8. brest cancer - hindu female-2014

www.wjpps.com Vol 3, Issue 6, 2014.

1213

Abhishikta et al. World Journal of Pharmacy and Pharmaceutical Sciences

ASSOCIATION OF LIFESTYLE VARIABLES WITH THE NOVEL

MUTATION OF BRCA1 GENE IN BREAST CANCER: A CASE-

CONTROL STUDY AMONG THE BENGALEE HINDU FEMALES OF

WEST BENGAL, INDIA.

Abhishikta Ghosh Roy1*, Pulakes Purkait1, Malay Barman2, Biswanath Sarkar1 and

Arup Ratan Bandyopadhyay3

1DNA Laboratory, Anthropological Survey of India, Kolkata, India. 2Department of Surgery, National Medical College and Hospital, Kolkata, India.

3Department of Anthropology, University of Calcutta, Kolkata, India.

ABSTRACT

BRCA1 mutations dramatically increase breast cancer risk, which is

the commonest cause of female death globally including India. There

is a substantial inter-individual variability in breast cancer risk among

BRCA1 mutation carriers, which attracts attention of medical genetics.

In the present study we have identified a novel mutation (cd.1437

CCT>CTT) in BRCA1 gene that changes the amino acid from Proline

to Leucine. Certain lifestyle factors like oral contraceptive use and

abortions are found to be highly associated with breast cancer risk

among the carriers of germline mutation. This study is the first report

from West Bengal among the Bengalee Hindu Caste Female Breast Cancer patients, which

would help in early prognosis of the mutation and modification of lifestyle factors.

Keywords: Novel Mutation, Breast Cancer, Lifestyle factors, Bengalee Hindu females, West

Bengal, India.

INTRODUCTION

Breast cancer is the most frequent female malignancy with an estimated 422,000 new cases

annually being the leading cause of female mortality worldwide (Ferlay et al., 2008). The age

adjusted rates vary with the different regions and cancer registries with increasing incidences

in Indian women with breast cancer (Consolidated Report of Population based Cancer

WWOORRLLDD JJOOUURRNNAALL OOFF PPHHAARRMMAACCYY AANNDD PPHHAARRMMAACCEEUUTTIICCAALL SSCCIIEENNCCEESS SSJJIIFF IImmppaacctt FFaaccttoorr 22..778866

VVoolluummee 33,, IIssssuuee 66,, 11221133--11222266.. RReesseeaarrcchh AArrttiiccllee IISSSSNN 2278 – 4357

Article Received on 25 March 2014, Revised on 20 April 2014, Accepted on 13 May 2014

*Correspondence for Author

Dr. Abhishikta Ghosh Roy

DNA Laboratory,

Anthropological Survey of

India, Kolkata, India.


1214


Registries (2001 – 2004)(Fig.1). Breast cancer being the commonest among women in urban

India, is the second most common cancer among Indian women (Samson et al., 2007).

BRCA1 mutation carriers have a slightly elevated risk of developing breast cancer. Though it

is possible that BRCA1 may interact with estrogen in breast carcinogenesis still it is unclear

what are the exact mechanisms that account for why BRCA1 mutation carriers develop

cancers of these hormonally regulated organs (Lee et al., 2008).

Approximately 5 – 10% of breast cancer and 25% of the early onset of breast cancer is

characterized by genetic susceptibility resulting from highly penetrant germline inactivation

in cancer predisposing genes (Palma et al., 2006). A number of genes have been identified

that are associated with breast cancer that has provided means to begin identifying

individuals and families with an increased risk. BRCA1 was the most highly anticipated

break through in cancer genetics through cloning in the year 1994 (Miki et al., 1994).

Mutations in BRCA1 gene results in loss or inactivation of wild-type allele, resulting in

expression of a non-functional protein and loss of cell cycle control and DNA repair

mechanism in women with tumorigenesis (Welesh and King, 2001).

Estrogen promotes cell proliferation and acts as a genotoxic agent, through its metabolites

generating mutagenic DNA damage in breast carcinogenesis (Yager et al., 2006; Cavalieri et

al., 2000) . BRCA1 is involved in several cellular functions important in carcinogenesis

including DNA damage repair as well as cell cycle checkpoint (Yoshida et al., 2004). In the

absence of BRCA1 functioning, the cancer promoting effects of estrogen would be even

stronger (Fan et al., 2001). There are likely to be other low risk genes that are distributed

more frequently in the population, which interact with environment and lifestyle factors,

which results in breast cancer (Samson et al., 2007).

