a possible mechanism of carcinogenesis - the electric charge transport properties of p53
DESCRIPTION
A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53. arXiv:q-bio/0708.3181; 0710.1676. C. T. Shih (施奇廷) Dept. Phys., Tunghi University 2007/10/08 Dept. Physics, National Tsing-Hua University. Collaborators: - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/1.jpg)
A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53
C. T. Shih(施奇廷)Dept. Phys., Tunghi University
2007/10/08Dept. Physics, National Tsing-Hua UniversityCollaborators:• Rudolf A. Römer, Department of Physics and Center for Scientific Computing, University of Warwick, United Kingdom• Stephan Roche, CEA/DSM/DRFMC/SPSMS, Grenoble, France
arXiv:q-bio/0708.3181; 0710.1676
![Page 2: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/2.jpg)
Outline Mutation of p53 tumor suppressor
and cancers A possible mechanism of DNA
damage/repair Scenario: how cancerous mutations
get rid of the repair process Model and method Results and Discussion
![Page 3: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/3.jpg)
Mutation of p53 tumor suppressor and cancers
Guardian of the Genome
![Page 4: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/4.jpg)
Mutants of p53 genes
Summary of carcinogens and mutational events that can alter the p53 genesSummary of carcinogens and mutational events that can alter the p53 genes
![Page 5: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/5.jpg)
Functional Significance of p53
Activate DNA repair proteins when DNA has sustained damage
Hold the cell cycle at the G1/S regulation point on DNA damage recognition (if it holds the cell here for long enough, the DNA repair proteins will have time to fix the damage and the cell will be allowed to continue the cell cycle.)
Initiate apoptosis, the programmed cell death, if the DNA damage proves to be irreparable
![Page 6: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/6.jpg)
Role of p53 tumor-repressor protein
![Page 7: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/7.jpg)
Database: IARC (France)http://www-p53.iarc.fr/index.html
Version R11 (Oct 2006): 23544 records20366 point mutations
![Page 8: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/8.jpg)
DNA: A Schematic View
![Page 9: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/9.jpg)
![Page 10: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/10.jpg)
![Page 11: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/11.jpg)
A possible mechanism of DNA damage/repair
BER (base excision repair) enzyme with [Fe4S4]2+ cluster – robust to oxidation in the absence of DNA
BER binding to DNA – oxidation activated ([Fe4S4]2+ →[Fe4S4]3+) and an electron is mediated
If another BER enzyme is at a distant site, the electron will be caught by the BER. The second BER will be reduced ([Fe4S4]3+ →[Fe4S4]2+) and dissociated
A base lesion can preclude the DNA mediated charge transport. BER will remain localized in the vicinity of the lesion and diffuse to the site to excise the base
E. Yavin et al. (JK Barton group), PNAS 103, 3610 (2006).
![Page 12: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/12.jpg)
Electron Paramagnetic Resonance Experiment
![Page 13: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/13.jpg)
![Page 14: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/14.jpg)
Models for Electric Transport of DNA – 1D
1L: 1-leg model :hopping integral between the i-th and (i+1)-th nucleotide : on-site potential of the basepair
FB (fishbone model) = 1L + hopping between backbone and basepair ( ) + on-site potential of the backbone ( ) DNA for 1≦i≦N and semi-infinite electrodes for i < 1 and i > N
iii
ii
iiiL CCchCCtH
..11
qiqiqi
qi
qiiqi
qiLFB CCCCtHH ,,
,,,,,1
qit
qi
iit
Energy Parameters On-site potential = 8.24eV, = 8.87eV, = 7.75eV and = 9.14eV 1L: The hopping between pairs base is taken to be = 0.4eV FB: hopping onto the backbone is 0.7eV and the backbone onsite energy is taken to be 8.5eV
A C G Tit
Using transfer matrix method to calculate transmission coefficient T(E) for incident energy E
![Page 15: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/15.jpg)
Models for Electric Transport of DNA – 2D
2L: 2-leg model : hopping integral between the two strands
LM (ladder model) = 2L+hopping between backbone and basepair + on-site potential of the backbone DNA for 1≦i≦N and semi-infinite electrodes for i < 1 and i > N
iii
ii
iiiiiL CCchCCtCCtH
2,1,2,1,
2,1,2,1,1,2 ..
iqiqqi
qi
qiqii
qiLLM CCchCCtHH
,,,,
)(,,2 .
2,1t
Energy Parameters 2L: The hopping between like base pairs (AT/AT, GC/GC, etc.) is chosen as 0.35eV, between unlike b
ase pairs it is 0.17eV, = 0.1 eV LM: Intrachain and interchain hopping strengths are as in the two-leg model. In addition, the backbone
is treated as in the fishbone model.
