a declarat că aceşti elevi nu au nimic, doar că prezintă aceleaşi simptome ca unul dintre personajele principale ale serialului. Cu toate acestea peste 30 de şcoli au fost închise.

Ce se întâmplă dacă masezi degetul arătător