Breast cancer shows uneven geographical distribution in occurrence reflecting the influence

of local environmental conditions, lifestyle, hormonal / reproductive pattern and genetic

predisposition in the development of the disease (McPherson et al., 2000; Parkin et al., 2001).

Breast cancer being second common cancer in the world, it ranks as fifth cause of death,

because of its good prognosis, average in developed countries is 73% and 57% in developing

countries.

A number of studies have attempted to understand the possible association between certain

lifestyle variables and risk for breast cancer. Certain lifestyle and reproductive factors have


1215


been known to be associated with breast cancer risk. Women, who underwent more menstrual

cycles having early age at menarche (before 12 years) or underwent late menopause (after 55

years) are at a slightly elevated risk of breast cancer (Winer et.al., 2000). Nulliparous women

are at a slightly increased risk of acquiring breast cancer (Huo et al., 2008), the nulliparous

women have undifferentiated cells which never undergoes differentiation, that retains high

concentration of epithelial cells that are targets for carcinogens and therefore undergoes

neoplastic transformation (Boulanger et al., 2005; Henry et al., 2004; Wagner et al., 2002).

Breast-feeding reduces breast cancer risk and is thought to exert its effects through hormonal

mechanisms (Huo et al., 2008; Lord et al., 2008; Zeng et al., 2010). Some studies have found

no association between abortions and increases risk of breast cancer (Erlandsson et al., 2003),

whereas some studies have reported an increased risk of breast cancer among women who

had induced abortions (Zeng et al., 2010). Women who consume alcohol or smoke are at an

increased risk (Atkinson 2003; Chen et al., 2002; Hamajima et al., 2002). Consumption of

alcohol more than two times a day leads to increased level of estrogen in blood leading to

increased risk of breast cancer. Reproductive factors act through different hormonal

mechanisms, some of which may involve estrogen, progesterone, or sex hormone binding

globulin (Bernstein et al., 1985; Garcia-Closas et al., 2002) oral contraceptive use has also

been associated with a slightly increased risk of breast cancer (Collaborative Group on

Hormonal Factors in Breast Cancer, 1996), although the effect is modest, possibly restricted

to current use, and observed in few studies.

Information on BRCA1 mutation in West Bengal, India is still lacking. Association between

breast cancer risk and reproductive and lifestyle variables is still unknown among the

Bengalee Hindu Breast Cancer patients of West Bengal, India. Therefore, the present study is

an attempt to understand the possible risk factors associated with the BRCA1 mutation. This

is the first report from West Bengal, thus it will be a hopeful promise in modifying those

factors to prevent breast cancer occurrence. Some of the breast cancer risk factors can be

modified either through behavioral or environmental changes, whereas genetic and inherited

mutations remains unchanged.

MATERIALS AND METHODS

Collection of samples: The subjects included in this study are 108 patients with histo

pathologically confirmed Breast Carcinoma visiting the Cancer Centre Welfare Home and

Research Institute, Kolkata, India, from April, 2010 to December, 2011. Clinical data and


1216


detailed family history of each patient were collected with the help of collaborating clinicians

after clinical examinations. Ethical approval of the research project using human subjects was

obtained from the Institutional Ethical Committee of Anthropological Survey of India,

Ministry of Culture, Government of India. Patient samples were mainly collected from The

Cancer Centre Welfare Home and Research Institute, Kolkata and National medical College

and Hospital, which are the main referral centers for cases related to Breast Carcinoma. The

demographic data (name, age, caste, address, origin, occupation, family history, educational

status, etc) and reproductive (age at menarche, regularity of menstrual periods, age at

menopause, parity, number of issues) and lifestyle (post menopausal hormone therapy,

abortions, use of oral contraceptives, alcohol consumption and smoking practices) data were

collected using schedule method. Age at menarche was defined as the chronological age

when the women first had her menses; age at menopause was defined as the chronological

age when the natural period ceases without any effect of medical or pathological interference.

Another 127 controls were collected; those were age sex and ethnic group matched. Controls

didn’t have any family history of breast cancer.

DNA Isolation: Approximately 5mL peripheral blood samples were collected in BD

Vacutainer K2 EDTA (6 mL) with written and informed consent from patients with Breast

Carcinoma, and from normal individuals as controls, without any history of breast carcinoma.