2,1t
Using transfer matrix method to calculate transmission coefficient T(E) for incident energy E
![Page 16: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/16.jpg)
Transmission Coefficient: Transfer Matrix Method
E: Energy of injected carrier; T(E): Transmission coefficent
![Page 17: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/17.jpg)
Sequence-Dependent Transport
![Page 18: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/18.jpg)
Sequence-Dependent Transport
![Page 19: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/19.jpg)
T(E) changed by point mutations
Black T0(E): (GC)30Red Tm(E): 30th base C→GtDNA=tm=1.0 eV
• i: beginning site of the subsequence• w: length of the subsequence• k: mutated site• s’: mutant base• (Emin, Emax)=(5.75, 9.75): energy range of injected carrier• W=4: bandwith in electrodes
![Page 20: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/20.jpg)
Comparison of the cancerous/noncancerous mutations
C→T is a cancerous mutation (the 9th highest frequency found in various types of cancer) C→A and C→G are non-cancerous (not found in the human cancer cells up to now)
P53 seq.: Mutation: 14585 C→T (found 133 times in IARC Database)AGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGGTAAGCAAGCAGGACAAGAAGCGGTGGA
GGAGACCAA
Energy-dependence of logarithmic transmission coefficients of the original sequence (C solid line) and mutated (A dotted, G dotted-dashed, T dashed) sequences with length L = 20 (from 14575th to 14594th nucleotide) of p53. The left panel shows results for model 1L, the right two panels denote the two transport windows for the fishbone model
14585,14575,20 ( )
sT E
![Page 21: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/21.jpg)
Comparison of the cancerous/noncancerous mutationsP53 seq.: Mutation: 14585 C→T (found 133 times in IARC Database)AGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGGTAAGCAAGCAGGACAAGAAGCGGTGGA
GGAGACCAA
Energy-dependence of logarithmic squared differences between the transmission coefficients of the original sequence and mutated (C → T solid line, → A dotted, → G dotted-dashed) sequences.
14585,14575,20 ( )
sT E
For the all four models, the cancerous mutation C→T results in the weakest change in T(E)!
![Page 22: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/22.jpg)
CT Change for Different Models and Propagation Lengths and A Scenario for Carcinogenesis
Cancerous Mutation C→T Lowest CT Change
![Page 23: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/23.jpg)
Scenario: how cancerous mutations get rid of the repair process
The mutations become cancerous – they can get rid of the repair processes
One of the repair processes (proposed by J.K. Barton) is to detect the lesions by probing the DNA mediated charge transport
The point mutations can cause the electric transport properties change of DNA segments containing the mutation points
The transport change of the cancerous mutations must be small, or they will be detected by the electric probing process of BER enzymes
This is a necessary condition, but may not sufficient because there are other repair mechanism
![Page 24: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/24.jpg)
Statistical Analysis for All Possible Mutations
The average effect of a mutation (k, s) of a subsequence with length L on the CT of p53 is defined as
For all 20303×3 = 60909 possible mutations, calculate the for various L
Scatter plots of Γ(k, s;w) versus occurrence frequency of all cancerous mutations (k,s) for (a) L = 20 and (b) 80. The sharp peaks at small Γ agree with the scenario that the most cancerous mutations — namely those with high frequency —change the CT only slightly and thus have smaller Γ.
Hotspots,Small CT change
![Page 25: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/25.jpg)
Comparison of the cancerous/noncancerous mutations Define the following 3 set of the mutations:
M: all 60909 possible mutations Mc: 1953 mutations found in the IARC database (found in cancer cells at least one time) Mc,10: 366 mutations found more than 10 times in the IARC database (most cancerous mutations)
For given L, sort the CT results for M according to Γ(k, s;L) and determine the rank r(k, s;L) of the CT change for each mutation (k, s) A smaller rank means less CT change for the mutation γ(k, s;L) = 100% × r(k, s;L)/60909 is then the relative rank in percentage
![Page 26: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/26.jpg)
Statistical Analysis for All Possible Mutations – The Histograms of the Distribution of γ(k, s;L) Histogram of the distribution of γ(k, s;L) in Mc (light wide bars) and Mc,10 (dark thin bars) which changes the kth nucleotide to s for (a) L = 20 and (b) 80. For M, all values are equal to 5% (20 intervals) as indicated by the horizontal dashed lines. (c) shows the percentage of Γ(k, s;L) values inMc,10 for small CT change as a function of DNA lengths in the range 0–5% (black), 5–10% (dark grey), 10–15% (light grey) and 15–20% (white). Similarly, (d) indicates large CT change forMc,10 in the ranges 80–85% (black), 85–90% (dark grey), 90–95%(light grey) and 95–100% (white). The horizontal dashed lines in (c) and (d) indicates the distributions forM.
Many mutations in Mc,10 have smaller CT change () on the average
The tendency is stronger in L=80 case
More than 50% of the mutations in Mc,10 has there smaller than 20% for L~90
The number of mutationswhose g larger than 80%
Is less than average for all L
![Page 27: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/27.jpg)
Summary The conductance of hotspots of cancerous mutations is smaller than that of other sites On average the cancerous mutations of the gene yield smaller changes of the CT The tendency is stronger in the set of highly cancerous mutations with occurence frequency > 10 These results suggest a scenario of how cancerous mutations might circumvent the DNA damage-repair mechanism and survive to yield carcinogenesis The results are robust for a wide range of types and parameters of models Our analysis is only valid in a statistical sense
Non-cancerous mutations with weak change of CT are observed Other DNA repair processes should exist and we therefore do not intend to claim that the DNA-damage repair solely uses a CT-based criterion
![Page 28: A Possible Mechanism of Carcinogenesis - The Electric Charge Transport Properties of p53](https://reader035.vdocuments.mx/reader035/viewer/2022070419/56815c94550346895dcaa1da/html5/thumbnails/28.jpg)
Thank you for your attention!