Genomic DNA was prepared from fresh whole blood by using the conventional phenol–

chloroform method (Sambrook and Russel, 2001). Genomic DNA was dissolved in TE

(10mM Tris-HCl and 0.1mM EDTA, pH 8.0).

PCR Amplification: Polymerase chain reaction (PCR) was carried out to amplify exon 13 and

adjacent flanking region in a total volume of 10.0 µL containing 40–100 ng genomic DNA,

0.4 mM of each primer, 0.2mM of each dNTP, 0.5–1.5mM of MgCl2 (as appropriate), and

0.2 unit of Taq polymerase (Invitrogen, Carlsbad, CA) in a Thermocycler (GeneAmp-9700;

PE Applied Biosystems, Foster City, CA). Annealing temperature is calculated based on Tm

of the primer pairs. The exon 13 was amplified using the designed primer (F:

AATGGAAAGCTTCTCAAAGTA; R: ATGTTGGAGCTAGGTCCTTAC). PCR amplified

DNA fragments were analyzed on 2% agarose gel and then visualized by ethidium bromide

staining.

Mutation and Polymorphism Detection: The PCR products free of contaminating bands due

to non specific amplification were directly sequenced in forward and reverse direction in


1217


DNA Analyzer 3730 (Applied Biosystems, USA) . Nucleotide changes were detected by

comparing sequence obtained in chromatogram with the normal BRCA1 gene sequence using

pair-wise BLAST (Tatusova et al., 1999) and SeqScape software v2.5. Appropriate statistical

techniques have been applied for analyzing the data using the statistical software SPSS 17.0

version.

RESULTS

A total of 108 breast cancer patients with histopathologically confirmed carcinoma of the

breast and 128 controls without any family history of breast cancer were included in the

present study. The age of the breast cancer patients ranged from 30 to 72 years with a mean

age 54.04 (SD 10.38) years, and mean age of the controls were 54.10 (SD 8.65), ranging

between 32 to 72 years. Exon 13 of BRCA1 has been analysed by amplification using

designed primer followed by direct sequencing in ABI 3730. DNA sequencing results

confirmed the presence of a variant in exon 13 of BRCA1 gene. A C-T transition was found

in codon 1437 which results in the change of amino acid from Proline to Leucine (fig.2).

Figure 1. Showing the novel variant in exon 13 of BRCA1.

Table 1. Distribution of the SNP

Sujects CC CT Total pvalue OR unadjusted

P value

Patients 93 15 108 P=0.0053 2- 7.772

0.2000 (0.0643 to

0.6224)

P=0.0055 Controls 124 4 128

217 19 236

Table 1 demonstrated 13% of the patients had significant (p = 0.0053) change in SNP than

the controls (3.125%). The odds of having the SNP for breast cancer patients is 0.2000 times


1218


higher (95% CI: 0.0643 – 0.6224) than those who had no cancer and devoid of family history

of breast cancer. This novel variant (ss527767420 has already been submitted to NCBI

genBank.

Table 2. Socio-demographic characteristics of the subjects.

Socio demographic

characteristics

Cases Controls pValue

No. % No. %

Marital Status

Ever Married 96 88.9 127 100 p=0.0015

Never Married 12 11.1 0 0

Occupation

Home maker 103 95.4 61 47.7 p=0.0001

service 2 1.9 32 25

others 3 2.8 35 27.6

Caste

Brahmin 23 21.3 30 23.4 p=0.5058

Kayastha 60 55.6 67 52.3

Baidya 15 13.9 23 18

Baishya 8 7.4 4 3.1

SC 2 1.9 4 3.1

Educational Level

Non-literate 3 2.8 4 3.1

Primary level 11 10.2 9 7.0 p=0.7902

Secondary 26 24.1 34 26.6

Higher Secondary 26 24.1 37 28.9

Diploma/Degree 42 38.9 44 34.4

Family History

Yes 72 66.7 0 0 p=0.0001

No 36 33.3 128 100

Socio demographic characteristics of the participants has been presented in Table 2. The

present study revealed no significant differences in age and caste and educational status

between cases and controls. But occupation (p=0.0001) and family history (p=0.0001)


1219


demonstrated significantly in single women (11.1%) and as well married women (88.9%)

among the breast cancer patients in comparison to controls.

Table 3. Reproductive and Lifestyle Characteristics of the studied subjects.

Reproductive chracters Cases (n= 108) Controls (n=128) p Value No. % No. %

Menarche 08 - 10 years 18 16.7 3 2.3 p=0.0001 11 - 13 years 80 74.1 97 75.8 14 and above years 10 9.3 28 21.9 Menstrual Cycle Regular 53 49.1 104 81.3 p=0.0002 Irregular 55 50.9 24 18.8 Menopausal Status Pre-Menopause 10 9.3 28 21.9 p=0.006 Post Menopause 98 90.7 100 78.1 Age at Menopause <50 years 71 65.7 68 53.1 p=0.025 >50 years 27 25 32 25 NA 10 9.3 28 21.9 Post Menopausal Therapy Yes 32 29.6 23 18 p=0.054 No 76 70.4 104 82 Abortions Yes 22 20.4 3 2.3 p=0.0001 No 86 79.6 125 97.7 Parity Parous 85 78.7 128 100 p=0.0001 Nulliparous 23 21.3 0 0 Number of Issues 1 35 32.4 42 32.8 p=0.0002 2 to 4 43 39.8 84 65.6 5 and above 7 6.5 2 1.6 none 23 21.3 0 0 Oral Contraceptive Use Yes 70 64.8 56 43.8 p=0.0019 No 38 35.2 72 56.3 Alcohol and Smoking Smoking 31 28.7 26 20.3 P=0.0013 Alcohol 19 17.6 68 53.1 No 58 53.7 34 26.6

Table 3 showed the reproductive performance and lifestyle variables of the patients and

controls. There were significant (p=0.0001) differences between cases and controls in terms

of abortions, such as patients underwent higher abortions (20.4%) than controls (2.3%).

Significant differences (p=0.0001) exist in age at menarche, more number of cases attained


1220


menarche within 8 – 10 years of age (16.7%) than controls (2.3%), while control females

attained menarche at 14 years of age or above (21.9%) in comparison to cases (9.3%).

Significantly (p = 0.0001) of the breast cancer patients were nulliparous and no controls

reported of null Significant differences exist in menopausal status of the women (p=0.006),

post menopausal women were 0.3644 times higher risk of developing breast cancer than pre

menopausal women (95% CI – 0.1681 – 0.7902). Furthermore, higher incidences of irregular

menstruation of the patients (50.9%) has been noticed in comparison to the controls (18.8%).

Hence, the present study envisaged that women with irregularity in menstrual periods were

0.2224 times higher risk of having breast cancer than women with regular menstrual cycles

(95% CI – 0.1242 – 0.3982). Prolonged oral contraceptive use of the patients (64.8%) was

found to be significantly higher (p = 0.0019) than the controls (18%). Alcohol and smoking

practice (p=0.0018), post menopausal therapy (p=0.0540) were found to be also significantly

associated with the breast cancer in the present study.

Table 4. Binary Logistic regression analysis of Risk factors for breast Cancer.

Risk Factors ODDS Ratio 95% CI pValue

Abortions 1.303 1.226 – 11.039 0.030 Oral Contraceptive Use 1.068 1.131 – 2.902 0.025

Binary Logistic Regression analysis (Table 4) was performed to study the significant

predictors associated with the risk of breast cancer among the carriers of the novel mutation.

The result revealed that there are some lifestyle variables like abortions and prolong use of

oral contraceptives, which can significantly (p<0.030 and p<0.020) predict the risk associated

with the mutation.

Women with the variant who underwent abortions are likely to have 1.303 times more risk

(OR = 1.303; 95% CI = 1.226 – 11.039) of developing breast cancer in their lifetimes than

those who didn’t experience abortions. Again, women carrying the mutation, who have

administered oral contraceptive pills for a longer period of time, are 1.068 times (OR = 1.068;

95% CI = 0.131 – 2.902) more likely to have breast cancer than those who never had oral

contraceptives.

DISCUSSION

In the present study we have identified a novel variant (ss527767420) in exon 13 of BRCA1

gene. Many studies have shown that there is a substantial inter-individual variability in cancer


1221


risk among BRCA1 mutation carriers. Even among those carrying the same deleterious

mutation, there is large variation in age at diagnosis and cancer type. This suggests that there

are additional genetic and environmental factors that modify risk; therefore such study

attracts medical and genetic attention. So, the present study attempted to understand the

possible predictor variables associated with BRCA1 mutation carriers.

Among the well established risk factors of breast cancer, prolong oral contraceptive usage

and abortions were significantly associated with the higher risks of breast cancer among the

carriers of germline BRCA1 mutation in the present study. Furthermore, univariate analysis,

however, demonstrated several variables, such as age at menarche, menaopausal status,

regularity of menstrual periods, parity, number of issues, post menopausal therapy were

found significantly (p<0.001) associated with breast cancer., Several epidemiological studies

have reported that induced or spontaneous abortions are risk factors for breast cancer in

general population (Darling et al., 1994; Newcomb et al., 1996). Induced and

spontaneous abortion increases the risk of developing breast cancer. In early pregnancy,

levels of estrogen increase, leading to breast growth in preparation for lactation. The

hypothesis proposes that if this process is interrupted by an abortion before full maturity in

the third trimester then more relatively vulnerable immature cells could be left than there

were prior to the pregnancy, resulting in a greater potential risk of breast cancer over time.

Though many studies have reported association between abortion and breast cancer risk, the

exact influence is still unclear.

A woman's risk of developing breast cancer depends on several factors, many of which are

related to her natural hormones. Hormonal risk factors include conditions that allow high

levels of estrogen to persist for long periods of time, such as early age at first menstruation

(before age 12), late age at menopause (after age 55), having children after age 30, and not

having children at all. Many of the risk factors for breast cancer are related to natural

hormones, and because Oral Contraceptives work by manipulating these hormones, there has

been some concern about the possible effects of medicines such as Oral Contraceptives on

breast cancer risk, especially if women take them for many years. OCs were introduced in the

1960s, and sufficient time has now elapsed to allow investigators to study large numbers of

women who took birth control pills for many years beginning at a young age and to follow

them as they age. Use of oral contraceptives increases the hormonal levels. Because

hormones are considered to play a role in the etiology of breast cancer, it seems likely that


1222


BRCA1 may be important regulators of growth and differentiation in hormonally responsive

epithelial cells. Breast and ovary being the main estrogen receptor sites, the increased levels

of the estrogen due to prolonged consumption of oral contraceptives gets accumulated in

these sites (Marquis et al., 1995; Rajan et al., 1997). For the females those have mutated

tumor suppressor genes, BRCA1, the gene already fails to perform its tumor suppressing

activity, elevated estrogen and progesterone stimulate breast cell proliferation, finally

uncontrolled growth leads to carcinoma. Several studies have found association between the

OC usage among the BRCA1 mutation carriers, though limited reports are available from

India (Narod et.al., 2002; McLaughlin et al., 2007; Modan et al., 2001). However, most

studies found no or weak association of OC use among BRCA1 mutation carrier in Breast

Cancer (Haile et.al., 2006; Figuiredo et al., 2009; Grenader et al., 2005).

This is the first report of Breast cancer risk assessment among the BRCA1 mutation carriers

among Bengalee females from West Bengal, India. The present study reports a novel variant

in exon 13 of BRCA1 gene, which indicates that exon 13 is likely to play an important role in

carcinogenesis of breast. As known not all individual with germline mutation in BRCA1

develops breast cancer during their lifetimes (risk being 10 – 15%), certain lifestyle variables,

socio-demographic and reproductive factors modify the risk. The present study vindicated

oral contraceptive use and abortions as significant predictors for females carrying the novel

germline mutation. Since it is known that germ line mutations are non-modifiable risk factor,

, therefore modification of the lifestyle variables could reduce the risk of developing the

disease during the lifetime. Therefore, the present study could be taken as one of the early

prognosis for the detection of the mutation and modification of the lifestyle factors among the

Bengalee Hindu females of West Bengal, India.

ACKNOWLEDGEMENT

This research work is supported by the grant from Anthropological Survey of India, Ministry

of Culture, Government of India. I am thankful to the patients with Breast Carcinoma and

control subjects for voluntarily taking part in this research work and donating their blood

samples.

REFERENCES

1. Atkinson HG. Alcohol’s “darker side”( 2003). A drink a day may raise a woman’s risk of

breast cancer. Health News 9(1):4.


1223


2. Bernstein L, Pike MC, Ross RK, Judd HL, Brown JB, Henderson BE.(1985). Estrogen

and Sex hormone-binding globulin levels in nulliparous and parous women. J Natl Cancer

Inst. 74:741-5.

3. Boulanger CA, Wagner KU, Smith GH(2005.). Parity –induced mouse mammary

epithelial cells pluripotent, self-renewing and sensitive to TGF-beta1 expression.

Oncogene. 24:552-560.

4. Cavalieri E, Frenkel K, Liehr JG, Rogan E, Roy D (2000). Estrogens as endogeneous

genotoxic agents- DNA adducts and mutations. J Natl Cancer Inst Monogr. 27:75-93.

5. Chen WY, Colditz GA, Rosner B, Hankinson SE, Hunter DJ, Manson JE, Stampfer MJ,

Willett WC, Speizer FE (2002). Use of post menopausal hormones, alcohol, and risk for

invasive breast cancer. Ann Intern Med 137 (10): 798-804.

6. Collaborative Group on Hormonal Factors in Breast Cancer, 1996. Breast Cancer and

hormonal contraceptives: collaborative reanalysis of individual data on 53,297 women

with breast cancer and 100239 women without breast cancer from 54 epidemiological

studies. Collaborative Group on Hormonal Factors in Breast Cancer. Lancet. 347:1713-

27.

7. Consolidated Report of Population Based Cancer Registries (2001-2004). National

Cancer registry Programme, Indian Council of Medical Research.

8. Daling JR, Malone KE, Voigt LF, White E, Weiss NS (1994). Risk of breast cancer

among young women: relationship to induced abortion. J Natl Cancer Inst. 86(21):1569-

1570.

9. Fan S, Ma YX, Wang C et al (2001). Role of direct interaction in BRCA1 inhibition of

estrogen receptor activity. Oncogene. 20:77-87.

10. Ferlay J, Parki DM, Steliarova-Foucher E (2008). Estimates of the cancer incidence and

mortality in Europe in 2008. Eur J Cancer 46(4):765–781.

11. Garcia-Closas M, Herbstman J, Schiffman M, Glass A, Dorgan JF.(2002). Relationship

between serum hormone concentrations, reproductive history, alcohol consumption and

genetic polymorphisms in premenopausal women. Int j Cancer. 102:172-8.

12. Grenadar T, Peretz T, Lifchitz M, Shavit L (2005). BRCA1 and BRCA2 germ-line

mutations and oral contraceptives: to use or not to use. The Breast. 14: 264-268.

13. Haile RW, Thomas DC, McGuire V, et al. (2006). BRCA1 and BRCA2 mutation carriers,

oral contraceptive use, and breast cancer before age 50. Cancer Epidemiol Biomarkers

Prev. 15(10):1863-70.


1224


14. Hamajima N, Hirose K, Tajima K, Rohan T, Calle EE, Heath CW Jr, Coates RJ, Liff JM,

Talamini R, Chantarakul N et al., (2002). Alcohol, tobacco and breast cancer

collaborative reanalysis of individual data from 53 epidemiological studies, including

58,515 women with breast cancer and 95,067 women without the disease. Br J Cancer

287: 1234-1245.

15. Henry MD, Triplett AA, Oh KB, Smith GH, Wagner KU (2004). Parity induced

mammary epithelial cells facilitate tumorigeneis in MMTV-neu transgenic mice.

Oncogene 23:6980-6985.

16. Huo D, Adebamowo CA, Ogundiran TO, Akang EE, Campbell O, Adenipekun A,

Cummings S, Fackenthal J, Ademuyiwa F, Ahsan H, Olopade OI (2008). Parity and

breastfeeding are protective against breast cancer in Nigerian women. Br J Cancer 98(5):

992-6.

17. Lee E, Ma H, Roberta MC, David VDB, Leslie B, Brian EH, Ursin. (2008). Effect of

reproductive factors and oral contraceptives on Breast Cancer risk in BRCA1/2 Mutation

Carriers and NonCarriers: Result from a Population –Based Study. 17(11):3170-78.

18. Lord SJ, Bernstein L, Johnson KA, Malone KE, McDonald JA, Marchbanks PA, Simon

MS, Strom BL, Press MF, Folger SG, Burkman RT, Deapen D, Spirtas R, ursine G

(2008). Breast Cancer risk and hormone receptor status in older women by parity, age of

first birth, and breastfeeding: a case-control study. Cancer Epidemiol Biomarkers Prev.

17(7): 1723-30.

19. Marquis ST, Rajan JV, Wynshaw-Boris A (1995). The developmental expression of

BRCA1 expression implies a role in differentiation of the breast and other tissues. Nat

Genet. 11:17-26.

20. Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, Liu Q,

Cochran C, Bennett LM, Ding W, Bell R, Rosenthal J, Hussey C, Tran T, McClure M,

Frye C, Hattier T, Phelps R, Haugen-Strano A, Katcher H, Yakumo K, Gholami Z,

Shaffer D, Stone S, Bayer S, Wray C, Bodgen R, Dayananth P, Ward J, Tonin P, Narod S,

Bristow PK, Norris FH, Helvering L, Morrison P, Rosteck P, Lai M, Barrett JC, Lewis C,

Neuhausen S, Cannon-Albright L, Goldgar D, Wiseman R, Kamb A and Skolnick MH

(1994): A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1.

Science 266:66-71

21. Modan B, Hartage P, Hirish-Yechezkel G et.al. (2001). National Israel Ovarian Cancer

Study Group. Parity, oral contraceptives and the risk of ovarian cancer among carriers

and noncarriers of a BRCA1 or BRCA2 mutation. N Engl J Med. 345: 235-40.


1225


22. Mcpherson K, Steel CM, Dixon JM (2000). Breast cancer epidemiology, risk factors and

genetics. Br Med J. 321: 624-628.

23. McLaughlin JR, Risch HA, Lubinski J, Moller P, Ghadirian P, Lynch H, Karlan B,Fishma

n D, Rosen B, Neuhausen SL, et al. (2007). Reproductive risk factors for ovarian cancer

in carriers of BRCA1 or BRCA2 mutations: a case–control study. Lancet Oncol;8:26-34.

24. Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, Liu Q,

Cochran C, Bennet LM, Ding W, Bell R, Rosenthal J, Hussey C, Tran T (1994). A strong

candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 266

(5182): 66-71.

25. Narod SA, Dube MP, Klijn J et al (2002). Oral Contraceptives and the risk of Breast

Cancer in BRCA1 and BRCA2 mutation carriers. Journal of the National Cancer Institute.

94(23):1173-1179.

26. Newcomb PA, Storer BE, Longnecker MP, Mittendorf R, Greenberg ER, Willett WC

(1996). Pregnancy termination in relation to risk of breast cancer. JAMA. 275:321-322.

27. Palma M, Ristori E, Ricevuto E, Giannini G, Gulino A (2006). BRCA1 and BRCA2: the

genetic testing and the current management options fro mutation carriers. Crit Rev Oncol

Hematol. 57(1): 1-23.

28. Parkin DM, Bray F, ferlay J, Pisani P (2001). Estimating the world cancer burden:

GLOBOCAN. Int. J. Cancer 94: 153-156.

29. Rajan JV, Marquis ST, Gardner HP, Chodosh LA (1997). Developmental expression of

BRCA2 colocalizes with BRCA1 and is associated with profileration and differentiation

in multiple tissues. Dev Biol. 184:385-401.

30. Sambrook J, Russel DW (2001) Molecular cloning: a laboratory manual. In: Irwin N (ed)

Science. Cold Spring Harbor Press, Cold Sprig Harbor, NY.

31. Samson M, Swaminathan R, Rama R, Sridevi V, Nancy KN, Rajkumar T.(2007). Role of

GSTM1 (Null/Present), GSTP1 (IIe105Val) and P53 (Arg72Pro) Genetic Polymorphisms

and the Risk of Breast Cancer – A Case Control Study from South India. 8:253-257.

32. Tatusova T, Madden T. (1999) BLAST 2 sequences a new tool for comparing protein and

nucleotide sequences. FEMS Microbiol Lett 174:247–250.

33. Welcsh P, King MC (2001). BRCA1 and BRCA2 and the genetics of breast cancer and

ovarian cancer. Hum Mol Genet. 10: 705-713.

34. Winer EP, Morrow M, Osborne CK, Harris JR (2000). Cancer of the breast; Section 2,

Malignant tumors of the breast, in: T.V. Devita (Ed.), Cancer: Principles & practice of

oncology, sixth ed., J.B. Lippcott, Philadelphia, pp. 1651-1659.


1226


35. Yager JD, Davidson NE (2006). Estrogen carcinogenesis in breast cancer. N Engl J Med.

354:270-82.

36. Yoshida K, Miki Y (2004). Role of BRCA1 and BRCA2 as regulators of DNA repair,

transcription, and cell cycle in response to DNA damage. Cancer Sci. 95:866-71.

8. brest cancer - hindu female-2014

Documents

breast cancer risk

introduction breast

cancer registries

common cancer

early onset of breast

breast carcinogenesis

brca1 mutation carriers

urban india